ID: 1091055975

View in Genome Browser
Species Human (GRCh38)
Location 11:132419550-132419572
Sequence AAATCTCTGCAGATGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 1, 2: 3, 3: 17, 4: 312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091055975 Original CRISPR AAATCTCTGCAGATGGTGGA AGG Exonic
900240093 1:1612469-1612491 GAATCTGTTCAGTTGGTGGAGGG + Intergenic
901696925 1:11014786-11014808 AAATCTCTGGATGTGGTGGTGGG + Intronic
903677381 1:25072845-25072867 AAAGCTCTGGAGTTGGGGGACGG - Intergenic
904302117 1:29561203-29561225 CAATCTCTGGAGAAGGGGGATGG + Intergenic
907138792 1:52164989-52165011 AAATTTCTGAAGATGGTTGGAGG + Intronic
908209648 1:61887185-61887207 TAGTCTGTGGAGATGGTGGAGGG + Intronic
910508300 1:87975740-87975762 TTATCTCTGAAGATGGAGGAAGG - Intergenic
911686119 1:100779792-100779814 CAATCTTTGCAGAAGGTGAAAGG + Intergenic
913386421 1:118262820-118262842 GATTCTCTGCAGATAGTGGCTGG - Intergenic
914255526 1:145959157-145959179 ATATATCTGCTGATGATGGAGGG + Intergenic
914439667 1:147693362-147693384 TAAGCTCTGCAGTTGGAGGAGGG - Intergenic
914719325 1:150276456-150276478 GAATCTATGAAGATGTTGGATGG + Intronic
915214306 1:154329637-154329659 AAATGTGTGCAGATGGTACAAGG + Intronic
917329613 1:173868262-173868284 AAAGCTCTGGGGATGGGGGAAGG + Intronic
917767951 1:178243960-178243982 AAATATCTGCAGTTGTTGAATGG + Intronic
917846005 1:179020739-179020761 AAATTTTTGCAGATGGGGGCAGG + Intergenic
917960961 1:180144226-180144248 CAAGCTCTGCAGTTGGTGGTTGG - Intergenic
918170283 1:181989765-181989787 ATATGGGTGCAGATGGTGGAAGG - Intergenic
918327327 1:183422377-183422399 AAATTTTTACACATGGTGGAAGG - Intergenic
919267452 1:195288994-195289016 TTATCTCTGAAGATGGAGGAAGG + Intergenic
920079020 1:203358691-203358713 GAATCTCTGCAGACGGTGCCTGG + Intergenic
920689813 1:208137350-208137372 AAATCTATACACAGGGTGGATGG - Intronic
920809414 1:209268136-209268158 ACACCACTGCAGATAGTGGATGG + Intergenic
922472547 1:225885604-225885626 AAAGCTCTGCAAATTGAGGAAGG - Intergenic
924817454 1:247455148-247455170 AAATCTCTGCTGAAGCTTGACGG + Intergenic
1062891775 10:1067065-1067087 ATATCACTGCCGTTGGTGGAAGG + Intronic
1063464822 10:6236308-6236330 GCATCTCTGCAGATGGGGCAGGG + Intergenic
1063521699 10:6747369-6747391 GCAGCTCAGCAGATGGTGGAAGG - Intergenic
1063700796 10:8383495-8383517 GAATCTCAGCAGATGAAGGAAGG - Intergenic
1064872055 10:19948505-19948527 ACATCTCTATTGATGGTGGATGG + Intronic
1065109479 10:22425659-22425681 AAATCACAGCAGTTGGAGGATGG - Intronic
1065495366 10:26321944-26321966 AAATCTATGCAGCTGGTTGCTGG - Intergenic
1065526272 10:26624420-26624442 AAATGTCTCCAAATGGGGGATGG + Intergenic
1068747362 10:60548358-60548380 AAATAGCTGCACATGGTGGTGGG - Intronic
1070006254 10:72427094-72427116 AAAACAATGCAGATGGTGGGTGG - Intronic
1070226556 10:74514381-74514403 AAATATCTCCAGAAGGTGAAGGG - Intronic
1071286880 10:84157016-84157038 AGCTCTCTGTAGAAGGTGGAAGG - Intergenic
1072190230 10:93072242-93072264 AAATATCTGCAGAGGTCGGAGGG - Intergenic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1073319067 10:102603006-102603028 AAATCTCTACAGATATTGGCAGG - Intronic
1074258861 10:111831964-111831986 AAATCACAGCAGAAGGTGAAGGG + Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1075261672 10:120968708-120968730 AATTATCTGCAGATGGTATATGG + Intergenic
1075496258 10:122922146-122922168 AAATCTGTGCACTTGGTGGGAGG + Intergenic
1075951434 10:126481131-126481153 CAAGATCTGCAGATGATGGAAGG - Intronic
1076213630 10:128674170-128674192 GAATTTCTGCAGATGGAGGGTGG + Intergenic
1076592405 10:131593325-131593347 TAATTTCTGCATATGGTGTAAGG + Intergenic
1076592722 10:131598025-131598047 TAATTTCTGCATATGGTGTAAGG + Intergenic
1077022530 11:424897-424919 AAATCTCTCCAGATGTTACAAGG + Intronic
1077719996 11:4618448-4618470 ACATCTTTGCAGATTGGGGAAGG - Intergenic
1078139981 11:8685189-8685211 AAATCTCTTCAGATAATGCATGG - Intronic
1078587122 11:12601401-12601423 CAATCCCTGGAGCTGGTGGAAGG - Intergenic
1078697463 11:13648781-13648803 AAATCACGGCAGAAGGTGCAGGG - Intergenic
1079319881 11:19442908-19442930 ACATTTCTCCCGATGGTGGAAGG - Intronic
1079906596 11:26255850-26255872 AAATCACAGCAGATGCTAGAGGG + Intergenic
1081073826 11:38643173-38643195 GAATCTGTGCACTTGGTGGAAGG - Intergenic
1081571462 11:44294012-44294034 AGAGCTCTGTAGACGGTGGAGGG - Intronic
1081575097 11:44314222-44314244 CCAGCTCTGCAAATGGTGGAAGG + Intergenic
1081982994 11:47281606-47281628 AAATTTCTCCAGATTGAGGATGG - Exonic
1082810529 11:57476678-57476700 AGATCTCGGTAGAGGGTGGAGGG - Exonic
1083689454 11:64398163-64398185 TGATCTGTGCAGAAGGTGGAAGG + Intergenic
1083950690 11:65953931-65953953 CAATCTCTGCAGCTGTTGAATGG + Intronic
1084437968 11:69155166-69155188 ACATCACTGCTGATGGTGGGGGG + Intergenic
1084992378 11:72939574-72939596 AAATCTATGAAGACGGTTGATGG + Intronic
1085010739 11:73140709-73140731 AAAGCACTGCATATGCTGGAAGG - Intronic
1085273743 11:75285270-75285292 AGCACTCTGCAGATTGTGGAAGG + Intronic
1085806486 11:79641559-79641581 AAAAATCTGCAGATGGTGTAAGG - Intergenic
1086143428 11:83524316-83524338 GAATCTCTGGAGATGGGGGCAGG - Intronic
1087117169 11:94537831-94537853 AACTCTCTCCAGATGGAGGAAGG - Intergenic
1087739185 11:101868400-101868422 AAAAATCTGGAGTTGGTGGAGGG + Intronic
1087902934 11:103663071-103663093 ACATCTCTGCAGTTGGCCGAGGG - Intergenic
1089108553 11:116035991-116036013 AAATATCAGCAGTTGGGGGAGGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1091055975 11:132419550-132419572 AAATCTCTGCAGATGGTGGAAGG + Exonic
1091953104 12:4611823-4611845 AAATATTTTCAGATGGTTGAAGG + Intronic
1093885517 12:24455599-24455621 AAATCTCTGCACATAGTTGGAGG - Intergenic
1094172213 12:27505570-27505592 AACTCTCAGCAGATGGGGAATGG - Intergenic
1094231272 12:28106409-28106431 AAATGTCTCCAGATAGTTGAAGG - Intergenic
1094335953 12:29353863-29353885 AAAACTCTGCATAGGGAGGATGG + Intronic
1094449057 12:30564736-30564758 AAATCTTTGTAGATGCTTGAAGG + Intergenic
1099237284 12:80096520-80096542 ACATCTCTGCCAATGGTAGAGGG + Intergenic
1100354758 12:93818624-93818646 AAATATCTGCAGAGGGGGCAAGG + Intronic
1100686762 12:96995029-96995051 ATATCTCTGCAGAGGGAGGAGGG - Intergenic
1102219336 12:111183808-111183830 AAATATCTGCAGGGGGTGGTGGG - Intronic
1103486303 12:121285126-121285148 AAATCTCTGAAGCTGATGGTGGG - Intronic
1103741508 12:123094646-123094668 GCATCTGTGCAGATGGAGGACGG - Intronic
1104157472 12:126147730-126147752 ATATCTCTGCAGATGTATGAGGG - Intergenic
1104365086 12:128169554-128169576 GTATCTCTGCAGATGGATGAGGG - Intergenic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1106489166 13:30201171-30201193 CACTCTCTGCAGTTAGTGGAGGG - Intergenic
1106567861 13:30902149-30902171 AAATCTTTGCAGTTGGGGTAGGG - Intergenic
1107494912 13:40916867-40916889 AAATCTCAGCAGATGGTTTTCGG - Intergenic
1107711718 13:43157111-43157133 AGATATCTACAGATGGTGGGTGG - Intergenic
1109640913 13:65190575-65190597 ATTTCTCTGCATATGTTGGATGG - Intergenic
1109956279 13:69571086-69571108 ACTTCTCTGAGGATGGTGGAGGG + Intergenic
1110146156 13:72192862-72192884 GAACCTATGAAGATGGTGGAGGG + Intergenic
1110966258 13:81701143-81701165 AAATCTCTGCAGATAGGGCTGGG - Intergenic
1111613513 13:90636158-90636180 AAATCACTGCTAGTGGTGGAAGG + Intergenic
1111667718 13:91290885-91290907 AAATTTCTACAGAAAGTGGAAGG - Intergenic
1111738568 13:92173784-92173806 AAATATTTGCAGAATGTGGAAGG + Intronic
1112052557 13:95657329-95657351 AAATCTCAGCAAAAGGTGGAAGG - Intergenic
1112370223 13:98787434-98787456 AAATCACGGCAGAAGGTGAAGGG - Intergenic
1113232342 13:108226718-108226740 ACATCTCAGCAGATGGTGCATGG + Intronic
1115509394 14:34124937-34124959 AAATCTCTGAGAATCGTGGAGGG + Intronic
1115853129 14:37603053-37603075 AAATTCCTGCAGGTGCTGGATGG + Intronic
1116626331 14:47269046-47269068 AAATCTCTGTGGATTGAGGAAGG + Intronic
1120594312 14:86415290-86415312 AAATCACGGCAGAAGGTGAAAGG + Intergenic
1121551637 14:94807215-94807237 AAATGTTTGCAGAAGGTAGAAGG - Intergenic
1122889260 14:104724917-104724939 CAAGGTCTGCAGGTGGTGGAGGG + Intronic
1123968967 15:25486714-25486736 GAATCCCTGCAGATCTTGGACGG + Intergenic
1124689866 15:31812786-31812808 AAAGCTCCTCACATGGTGGATGG - Intronic
1125104446 15:35954297-35954319 AAATCTCTGGTGAAGGTGAAGGG - Intergenic
1126161345 15:45616529-45616551 AGATTTCTCCAGATGGTGGTGGG - Intronic
1126803945 15:52326610-52326632 AAAGCTCTGGAGATGGATGATGG + Intronic
1128226551 15:66005618-66005640 AAACCTTTTCAGATGGTGGCTGG + Intronic
1128360508 15:66958410-66958432 AAAGTTCTGCAGATGGAGGGTGG + Intergenic
1131108017 15:89747726-89747748 AAAAGGCTGCAGATGGTGGGTGG - Intergenic
1132376668 15:101332623-101332645 AAATGTCTGCAGAAGCTGGGTGG + Intronic
1134374058 16:13653405-13653427 GAATCTAGGCAGATGGAGGAAGG + Intergenic
1134555494 16:15160456-15160478 AATTCTCTGGGGATGGTGGCAGG - Intergenic
1138429834 16:56961744-56961766 AAAATGGTGCAGATGGTGGAGGG + Intergenic
1140520116 16:75573726-75573748 AGATCTCTGCAGAAGGTACAAGG + Intronic
1140763551 16:78133942-78133964 AAATCTCTTAAGAAGATGGAAGG - Intronic
1140953222 16:79838877-79838899 AAATTTCTGCATACGGTTGAAGG + Intergenic
1141593164 16:85081946-85081968 ATGTCGCTGCACATGGTGGACGG - Intronic
1145271683 17:21408082-21408104 AAGGCTCTGCAGGTGGTGGCTGG + Intronic
1145309899 17:21695546-21695568 AAGGCTCTGCAGGTGGTGGCTGG + Intronic
1147174248 17:38643076-38643098 TAATCTTTGCAAATGGTGTAAGG - Intergenic
1147817964 17:43223930-43223952 CACTCTCTGCAGAAGTTGGAAGG + Intergenic
1149128147 17:53260530-53260552 CAATCACTGCAGAAGGTGAAAGG - Intergenic
1149407532 17:56369076-56369098 AAATAGCTGGAGATGGTGTATGG - Intronic
1151149695 17:72074474-72074496 AAAAATCTGCAAATGATGGAAGG + Intergenic
1155737682 18:29244152-29244174 AAATTACTGCAGAAGGTGAAGGG - Intergenic
1157412549 18:47475635-47475657 AAAACTCTGAAGAGGGTGCAAGG - Intergenic
1157712246 18:49858077-49858099 AAGTCCCTTCAGATGGTGGGGGG - Intronic
1158667431 18:59445205-59445227 TAATTTTTGCAGATGGTGTAAGG + Intronic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1162196140 19:8986204-8986226 CAATCTGTGAAGATGGTAGAAGG - Intergenic
1164407982 19:27971666-27971688 AACTCTCAGCACATGCTGGAGGG + Intergenic
1166352644 19:42207341-42207363 AAAGCTCTGCAGATGGTAGAAGG + Intronic
1167508181 19:49882103-49882125 AAAGAGCTGCAGGTGGTGGAAGG - Exonic
925299699 2:2802455-2802477 AAATCACTGCAGATGTGGTAGGG - Intergenic
926390648 2:12388176-12388198 AAATCTAAGCAGATTGTGAAAGG - Intergenic
926759213 2:16262496-16262518 AAATCCCTGGGGATGGTGGCAGG + Intergenic
926774431 2:16407859-16407881 AATTCTGTGCAGATGCTGAAAGG - Intergenic
926951806 2:18251564-18251586 AAATCATGGCAGATGGTGAAGGG + Intronic
927081570 2:19635838-19635860 AGATCTCTGCACCTGGGGGATGG - Intergenic
928430997 2:31218263-31218285 AAATCTGTGCAAGTGGTGGTGGG - Intronic
929070943 2:38029881-38029903 CAATCACGGCAGAAGGTGGAAGG + Intronic
929419023 2:41772093-41772115 AAATCTTAGCAGATGGGGTAGGG + Intergenic
930052526 2:47227815-47227837 AAATGGCTGCAGAAGGAGGAGGG - Intergenic
931143146 2:59485792-59485814 AAATGTCTGCAGATGGGAGGAGG - Intergenic
931777997 2:65556469-65556491 AAATCTCTTAAGATGATGGTGGG + Intergenic
932235832 2:70120427-70120449 GATTCTCTGCAGATGGTTCATGG + Intergenic
933771038 2:85744081-85744103 AACTATCTGCAGGTGTTGGAAGG + Intergenic
934763600 2:96869017-96869039 AAATCCCTGGAGCTGGGGGAGGG - Intronic
935366056 2:102292103-102292125 AAATCACATCACATGGTGGAGGG + Intergenic
935640700 2:105287259-105287281 AAAGGTCTGGAGATGGTGGGTGG + Intronic
935675108 2:105588374-105588396 AATTCTCTGCTGCAGGTGGATGG + Intergenic
935835675 2:107050649-107050671 AAATCTCTGCACTTGGGGGATGG - Intergenic
936544749 2:113381279-113381301 AAATTTCTACACATGGTAGAAGG - Intergenic
936631243 2:114205387-114205409 AAATCACTGGAAATGGGGGAGGG + Intergenic
937645786 2:124264706-124264728 AAACCACTGCAGATGGTTGAGGG - Intronic
937704748 2:124906977-124906999 AAATCTGTAAAGATGATGGAAGG + Intronic
