ID: 1091057145

View in Genome Browser
Species Human (GRCh38)
Location 11:132429930-132429952
Sequence AGCTAGAAGCAGACTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 347}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091057137_1091057145 10 Left 1091057137 11:132429897-132429919 CCCCGGGAAGACTGATAGGGCAG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG 0: 1
1: 0
2: 4
3: 39
4: 347
1091057133_1091057145 22 Left 1091057133 11:132429885-132429907 CCATAGGCTGACCCCCGGGAAGA 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG 0: 1
1: 0
2: 4
3: 39
4: 347
1091057138_1091057145 9 Left 1091057138 11:132429898-132429920 CCCGGGAAGACTGATAGGGCAGG 0: 1
1: 0
2: 3
3: 24
4: 199
Right 1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG 0: 1
1: 0
2: 4
3: 39
4: 347
1091057130_1091057145 29 Left 1091057130 11:132429878-132429900 CCTCTCACCATAGGCTGACCCCC 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG 0: 1
1: 0
2: 4
3: 39
4: 347
1091057136_1091057145 11 Left 1091057136 11:132429896-132429918 CCCCCGGGAAGACTGATAGGGCA 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG 0: 1
1: 0
2: 4
3: 39
4: 347
1091057129_1091057145 30 Left 1091057129 11:132429877-132429899 CCCTCTCACCATAGGCTGACCCC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG 0: 1
1: 0
2: 4
3: 39
4: 347
1091057140_1091057145 8 Left 1091057140 11:132429899-132429921 CCGGGAAGACTGATAGGGCAGGT 0: 1
1: 0
2: 0
3: 20
4: 130
Right 1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG 0: 1
1: 0
2: 4
3: 39
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091057145 Original CRISPR AGCTAGAAGCAGACTGAGGA AGG Intronic
900585711 1:3431330-3431352 GGCTGGAAGCAGAGTGTGGAGGG + Intronic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901896117 1:12313734-12313756 AGCTAGAAGCTGACAGATGAAGG + Intronic
903345806 1:22683611-22683633 AGCTACAAGAAGGCAGAGGAGGG - Intergenic
904322998 1:29708742-29708764 AGCTAGAAAAAGACTGAGCTGGG - Intergenic
904538782 1:31218866-31218888 AGCTAGCGGCAGCCTGGGGACGG + Intronic
904563552 1:31413931-31413953 AGCGCGAGCCAGACTGAGGACGG - Intronic
904823306 1:33258576-33258598 AGGTAGAAGGAGACTGAGACCGG + Intronic
904871352 1:33620774-33620796 AGCTAGAAGCAGACCCTGCAGGG - Intronic
905585914 1:39118246-39118268 AGCTAGCTGCAGCCTGAGCATGG + Intronic
905780122 1:40701403-40701425 AGCTAGAAGTAGAGTTAGAAAGG - Intronic
905893344 1:41530499-41530521 AGCTAGAAGAAGACAGAGTGAGG + Intronic
907450818 1:54544681-54544703 AGCTATAAGCAGGTTGTGGAGGG + Intronic
907472071 1:54680413-54680435 AGCTGGAGGCAGAGTCAGGACGG - Intronic
907525266 1:55050226-55050248 TGCTAGGAGCAGACTGAGCATGG + Intronic
907968005 1:59352226-59352248 AACAAGGTGCAGACTGAGGAAGG + Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909480032 1:76121037-76121059 AGCTGGAAGCAGAGTCAGAAAGG - Intronic
911133442 1:94414729-94414751 AGACCGAAGCAGATTGAGGAAGG - Intergenic
912847371 1:113087029-113087051 AGCTGTAAGGAGACTGAGGTAGG + Intronic
913509845 1:119551567-119551589 AGCTACTAGGAGACTGAGGCAGG + Intergenic
914434225 1:147646092-147646114 AGTAACCAGCAGACTGAGGATGG + Exonic
915801660 1:158800039-158800061 ACTTAGAAACAGACTGAGAATGG - Intergenic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916117793 1:161502470-161502492 AACTAGAACCCCACTGAGGAAGG + Intergenic
916464494 1:165060634-165060656 ACCCAGCAGCTGACTGAGGAGGG + Intergenic
918140082 1:181712821-181712843 AGCTGGCAGCAGACCCAGGAAGG + Intronic
918658109 1:187054095-187054117 AGCTAAAAGCAGACTACGGCAGG - Intergenic
919837404 1:201584651-201584673 TTCTAGAAACAGACTGAGGAGGG - Intergenic
920171397 1:204074337-204074359 AGCAAGAAGCAGCCTGCGGTGGG - Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920395839 1:205645318-205645340 TGCTATAAGGAGACTGAGGCAGG + Intergenic
920662310 1:207925773-207925795 AGCTAGTAGGAGGCTGAGGCAGG + Intergenic
920972139 1:210751936-210751958 AGCTGGATGTAGACTGAGGAAGG + Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
922009601 1:221568978-221569000 AGCTATAGCTAGACTGAGGAAGG + Intergenic
922292360 1:224218999-224219021 AGCTGAAAGCAGATGGAGGAGGG + Intergenic
923030373 1:230244734-230244756 ACCTAGAACCAGACTGAGCCAGG + Intronic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1064538510 10:16382768-16382790 AGCTACGAGCAGGCTGAGGTGGG + Intergenic
1064807989 10:19159425-19159447 GGCAATAAGCAGACTGAGGAAGG + Intronic
1065183283 10:23147871-23147893 ATCTAGGAGCAAAGTGAGGAAGG - Intergenic
1067748786 10:48956513-48956535 AGCAAGAAGCAGAGGGAGGAGGG - Intronic
1068092959 10:52455281-52455303 AGCAAGAAGCAGAGTGAGAGAGG - Intergenic
1068865940 10:61896094-61896116 ACCTAGAAGCAGAGTGGGTACGG - Intergenic
1068916571 10:62438825-62438847 TGTGAGAAGCATACTGAGGAAGG - Intronic
1070911664 10:80124406-80124428 AGCTACAGGAAGACTGAGGCAGG - Intergenic
1071226119 10:83530174-83530196 AGCTAGAAGCTAACAGAAGATGG - Intergenic
1072317356 10:94215676-94215698 AGCCAGCAGCAGAGAGAGGATGG + Intronic
1072880263 10:99219838-99219860 AGTTAGAAACAGACTAAAGAAGG - Intronic
1073064614 10:100750646-100750668 AGCCAGAAGCGGACTGTGGCGGG - Intronic
1075295076 10:121267948-121267970 TGCTAGAAGCAGGATGATGAAGG + Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1076108015 10:127839851-127839873 AGCTACTCGGAGACTGAGGAGGG - Intergenic
1076272072 10:129162492-129162514 AGATCAAAGCAGACTTAGGAAGG + Intergenic
1076861640 10:133140712-133140734 AGCAAGAAGCAGGCTGATGTTGG + Intergenic
1078423745 11:11233042-11233064 AAATAGAGGGAGACTGAGGATGG + Intergenic
1078443394 11:11385922-11385944 ATCTGGATGCAGACTGAGGTAGG + Intronic
1079465911 11:20730735-20730757 TGAGAGCAGCAGACTGAGGATGG + Intronic
1079661996 11:23050076-23050098 AGCTAGTAGCATACTGAACAGGG - Intergenic
1083659106 11:64244022-64244044 AGCTGTAACCAGACTGGGGAGGG + Exonic
1084268711 11:68017956-68017978 AGCAAGAAGCAGAGTGGGCAAGG - Intronic
1085316637 11:75548993-75549015 AGCTAGAAGCAGAAGGATGCAGG + Intergenic
1085388143 11:76168845-76168867 GGCTAGAAGGAGTCTGGGGAGGG + Intergenic
1085622207 11:78045989-78046011 AGTTAGAGGCAGCCTCAGGAGGG + Intronic
1085646291 11:78225194-78225216 AGGAAGAAGCTGACAGAGGAAGG + Exonic
1086659206 11:89393909-89393931 AGGTAGAAGACGACTGAGAAAGG - Intronic
1087125758 11:94624401-94624423 GGCTAGAATCAGTCTGGGGAGGG - Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087220031 11:95536837-95536859 GGCAAGACCCAGACTGAGGATGG - Intergenic
1087344899 11:96959478-96959500 AGCCAAAATCAGAGTGAGGAAGG + Intergenic
1087429186 11:98029952-98029974 AACTAAAAGCAGACTAAGCATGG + Intergenic
1087968211 11:104445953-104445975 ATCTAGAAGAAAATTGAGGAAGG - Intergenic
1088207283 11:107407605-107407627 GAATAGAAGCAAACTGAGGAAGG + Intronic
1088678458 11:112219217-112219239 AGCTAAAAGCAGACTTTGGGGGG - Intronic
1090135199 11:124190614-124190636 AGCTAAAAGCAGACTCTGGGGGG + Intergenic
1090344759 11:126061431-126061453 AGCTAAAAATAGACTGAGGGTGG + Intronic
1090460206 11:126884520-126884542 AGCTAGGAGAGGTCTGAGGAAGG + Intronic
1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG + Intronic
1092409993 12:8245329-8245351 GATTGGAAGCAGACTGAGGAAGG + Intergenic
1092915422 12:13184839-13184861 AGCTAGAAGCAGGCTGCAGAGGG + Intergenic
1093213949 12:16340744-16340766 AGCTAGTATCATACTGAGCAGGG - Intergenic
1094091674 12:26656898-26656920 AGCTAGAAGCTGAGTGAGGCTGG - Intronic
1094672778 12:32587076-32587098 AGCTACTAGCAGGCTGAGGCAGG + Intronic
1096492622 12:52021040-52021062 AGCGTGCAGCAGGCTGAGGAAGG - Intergenic
1096528146 12:52225991-52226013 AGCTGGCAGCACACTGAAGAGGG - Intergenic
1096529901 12:52235962-52235984 AGCCAGAAGGAGGCTCAGGAAGG + Intronic
1098588223 12:72181061-72181083 AGGTAGAAGAAGACTGAGAATGG + Intronic
1098871570 12:75822686-75822708 TGTAAGGAGCAGACTGAGGAAGG + Intergenic
1098904692 12:76149962-76149984 CGCTAGAAGCAGACTTTGGTTGG - Intergenic
1101606302 12:106249163-106249185 AGAAAGAAGCAGACTGAGTGAGG - Intronic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1102104225 12:110306872-110306894 AGCTACAAGGAGGCTGAGGTGGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1103996805 12:124835368-124835390 AGCTACAAGGAGGCTGAGGCAGG - Intronic
1104334365 12:127879611-127879633 AGCTAGAAACAGAAAGAGCAAGG + Intergenic
1104881735 12:132076201-132076223 TGAAAGAATCAGACTGAGGATGG - Intronic
1105080971 13:16117093-16117115 AGACAGAAGCATTCTGAGGAAGG + Intergenic
1105081854 13:16130799-16130821 AGACAGAAGCATTCTGAGGAAGG + Intergenic
1105082540 13:16141074-16141096 AGACAGAAGCATTCTGAGGAAGG + Intergenic
1106803817 13:33285592-33285614 AGGTAGTAGCAGCCTGAGGCTGG + Exonic
1107190591 13:37579967-37579989 AGCTTCAAGTAGGCTGAGGAAGG + Exonic
1107230868 13:38108709-38108731 AGCAAGAGGGAGAGTGAGGAAGG + Intergenic
1111676146 13:91391142-91391164 AGCTAGGAGAAGACTGAGGACGG + Intergenic
1111780346 13:92715425-92715447 AGCTGGAAGAAGGCTTAGGAAGG + Intronic
1112795440 13:103051391-103051413 AGCTATGAGCACAATGAGGATGG + Exonic
1113991164 14:16029376-16029398 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1117187793 14:53259483-53259505 TGCTAGAAGGAGACTAAAGATGG + Intergenic
1119722331 14:76899642-76899664 AGCTAGAACAAGAGTGAGGAGGG + Intergenic
1119747588 14:77055269-77055291 AGCTAGAAACCGACAGAGAAGGG + Intergenic
1120680681 14:87477412-87477434 AGCAGGAAGCAGAGAGAGGAGGG + Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121087105 14:91155018-91155040 GACTAGAAGCAGGCTGGGGAGGG - Intronic
1121408545 14:93733983-93734005 ACCTAGAAGGAGGCTGGGGAGGG - Intronic
1122053688 14:99077931-99077953 TGCTGGAGGCAGACAGAGGAAGG + Intergenic
1122805011 14:104252191-104252213 AGCAAGACGAAGTCTGAGGAGGG - Intergenic
1123712109 15:22996028-22996050 AGCTAGAAACATCCTGATGACGG - Intronic
1123779856 15:23615472-23615494 AGCAAGATGAAGACTGAGAATGG - Intronic
1125001831 15:34778849-34778871 AGCTACAAGGAGGCTGAGGTGGG - Intergenic
1125483770 15:40098354-40098376 AGCTTGAAGGAAACTGAGTAAGG - Intronic
1125601162 15:40916456-40916478 AGCTACAGGCTGAGTGAGGACGG - Intergenic
1126015966 15:44351012-44351034 AGCTAGTATCATACTGAAGAGGG + Intronic
1127459679 15:59186636-59186658 AGCTACTTGCAGACTGAGGTGGG + Intronic
1127960674 15:63888056-63888078 AGTTTTAAGCAGACTGAGAAGGG - Intergenic
1129983871 15:79898606-79898628 GGCTAGAAGCAGACTCAGGTCGG - Intronic
1129990800 15:79960668-79960690 GGCTAGAAGCAGACTCAGGTCGG - Intergenic
1131333480 15:91524484-91524506 AGCTAAAAGCAGACTCAGGTGGG + Intergenic
1131351534 15:91705244-91705266 AACTCAAAGCAGACAGAGGAAGG + Intergenic
1133293204 16:4736333-4736355 AACTAGAAGGAAACTGAGGCAGG + Intronic
1134068851 16:11248336-11248358 AGCAAGAAGCAACCTGAGAATGG + Intergenic
1135754634 16:25086885-25086907 AGCATGAAGAATACTGAGGAAGG + Intergenic
1135984450 16:27173721-27173743 AGCTACTAGGAGGCTGAGGATGG + Intergenic
1136531296 16:30871188-30871210 AGCTAGAAACTGACTTAGGAGGG + Intronic
1136910349 16:34140508-34140530 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138688583 16:58747947-58747969 AGCTATAGGAAGACTGAGGCGGG - Intergenic
1140903849 16:79393853-79393875 AGCAAGAAGCAAACAGAAGAAGG + Intergenic
1141244204 16:82291214-82291236 AGAATGAAGCAGACGGAGGAAGG + Intergenic
1143096481 17:4481030-4481052 AGCTTGGAGCAGGGTGAGGAGGG + Intronic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1145806853 17:27740514-27740536 AGCTACAGGGAGACTGAGGCAGG - Intergenic
1146058422 17:29592553-29592575 AGCAAGAACCAGAGTGAGGTTGG - Intronic
1146750064 17:35370364-35370386 AGCTAGTAGCATACTGAGTAGGG + Intronic
1146784785 17:35710105-35710127 AGCTAGCAGCAGGCTGGGAATGG - Intronic
1147328318 17:39680973-39680995 AGCTAGTAGGAGGCTGAGGTGGG - Intronic
1147365180 17:39954391-39954413 AGCTACAAGCAGAGTGGGCAGGG + Intergenic
1147743321 17:42680802-42680824 AGCTGGAAGCAGAGGTAGGAGGG - Intronic
1147806192 17:43133575-43133597 AGCTAAAGACAGACTGAGCAAGG - Intergenic
1148043292 17:44725797-44725819 AGCTACAGGGAGACTGAGGCGGG - Intronic
1148066624 17:44875597-44875619 AGCTATCAGGAGACTGAGGTGGG + Intronic
1148870692 17:50657331-50657353 ACCTGGAAGCAGGCTGAGGAGGG + Intronic
1149284876 17:55151229-55151251 AGTTAGAAGTAGAGTGGGGAGGG + Intronic
1149429800 17:56588600-56588622 AGCAGGAGCCAGACTGAGGAAGG + Intergenic
1149699881 17:58646576-58646598 AGCTACTTGCAGACTGAGGTGGG - Intronic
1150061943 17:62076040-62076062 AGCTATCAGGAGACTGAGGCAGG + Intergenic
1150973363 17:70056100-70056122 AAACAGAATCAGACTGAGGAAGG + Intronic
1151896867 17:76986584-76986606 AGCTGGCAGCAGACAGCGGAGGG - Intergenic
1153802096 18:8680610-8680632 AGCTAAAAAAACACTGAGGAAGG + Intergenic
1154003003 18:10500827-10500849 AGCTATGAGGAGACTGAGGCGGG - Intergenic
1154167350 18:12026144-12026166 AGCTAGCAGGAGGCTGAGGCAGG - Intronic
1154338667 18:13485518-13485540 AGCCACAAGCAGCATGAGGATGG - Intronic
1155930143 18:31698517-31698539 AGCTACAGGAAGGCTGAGGAAGG + Intergenic
1156273523 18:35559334-35559356 AACTGGATGGAGACTGAGGAAGG + Intergenic
1159300976 18:66567274-66567296 AGCAAGAAGCAGAGGGAGGAAGG + Intronic
1160044028 18:75370491-75370513 AGCTATCAGCAGGCTGAGGTGGG - Intergenic
1163169240 19:15519239-15519261 GGCTCAAAGCAGACTGAGAATGG + Intronic
1163494114 19:17634805-17634827 AGCTAGTGGGAGACTGAGGCAGG - Intronic
1165998731 19:39864514-39864536 AACTAGAACCAGGCTGAGGGAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167288922 19:48614180-48614202 AGCTGGAAGGAGTGTGAGGAGGG - Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167645831 19:50704297-50704319 AGCTGGAAGAAGACAGAGGGCGG - Intronic
1167789398 19:51663728-51663750 AGCTCCAAGCAGATTGAGGAGGG + Intergenic
925726755 2:6880471-6880493 AGCTAAAAGCAGATTCAGGGTGG - Intronic
925772328 2:7295152-7295174 TGCTGTAAGCACACTGAGGAAGG + Intergenic
926519151 2:13888048-13888070 AGCTAGTATCACACTGAGCAGGG + Intergenic
926906332 2:17808963-17808985 AGCTATAAGGAGGCTGAGGTGGG + Intergenic
927755459 2:25704977-25704999 AGCTAGAAGCTAACAGAGGTTGG + Intergenic
927815942 2:26217555-26217577 ATCTGAAAGCAGACAGAGGAAGG + Intronic
927859477 2:26551448-26551470 AGTTAGGGGAAGACTGAGGAAGG - Intronic
929500988 2:42491956-42491978 AGGAATAAGCAGACTAAGGATGG - Intronic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
932407873 2:71525918-71525940 AGCGGGAAGGAGACTGAGGTTGG + Intronic
932424267 2:71619349-71619371 AGCCAGAAGCATACGCAGGAGGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933633592 2:84682884-84682906 TGCTAGAAGCAGCCTCAGGAGGG - Intronic
933984846 2:87581976-87581998 ATCTAGAAGCAGACTGGCAAAGG - Intergenic
935387211 2:102512835-102512857 AGCTGGAAGCTCACTGAGGATGG + Intronic
935580931 2:104755357-104755379 GGCTAGAAGTAGAGGGAGGAGGG + Intergenic
935712246 2:105909518-105909540 AGATTGAAGAAGATTGAGGAGGG + Intergenic
936309006 2:111368835-111368857 ATCTAGAAGCAGACTGGCAAAGG + Intergenic
936480367 2:112879914-112879936 TGCTAGAGGCAGACAGAGGATGG - Intergenic
936577766 2:113669833-113669855 AGATGGGAGCAGACTGAGGTAGG + Intergenic
939196836 2:138983553-138983575 AGCTACCAGGAGACTGAGGTAGG + Intergenic
939374904 2:141351841-141351863 AGCTAGAAGAAAAATGAAGATGG + Intronic
940691524 2:156925565-156925587 AGCAAGAAACAGAGTGAGGGGGG + Intergenic
940846847 2:158651317-158651339 AGCCAGATGCAAACTGAGGGTGG - Intronic
941679013 2:168376062-168376084 AGCTAGTAGCATACTGAAGTGGG + Intergenic
941695152 2:168543371-168543393 AGATAGAAGCAGATTGATGGGGG - Intronic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
942146396 2:173031464-173031486 AGCTGGTAGCTGACTGGGGAAGG - Intronic
943839487 2:192560662-192560684 AGCTACAAGCAGACTTATGTGGG + Intergenic
944443211 2:199763496-199763518 AGCTGGGAGGAGGCTGAGGAAGG - Intronic
944591325 2:201220448-201220470 AGCTAAAAGCAGACTGGAGGGGG + Exonic
946809119 2:223504188-223504210 AGCAAGAAGAAGGCTGAAGAAGG + Intergenic
947251000 2:228103587-228103609 AGCAAGCAGCAGGCTGCGGAGGG - Intronic
947767737 2:232648356-232648378 AGCTGCATGCAGACTGAGGGTGG - Intronic
948101522 2:235377945-235377967 GGCCTGAAGCAGACAGAGGAGGG - Intergenic
1168835958 20:877621-877643 ACCAAGAACCAGGCTGAGGAAGG + Intronic
1169113768 20:3049448-3049470 AGCTAGTACCAGCCTAAGGAGGG - Intergenic
1169297402 20:4412009-4412031 AGCTGGAAGCTGAGTGGGGAGGG + Intergenic
1169770035 20:9190193-9190215 ACCTAGAAGCTGACTGGGGCTGG + Intronic
1170458758 20:16557290-16557312 AGCTAGTTGGAGACTGAGGCAGG - Intronic
1171770723 20:29320330-29320352 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1171813419 20:29763097-29763119 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1171905817 20:30899239-30899261 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1172032364 20:31991069-31991091 AGCTAGGAGCTGGCAGAGGAGGG + Intronic
1173003423 20:39121922-39121944 AGCAAGAAGGAAACTGAGGCAGG + Intergenic
1174179188 20:48664402-48664424 AGCTAGGAGCAGAGTGATGACGG + Intronic
1174521308 20:51132728-51132750 AGATAGAAGTAGACTTAGGGAGG - Intergenic
1177583579 21:23060074-23060096 AGATAGAAAGAGACTGAGAAAGG + Intergenic
1177938679 21:27382043-27382065 AGCTAGGATCAGCCTTAGGAGGG + Intergenic
1178465541 21:32844126-32844148 AGGCAAAAGCAGACTGGGGATGG - Intergenic
1180316104 22:11278148-11278170 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1180339233 22:11605340-11605362 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1181100509 22:20535847-20535869 AGAAAGAAGCAGGCTGAGCACGG - Intronic
1181911377 22:26240961-26240983 TGCCAGAGGCAGACAGAGGAGGG + Intronic
1182033230 22:27176511-27176533 AGCGTGAAGTAGAATGAGGACGG - Intergenic
1182078325 22:27510576-27510598 AGCTAGCAGGAGACAGAGCAGGG + Intergenic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182458209 22:30466052-30466074 TGCCAGAAGCAGTCTGGGGAGGG + Intronic
1184653640 22:45930638-45930660 AGGCAGGAGCAGCCTGAGGAAGG - Intronic
1185422467 22:50742829-50742851 AGATGGGAGCAGACTGAGGTAGG - Intronic
