ID: 1091051736

View in Genome Browser
Species Human (GRCh38)
Location 11:132378728-132378750
Sequence AATTATTTGTAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091051736_1091051742 25 Left 1091051736 11:132378728-132378750 CCTGCCATCTTCTACAAATAATT No data
Right 1091051742 11:132378776-132378798 GGCCTGTTACTGAGCTTTGGTGG No data
1091051736_1091051739 4 Left 1091051736 11:132378728-132378750 CCTGCCATCTTCTACAAATAATT No data
Right 1091051739 11:132378755-132378777 TCCTTTTGAGAGGCAGCTTTTGG No data
1091051736_1091051741 22 Left 1091051736 11:132378728-132378750 CCTGCCATCTTCTACAAATAATT No data
Right 1091051741 11:132378773-132378795 TTTGGCCTGTTACTGAGCTTTGG No data
1091051736_1091051738 -6 Left 1091051736 11:132378728-132378750 CCTGCCATCTTCTACAAATAATT No data
Right 1091051738 11:132378745-132378767 ATAATTACTCTCCTTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091051736 Original CRISPR AATTATTTGTAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr