ID: 1091055354

View in Genome Browser
Species Human (GRCh38)
Location 11:132413109-132413131
Sequence TAGGAAAAGCATGCGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091055354_1091055361 27 Left 1091055354 11:132413109-132413131 CCCAACTCCGCATGCTTTTCCTA No data
Right 1091055361 11:132413159-132413181 TGCCCTTAATATATCTCCAGAGG No data
1091055354_1091055358 -4 Left 1091055354 11:132413109-132413131 CCCAACTCCGCATGCTTTTCCTA No data
Right 1091055358 11:132413128-132413150 CCTACTTAATACACCTTGATAGG No data
1091055354_1091055359 2 Left 1091055354 11:132413109-132413131 CCCAACTCCGCATGCTTTTCCTA No data
Right 1091055359 11:132413134-132413156 TAATACACCTTGATAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091055354 Original CRISPR TAGGAAAAGCATGCGGAGTT GGG (reversed) Intergenic
No off target data available for this crispr