949522235 3:4868171-4868193 AGCTGGTAGCAGGCCGAGGAGGG + Intronic
949875188 3:8621946-8621968 AGCCAGAAGCAGATAGAGGCAGG - Intronic
950135697 3:10579370-10579392 ACTTAGAAACAGACTGAGAAGGG + Intronic
950177861 3:10888390-10888412 AGGAAGAATCTGACTGAGGATGG + Intronic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
954558720 3:51538505-51538527 AGCCAGAAGCTGCCTGAGAATGG - Intergenic
958795310 3:98700842-98700864 AGTCTGAAGCAGACTGAGGAAGG + Intergenic
958872917 3:99582333-99582355 AGCTAGTATCATACTGAGTAGGG + Intergenic
961719078 3:128880201-128880223 CGCTGGAAGGTGACTGAGGAGGG - Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
963779881 3:149476337-149476359 ACCTAGAAGCCTACTGGGGAGGG - Intronic
965451466 3:168844482-168844504 TGCAACAAGCAGACTGAGTACGG + Intergenic
966387322 3:179413064-179413086 AGCTACCAGGAGACTGAGGTGGG + Intronic
966806051 3:183808470-183808492 AGCTAGGATCAGGCTGGGGAAGG - Intronic
968571756 4:1346006-1346028 AGCAAGAGGCAGGGTGAGGAAGG + Intergenic
969869579 4:10096228-10096250 AGCTAGAAGCCGGCTGTGGGTGG - Intronic
969898363 4:10325710-10325732 AGCAGGAGGCAGCCTGAGGATGG + Intergenic
971009635 4:22419045-22419067 AGTCCGAAGCAGGCTGAGGAGGG + Intronic
971267053 4:25105067-25105089 AGCTAAAAGCAGACTTAGTGTGG + Intergenic
972615889 4:40697673-40697695 AGCTACTCGGAGACTGAGGAAGG + Intergenic
973264954 4:48201693-48201715 AGCCAGAAGGAGGCTAAGGAAGG + Intronic
974107283 4:57484693-57484715 AGCTAGATGCTGACTGAATAAGG + Intergenic
974324279 4:60393778-60393800 AACTAGAAGCAGTCAGAGAAGGG + Intergenic
974676513 4:65096569-65096591 AGCTGAAAGCAGACTCAGGCAGG + Intergenic
975023540 4:69520726-69520748 AGCTAAATGGGGACTGAGGATGG + Intronic
975488445 4:74961188-74961210 AGCTTTGAGCAGACTGAAGAAGG + Intronic
975771791 4:77732457-77732479 AGCTTGAAGGAAAGTGAGGAGGG - Intronic
976519545 4:86010056-86010078 ACCTAGATGCTGACTGAGCATGG - Intergenic
977299336 4:95250097-95250119 TCCTAGAAGCTGACTGAGAAAGG + Intronic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
977986010 4:103384428-103384450 AGCTAGTAGCATACTGAATAGGG + Intergenic
978380988 4:108128484-108128506 GGAAAAAAGCAGACTGAGGAAGG + Intronic
978703201 4:111674258-111674280 AGCTAGAAGAAGGCTGGGCACGG + Intergenic
978810827 4:112847833-112847855 AGCTAGAACTAGACTGTGAAGGG - Intronic
979289681 4:118965941-118965963 AGCTGGATGGAGACTGAGGTGGG + Intronic
979911187 4:126367678-126367700 AACTTGAAGGAAACTGAGGAAGG + Intergenic
981078774 4:140617673-140617695 AGCTAGAGGCAGACGGCAGAGGG - Intergenic
981389055 4:144166421-144166443 AGCTGGGTGCAGACTGAGGCAGG + Intergenic
987088905 5:14493707-14493729 AGCCAGAAGCTTAGTGAGGAAGG + Intronic
987252917 5:16118830-16118852 AGCTTGGAGTAGACTGAGGAAGG + Intronic
988353718 5:30144940-30144962 AGCTAGTATCAGACTGAATAGGG - Intergenic
988832748 5:35003478-35003500 AGATAGAGGCAGACAGAGGATGG - Intronic
989989246 5:50741919-50741941 AGCTAGTAGAAGGCTGAGGCAGG - Intronic
990035897 5:51319529-51319551 AGCAAGATGAAGACTGAGAAGGG - Intergenic
990172697 5:53071742-53071764 GGCTAAAAGCAGAATTAGGATGG + Intronic
990710061 5:58570591-58570613 AGCTAGCAGGAGACAGAGGGTGG + Intergenic
990827530 5:59918646-59918668 AGGTAGTAGCGAACTGAGGATGG + Intronic
991090417 5:62689022-62689044 AGATAGTAGAAGACTGAAGAGGG + Intergenic
991368224 5:65891275-65891297 AGCTAGTAAGAGACTGAGGCAGG - Intergenic
992191447 5:74295990-74296012 AGCTAGAGCCAAACTGTGGACGG - Intergenic
992246866 5:74834895-74834917 AGCTGGAAGCAGAAAGAAGATGG - Intronic
992847414 5:80765063-80765085 AGCTACAAGAAAGCTGAGGATGG - Intronic