940144070 2:150526338-150526360 AAGTCTATTCAGATGGTTGAGGG + Intronic
941270009 2:163413866-163413888 ACATGTCTGCAGATTGTTGAGGG + Intergenic
941350645 2:164429840-164429862 AAATAACTGCAGGGGGTGGACGG + Intergenic
941539505 2:166765050-166765072 AAATTTTTGAAGATTGTGGAAGG - Intergenic
944397952 2:199290781-199290803 ATATTTCTGCAGATTGGGGAGGG - Intronic
944717875 2:202393117-202393139 TAGTCTCTGCAGTTGGTGTATGG + Intronic
945715380 2:213352067-213352089 AAACCTCTTCAGAGGGTGGCAGG - Intronic
945926432 2:215810165-215810187 AAATCACTGCAGCTAGTGGTAGG + Intergenic
946562929 2:220933481-220933503 AAATCTCTACAGGTGGTGTCTGG - Intergenic
946987632 2:225291001-225291023 AAATGTGTGTAGATGATGGAAGG + Intergenic
947049720 2:226028496-226028518 AAATGTCTGTGGATTGTGGAGGG - Intergenic
947210095 2:227700609-227700631 ATATCTTTCCAGATGTTGGAAGG - Intronic
947304705 2:228731290-228731312 AAATTTCTGCACATTGTTGATGG - Intergenic
947406304 2:229781103-229781125 GAGCCTCTGCAGAAGGTGGAAGG + Intronic
948104699 2:235404222-235404244 AAATAGCTGCACATGGTGGCGGG + Intergenic
948444013 2:238018094-238018116 AAGTCTCAGCAGGTGGTGGATGG - Intronic
1169533881 20:6515611-6515633 AAATTACTTCAGATTGTGGAAGG - Intergenic
1170219840 20:13930182-13930204 AAATCTCTTCAGAAGCAGGAAGG - Intronic
1171179724 20:23083896-23083918 AAAGCTCTGAGGATGGTGGCTGG + Exonic
1171397998 20:24851371-24851393 TAATTTTTGCATATGGTGGAAGG - Intergenic
1172574473 20:35997119-35997141 AAAGATCTGCAGAGGATGGAAGG - Intronic
1172648575 20:36487104-36487126 GAGGCTCTGCAGATGGAGGAGGG + Intronic
1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG + Intergenic
1174491060 20:50896074-50896096 AAATAGCTGCACATGGTGGCAGG + Intronic
1174860435 20:54086310-54086332 GAATCTCTGCAGGTGGGAGAAGG + Intergenic
1175652260 20:60735746-60735768 AAATCTCTGCAGAGCTGGGAGGG + Intergenic
1175742390 20:61429284-61429306 AAATCCATGCAGCTGGTGAAAGG + Intronic
1177183461 21:17768161-17768183 CAATCTCTCTAGAGGGTGGAAGG + Intergenic
1177494531 21:21872409-21872431 AGCTCTCTGGAGCTGGTGGAGGG + Intergenic
1178189421 21:30263465-30263487 GCATCTCTGCAGATGGTGGAGGG + Intergenic
1178676940 21:34639065-34639087 AAATCCCAGGAGCTGGTGGATGG + Intergenic
1182314837 22:29438695-29438717 AAATCTCTGAAGACGGGGGGTGG + Exonic
1182341616 22:29626445-29626467 AAATATCTGCAGATGGGGCTGGG - Intronic
1182695113 22:32193349-32193371 AAATCTCTGAAGACGGGGGGTGG - Intronic
1183559829 22:38563683-38563705 AAATTTGTGGAGATGGGGGAGGG - Intronic
1184443077 22:44530599-44530621 ACATCTCTTCTGATGGTGGGGGG - Intergenic
1184463178 22:44651789-44651811 AACTTTCTGAAGATGGGGGAAGG - Intergenic
1184497890 22:44853303-44853325 AAATCACAGCAGATGATGTACGG - Intronic
1184940632 22:47762178-47762200 AAGTCTCTGCAGAAGGAGGTTGG - Intergenic
949170889 3:995103-995125 GCATCTCATCAGATGGTGGAAGG - Intergenic
950218643 3:11177926-11177948 AAATCTCTTCAGAGGGAGGTGGG - Intronic
950587615 3:13906210-13906232 TAATTTCTGCATATGGTGTAAGG - Intergenic
951351796 3:21615283-21615305 CAATCATGGCAGATGGTGGAGGG - Intronic
952205009 3:31172469-31172491 ATTTCACTGCAGATGGGGGAAGG + Intergenic
952747179 3:36792457-36792479 AAATCAATGCAGATGGTGCAGGG - Intergenic
953569304 3:44058645-44058667 AGAGCTCTGCAGGTGGTGGGAGG - Intergenic
955816209 3:62846083-62846105 AAATGTCTTCACATGGTGGCAGG - Intronic
955852739 3:63238475-63238497 ATATCTCAGCAGATGGGAGAGGG - Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956486545 3:69728927-69728949 AGATCTATGCAGATGTGGGAGGG - Intergenic
956875876 3:73462695-73462717 ACCTCTCTGCATGTGGTGGAAGG + Intronic
957279233 3:78128348-78128370 AAACTTCTTCACATGGTGGAAGG + Intergenic
958681602 3:97339068-97339090 AAATCACTGAAGATGGTGAGAGG - Intronic
958995409 3:100898855-100898877 AAACCTCTGCAGCTGGTGGTTGG - Exonic
960132559 3:114072783-114072805 AAATGTTTGCTGATGGTGAATGG + Intronic
962254643 3:133862004-133862026 AATTCTCTGGAGATGGAGAAGGG - Intronic
962384828 3:134924114-134924136 TAATTTCTGCATAAGGTGGAAGG - Intronic
963533779 3:146502830-146502852 AAATTTCTACTCATGGTGGAAGG - Intergenic
964136981 3:153355059-153355081 AAAACTCAGCTGATGATGGACGG - Intergenic
965956622 3:174377895-174377917 GCATCTCTGCGGATGGTGGAGGG - Intergenic
968976822 4:3826368-3826390 AAATCTCCGAAGCTGGTGCAGGG - Intergenic
969995880 4:11312647-11312669 AAATCTCTTTGGCTGGTGGATGG + Intergenic
973766432 4:54167492-54167514 CCATGTCTGCACATGGTGGAAGG + Intronic
974772334 4:66433093-66433115 CAATCACAGCAGATGGTGAAAGG + Intergenic
975158310 4:71096229-71096251 AATTCTCTGCATAGGGTGGCTGG + Intergenic
975346298 4:73296168-73296190 AAATCCATTCAGATGGTTGAGGG - Intergenic
979073667 4:116242961-116242983 ATATACCTGCAGATGGTAGAGGG + Intergenic
980913127 4:139011208-139011230 GAATCTCTGGAGATGGGGTAGGG - Intergenic
982918247 4:161241991-161242013 AAATCTCTGTGGAGGGGGGAAGG - Intergenic
983333641 4:166363715-166363737 AAATCAGTGCAGTGGGTGGAGGG + Intergenic
983677415 4:170311939-170311961 AAGTCTCTTCAGATGGTAGAAGG - Intergenic
984897147 4:184551408-184551430 AAAGCTCTAGAGATGATGGATGG - Intergenic
987714520 5:21550054-21550076 AAAACTCAGCAGATTGTGGTGGG + Intergenic
990044335 5:51410587-51410609 AAATCCCTGTAGAGGGTGAAAGG - Intergenic
992141156 5:73798535-73798557 CATTCTCTGCAGATGCTGTAAGG + Intronic
992304910 5:75426838-75426860 AAAGCTCTGAAGATGGATGATGG + Intronic
993947450 5:94132675-94132697 AATTCTCTGCACATGGTGGCGGG - Intergenic
994498127 5:100538884-100538906 AAATCACTGTAGATGGTTGTTGG + Intronic
994944829 5:106374001-106374023 CGCTCTCTGCAGATGGAGGATGG - Intergenic
995613834 5:113939634-113939656 AAATCTCTGATGGTTGTGGAAGG - Intergenic
996095062 5:119389694-119389716 AAAGAGCTTCAGATGGTGGAGGG + Intronic
996204816 5:120719997-120720019 AAACCCCTGCACATAGTGGAAGG + Intergenic
998181405 5:139947999-139948021 AAAGCTCTGGAGATGGAGAATGG - Intronic
998237660 5:140413430-140413452 AAAGTTCTGGAGATGGTTGATGG - Intronic
998771697 5:145553000-145553022 AAATATCTGCAAAAGGTAGAAGG - Intronic
