ID: 1091054367

View in Genome Browser
Species Human (GRCh38)
Location 11:132404519-132404541
Sequence TCCTATTGGGTGATCCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091054364_1091054367 -1 Left 1091054364 11:132404497-132404519 CCAGTCTGCTTCATTCTTGGCTT No data
Right 1091054367 11:132404519-132404541 TCCTATTGGGTGATCCATGATGG No data
1091054363_1091054367 0 Left 1091054363 11:132404496-132404518 CCCAGTCTGCTTCATTCTTGGCT No data
Right 1091054367 11:132404519-132404541 TCCTATTGGGTGATCCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091054367 Original CRISPR TCCTATTGGGTGATCCATGA TGG Intergenic
No off target data available for this crispr