996354605 5:122581769-122581791 GGCTAGAAGCAGCCTGGGGAAGG + Intergenic
997816648 5:137025868-137025890 AGCTAGAAGGAGGCTCATGATGG - Intronic
998141794 5:139704026-139704048 AGGTAGATGCAGACTGGAGAGGG - Intergenic
998258728 5:140611306-140611328 AGCTAAAAGCAGACTGGGGGTGG - Intergenic
998447988 5:142212899-142212921 AGCTATCAGCAGGCTGAGGCAGG + Intergenic
998737183 5:145155531-145155553 AGATGGCAGCAGGCTGAGGATGG - Intergenic
1002021842 5:176368648-176368670 AGCTAGAAGCAGGGTGGGGTGGG + Intronic
1002080942 5:176737102-176737124 TGCTCAAAGCAGACCGAGGAAGG + Intergenic
1003040027 6:2679142-2679164 ACCTAGAAGGCAACTGAGGATGG + Intronic
1003351342 6:5320301-5320323 AGCTAGAAGCAGCTGGAGGGAGG + Intronic
1004417577 6:15438701-15438723 AGATAGAAGGATACTGTGGAGGG - Intronic
1004573302 6:16869024-16869046 AGCTTGAAGCAGGCAGAGGCAGG - Intergenic
1004894466 6:20133916-20133938 AGCTGGGAGCAGCCTGAGGGAGG - Intronic
1007380655 6:41488303-41488325 AGCCAGAAGGAGACTGAGGAGGG - Intergenic
1007394802 6:41571292-41571314 TGCTAGAAGCAGGCAGAGGCCGG + Intronic
1007649128 6:43406833-43406855 AGCTACCAGGAGACTGAGGCAGG + Intergenic
1009647405 6:66424325-66424347 AACTCAAAGAAGACTGAGGAAGG - Intergenic
1009678358 6:66857297-66857319 AGCTAGAAGCAGAGAGACAATGG - Intergenic
1010232897 6:73551110-73551132 AGCTACTAGCAGGCTGAGGGAGG + Intergenic
1011194632 6:84768449-84768471 AGCTAGAAGCAGAAATGGGACGG + Intergenic
1012271693 6:97220279-97220301 AGGTAAAAGAAGACTGTGGATGG + Intronic
1013016867 6:106168035-106168057 AGCTAGAAGCAGGCAGAGCTGGG + Intergenic
1013077528 6:106784408-106784430 AGCTGGGAGCAGACAGAGAACGG + Intergenic
1013832467 6:114291008-114291030 ACCTAGAAAGAGACTGAGTAGGG - Intronic
1014549383 6:122772297-122772319 ATCTAGAAGCAGGCTAAGAATGG + Intergenic
1014615478 6:123592842-123592864 AGATAGAAGCAGACAGTGAATGG - Intronic
1016063721 6:139656814-139656836 AGCTAGAAACAGACAGAGCTGGG - Intergenic
1016792364 6:148079160-148079182 AGGTAGAAGGGGAGTGAGGAAGG + Intergenic
1018099580 6:160424801-160424823 ATCTTGAGGAAGACTGAGGAAGG + Intronic
1018950294 6:168374508-168374530 AGCTGGCAGCAGACTCTGGAAGG - Intergenic
1019282640 7:208063-208085 AGCTACAAGCAACCTGAGCAGGG - Intronic
1019306883 7:339840-339862 AGCTTGGAGCAGCCTGGGGATGG - Intergenic
1019448324 7:1082917-1082939 AGATAAAATCAGACTGAGGTGGG + Intronic
1021239926 7:18187850-18187872 AGGAAGAAGCACACTGAAGAAGG - Intronic
1021744967 7:23730994-23731016 AGCTATCAGGAGACTGAGGCAGG - Intronic
1021964295 7:25902331-25902353 AGCTAAAATCAGTCTGTGGAAGG + Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1026508321 7:71005864-71005886 GGATAGAAACAGACAGAGGAAGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1030148242 7:106378056-106378078 AGCCAGGAGCACCCTGAGGAAGG - Intergenic
1030290480 7:107867360-107867382 AGCTACTAGGAGGCTGAGGAAGG - Intergenic
1031077613 7:117227962-117227984 GGCTAGAAGGATACTGGGGAGGG - Intronic
1032848300 7:135770579-135770601 AGCTAGAAGCAGGCAGAGGAAGG + Intergenic
1033239272 7:139663791-139663813 AGCTGGAGACAGACTGAGCAAGG + Intronic
1033443274 7:141398842-141398864 AGCTAGGAGGTGACAGAGGAAGG + Intronic
1035144418 7:156799696-156799718 AGCTAGAAGCTTAGTGAGGAAGG + Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035777153 8:2196793-2196815 GGATAGAAGCAGGCAGAGGAAGG - Intergenic
1036213646 8:6862522-6862544 AGCAAGATGGAGAATGAGGAAGG + Intergenic
1037034912 8:14154255-14154277 AGCTAGCAGGAGGCTGAGGCAGG + Intronic
1038075361 8:24067028-24067050 AGATAGAAATGGACTGAGGAGGG - Intergenic
1038419231 8:27421681-27421703 AGCTTGAAATAGGCTGAGGAGGG - Intronic