998881906 5:146653615-146653637 AAATCTCTGCAGACAATGCACGG - Intronic
1002320536 5:178372870-178372892 AAATCTCTGAAGCTGGGGGCTGG - Intronic
1002955148 6:1855145-1855167 CAATCTCTGCATATGGTGTCAGG + Intronic
1003259269 6:4502119-4502141 AAATTTCTGGAGATGGATGATGG - Intergenic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1003794303 6:9582614-9582636 ATGTGTCTGCAAATGGTGGATGG + Intergenic
1003906872 6:10709048-10709070 AAGGCTCTGCAGCTGGAGGAAGG - Exonic
1004021339 6:11778634-11778656 AAATCTTGGCAAATGGTGCAAGG - Exonic
1005508101 6:26487818-26487840 GGATCTATGCTGATGGTGGATGG - Intergenic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1005855191 6:29855634-29855656 ATTTCTCTACAGATTGTGGAAGG - Intergenic
1007627424 6:43254453-43254475 ACAGCTCTGCAGCTGGTGAAGGG - Intronic
1008653359 6:53586073-53586095 AAATCCCTGGAGGTGCTGGAGGG - Intronic
1008941684 6:57052784-57052806 AAATCACTGCAGATTGTCTAAGG + Exonic
1009002207 6:57732010-57732032 AAAACTCAGCAGATTGTGGTGGG - Intergenic
1010032501 6:71286257-71286279 AAAGGTATTCAGATGGTGGATGG + Intergenic
1010076815 6:71808346-71808368 AAATCATGGCAGATGGTGAAAGG + Intergenic
1010227103 6:73500614-73500636 AAATCTCAGCAGATTGATGATGG - Exonic
1010551630 6:77230392-77230414 AACTCTTTACAGATGGTGGGGGG + Intergenic
1011754737 6:90486919-90486941 CAATCTCTCCAGAAGCTGGAAGG - Intergenic
1011780816 6:90787377-90787399 AAATGTGTGCAGAGGGTAGAAGG + Intergenic
1012224374 6:96687973-96687995 AAATCTCTGCACTTGGGAGAGGG + Intergenic
1014600973 6:123411698-123411720 AGATACCTGCAGATGGTAGAGGG - Intronic
1015717856 6:136210648-136210670 AAGTCTCCACAGCTGGTGGAAGG + Intergenic
1015768278 6:136742477-136742499 TAATTTCTGCAGAGGGTGTAAGG - Intronic
1017443152 6:154483254-154483276 AAATGTCTGCATATGATGGCTGG - Intronic
1017506841 6:155076323-155076345 AAATGACTGTAGATGGTGCAGGG - Intronic
1018617155 6:165697763-165697785 AAAGCTCTGGAGATGGATGATGG + Intronic
1019131914 6:169883159-169883181 AAATCTTTGCAGATGGAGGAAGG + Intergenic
1019535574 7:1527922-1527944 AAATTTCTGGAGATGGATGATGG + Intergenic
1019867914 7:3730256-3730278 AAATTTCTGCAAATGATGGGAGG + Intronic
1020243410 7:6412667-6412689 GAATCTGATCAGATGGTGGAAGG + Intronic
1021038587 7:15832381-15832403 AAATCTCTGTAGATGAGGTATGG - Intergenic
1022320413 7:29282941-29282963 CAATATCAGCAGGTGGTGGATGG + Intronic
1022341584 7:29473389-29473411 AAATTTCTGGAGATGGGGGCTGG - Intronic
1023172857 7:37406219-37406241 AAAAATCTGCAGTTGGTGCAAGG + Intronic
1023228692 7:38000659-38000681 CAATCTATGCTGATGGGGGATGG + Intronic
1024401791 7:48932314-48932336 CAATGTCCTCAGATGGTGGAAGG + Intergenic
1027710928 7:81600505-81600527 AAATCCCTGCAGAAGGTGAAGGG - Intergenic
1029210370 7:98903394-98903416 TATTCTCAGCAGATGGTGAAAGG + Exonic
1031419762 7:121537425-121537447 AAATCTGTGGAGAAGATGGAAGG - Intergenic
1032657986 7:133952575-133952597 AAAGTTCTGCAGATGGATGATGG - Intronic
1034049623 7:147968766-147968788 AAATCTCTGTGAATGGTGGAGGG - Intronic
1034140118 7:148807745-148807767 AAGTCTCAGCACATGTTGGATGG - Intronic
1037586914 8:20283344-20283366 CTATGTCTTCAGATGGTGGAAGG - Intronic
1039033355 8:33332905-33332927 AGATATGTGCAGATTGTGGATGG - Intergenic
1039677534 8:39685788-39685810 ATATGTTAGCAGATGGTGGAGGG - Intronic
1040603737 8:48909840-48909862 TAATCTCTGAAGATGGAGGGGGG + Intergenic
1041623729 8:60001252-60001274 ACATACCTGCAGATGGTGGCTGG - Intergenic
1045453788 8:102355571-102355593 AAATCTTTGCAGTTTGTTGAAGG - Intronic
1046699751 8:117386842-117386864 AAATGTCTTCAGAAGGTGAAAGG - Intergenic
1047281113 8:123446524-123446546 AAAGCTCTCCAGAGGGAGGAGGG - Intronic
1049843739 8:144789892-144789914 GCATCTCTGCGGATGGTGGAGGG + Exonic
1050018524 9:1260523-1260545 AAATATCTGCCGATGGAGGCGGG + Intergenic
1050515394 9:6438219-6438241 ATATCTCTGAAGATGGAGAATGG + Intronic
1050808464 9:9714718-9714740 AGTTCTCTGCTGATGGTGGGAGG + Intronic
1050909079 9:11043635-11043657 ACATATCTGAAGAGGGTGGACGG - Intergenic
1051144075 9:14007803-14007825 AGCTCTCAGCAGATGGGGGAAGG - Intergenic
1051474558 9:17490843-17490865 AAATCTCTGCTATTGGTGGGGGG - Intronic
1051797709 9:20892518-20892540 AAGTCACTGCAGATGTGGGAGGG + Intronic
1055268948 9:74533962-74533984 AAATCTCTCCAAATAGTGGATGG + Intronic
1056383345 9:86075398-86075420 AAAGCTCAGCAGCTGGTGGTTGG - Intronic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1057623669 9:96658451-96658473 AAAGCTCTGGAGATGGATGATGG - Intergenic
1057906232 9:98985714-98985736 AAGTCCCTGAAGAAGGTGGATGG - Exonic
1057966534 9:99509280-99509302 TAATCTCTGCAGCATGTGGAAGG + Intergenic
1187045332 X:15642657-15642679 AAATCACTGGATATGGTGGCAGG + Intronic
1187504031 X:19864318-19864340 AAATCTTTGCAGGGGGTGGGGGG - Intronic
1187961721 X:24572325-24572347 AATCCTTTGCAGATGCTGGAAGG + Intronic
1189152035 X:38719153-38719175 AGAGCTCTCCAGATGGTGGTGGG + Intergenic
1189944354 X:46163048-46163070 AAAGCTCTGCAGAAGGTCAAGGG - Intergenic
1190151527 X:47954052-47954074 CTCTCTCTGCAGATGGTGGCAGG + Intronic
1193140176 X:78018823-78018845 AAATCTTGGCAGAAGGTGAAGGG + Intronic
1194077454 X:89414490-89414512 TAATCTTTGCATATGGTGAATGG - Intergenic
1197098628 X:122625132-122625154 AAATCACAGCAGAAGGTGAAGGG + Intergenic
1198203006 X:134440705-134440727 AAATCTCTGCAGATGGTGGGAGG + Intergenic
1198556625 X:137800018-137800040 CAATGTCTGGAGATGGAGGAGGG - Intergenic
1198811210 X:140538142-140538164 AGCTCTCTGCAGATGCAGGATGG + Intergenic
1199051617 X:143242917-143242939 CAATCACGGCAGATGGTGAAGGG + Intergenic
1199845152 X:151687554-151687576 GAATCTCTGAACCTGGTGGAGGG + Intergenic
1200129252 X:153831974-153831996 CGGTCTCTGCAGCTGGTGGATGG + Intergenic
1200327286 X:155254612-155254634 AATATTCTCCAGATGGTGGAGGG + Intergenic
1200430104 Y:3070029-3070051 TAATCTTTGCATATGGTGAATGG - Intergenic
1200544228 Y:4499027-4499049 TAATTTCTGCATATGGTGTAAGG - Intergenic
1202030955 Y:20573506-20573528 AAATCACTGTAGAAGGTGAAGGG + Intergenic