1038635423 8:29282749-29282771 AGCTACCAGGAGGCTGAGGAAGG + Intergenic
1039612248 8:38929189-38929211 AGCTAGCAGGAGACGGAGGGAGG - Intronic
1042946983 8:74164963-74164985 GGCTAGTAGGAGACTGAGGTGGG + Intergenic
1043456967 8:80422193-80422215 AGCTGGATTCAGACAGAGGAAGG + Intergenic
1043737887 8:83769493-83769515 AGCTATAAGAAGACTGAAGCTGG + Intergenic
1044587297 8:93879621-93879643 AGCTCGAAGCAGGCAGAGGATGG + Intronic
1044721819 8:95158116-95158138 AGCTACATGAAGACTGAGGTGGG + Intergenic
1045541269 8:103088187-103088209 AGCTACAAGGAGACTGAGGCGGG + Intergenic
1046718822 8:117596296-117596318 AGCTATAAGCATTCTGGGGAAGG - Intergenic
1048908209 8:139109032-139109054 AGCTTGCAGGAGACTGAGGATGG + Intergenic
1049072721 8:140369275-140369297 AGTTAGAAGCAGGCTCTGGAAGG + Intronic
1050538467 9:6649984-6650006 AGCCAAAAGCAGATTGAGGAGGG + Intergenic
1051355422 9:16235689-16235711 AGCTAGAAACAGGAAGAGGAAGG - Intronic
1053475916 9:38382017-38382039 AGGTAGAAGCAGACAGATCAGGG - Intergenic
1055943992 9:81676443-81676465 GACTTGAAGGAGACTGAGGAAGG + Intronic
1056686104 9:88761373-88761395 AACTAAAAGCAAACAGAGGAAGG + Intergenic
1057447141 9:95124546-95124568 AACTAGAAGGGGAGTGAGGAAGG - Intronic
1057702909 9:97376519-97376541 AGCTAGAAGGAGGCTGAGCAGGG - Intronic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1061010579 9:127952174-127952196 GGCTAGAACCAGGCTGTGGAGGG - Intronic
1061084340 9:128390399-128390421 AGCTGTAAGCAGCCTGGGGAGGG - Exonic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1186225585 X:7395867-7395889 AGCAAGAAGAAGAAGGAGGAAGG - Intergenic
1186515449 X:10163517-10163539 AGCTACAAGGAGGCTGAGGCAGG - Intronic
1186642994 X:11476177-11476199 AGCTATAAGTAGATTGAGCATGG + Intronic
1187256866 X:17651240-17651262 AGCTAGAAGAAGGTTGAGAAAGG + Intronic
1187624915 X:21100205-21100227 AGCTAGTATCAGACTGAATAGGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188491724 X:30745155-30745177 GGGTAGATGCAGGCTGAGGAAGG - Intergenic
1188520939 X:31037032-31037054 AGCTAACTGCAGACTGATGAAGG - Intergenic
1189338523 X:40186492-40186514 AGCGAGCAGCAGACTGATCACGG - Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190046735 X:47117483-47117505 AGCTATTTGGAGACTGAGGAAGG + Intergenic
1190072959 X:47293829-47293851 AGCTAAAGGCAGACTCGGGAGGG - Intergenic
1192334622 X:70207130-70207152 AGCTACCAGGAGACTGAGGTGGG + Intergenic
1192927754 X:75774534-75774556 AGCTAGTATCATACTGAGTAGGG + Intergenic
1193212296 X:78821582-78821604 AAATAGAAGCAGCCTGAGGTGGG + Intergenic
1193337875 X:80312408-80312430 AGCTAAAAGCAGACTCAGTGGGG + Intergenic
1193474851 X:81950622-81950644 TGCTAGAAGGAGACTAAAGATGG - Intergenic
1193833558 X:86316205-86316227 ATCTAGAAGCAGACACAGGGGGG - Intronic
1194676705 X:96803013-96803035 GGATAGAAGCAGGCAGAGGAAGG - Intronic
1194953649 X:100154631-100154653 AGCTAGTAGCATACTGAATAGGG - Intergenic
1194969479 X:100327109-100327131 AGATAGAAGCAAACAGATGAGGG + Intronic
1195046599 X:101060061-101060083 AGCTAGCAGGAGGCTGAGGTGGG + Intergenic
1195257142 X:103101839-103101861 AGCTAAAAGCAGACTCAGGGAGG + Intergenic
1197899565 X:131355545-131355567 AGCCAGAAAAAGACTGAGAAAGG - Intronic
1198402318 X:136279850-136279872 AGCTAGAGGCACTCTTAGGAGGG + Intergenic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1199765881 X:150941484-150941506 AGGTGGGAGCAGACAGAGGAGGG + Intergenic
1201074241 Y:10175163-10175185 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1201373598 Y:13291972-13291994 AGCTAGTAGCACACTGAATAGGG + Intronic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic