ID: 1091057389

View in Genome Browser
Species Human (GRCh38)
Location 11:132431517-132431539
Sequence CTCTGTGTGGGGAAGGCAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091057383_1091057389 -6 Left 1091057383 11:132431500-132431522 CCACTCTGTCCTTGTGGCTCTGT 0: 1
1: 1
2: 4
3: 38
4: 483
Right 1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG 0: 1
1: 0
2: 2
3: 16
4: 269
1091057381_1091057389 3 Left 1091057381 11:132431491-132431513 CCTAGCTGACCACTCTGTCCTTG 0: 1
1: 0
2: 5
3: 19
4: 272
Right 1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG 0: 1
1: 0
2: 2
3: 16
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091057389 Original CRISPR CTCTGTGTGGGGAAGGCAAC CGG Intronic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901318378 1:8324097-8324119 CTCTGAGTAGGGAAGGCACTGGG + Intronic
902718819 1:18290846-18290868 CTCTGTGTGGTGGAGGCAGCGGG - Intronic
907830482 1:58060110-58060132 TTCTGTGTGGGGAGAGCAGCAGG + Intronic
907966364 1:59333841-59333863 ATCAGTGTGGTGAAGGCATCTGG + Intronic
909686156 1:78351220-78351242 GTCTTTGTGAGGAAGGCAATTGG + Intronic
910111807 1:83691477-83691499 GCCGGTGTGGGGAAGGCAGCAGG + Intergenic
910719439 1:90269782-90269804 CTTTGTGTGGGGAAGAAAAGAGG + Intergenic
913233249 1:116759550-116759572 CTCTGTGCGGGAGAGGCAAGAGG + Intronic
913338430 1:117732918-117732940 CTCTGTGAGGTGAAGGCAGTGGG - Intergenic
914263673 1:146019962-146019984 TTCAGTCTGGGGAAGGCCACTGG - Intronic
915170489 1:153973851-153973873 CACTGTGAGGTGAAGGCAAGAGG - Exonic
915243707 1:154541725-154541747 CCCTGTCTGGGGAAGGCTGCTGG + Intronic
915364423 1:155306426-155306448 CTCAGTGTGGGGATGGAGACAGG + Intergenic
916485531 1:165255048-165255070 CTCTCTGTGGGGAAGGCTCTGGG + Intronic
918412793 1:184277673-184277695 CTCTGTGTGTGGAAGGGGACAGG + Intergenic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
923443112 1:234040112-234040134 CTCTCAGTGGAGAAGGCAGCTGG + Intronic
1063977490 10:11429059-11429081 CTTTGTCTGTGGAAGGCAATAGG - Intergenic
1065345841 10:24747413-24747435 CTCTGAGGGGGGAAGGAAAAGGG + Intergenic
1065766197 10:29032062-29032084 CACTATGTGGGGAAGGAGACCGG + Intergenic
1067511487 10:46898533-46898555 TTCTGTTTAGGGAAGGCTACTGG + Intergenic
1067650759 10:48153331-48153353 TTCTGTTTAGGGAAGGCTACTGG - Intergenic
1067726329 10:48773990-48774012 CTCTGTGGGGGGAAGGTGGCTGG - Intronic
1068668364 10:59699258-59699280 CTCAGTGTGGGAAAGGTAGCAGG + Intronic
1069613197 10:69789163-69789185 CTCTGTGTGGGGAAGGCTGTGGG + Intergenic
1069642155 10:69963026-69963048 CTCACTGTGGTGAAGGAAACAGG + Intronic
1070642151 10:78177863-78177885 CTTTGAGAGGGGAAGACAACTGG + Intergenic
1070803889 10:79259220-79259242 CTCTGCGTGGGGCAGGGAAGGGG + Intronic
1071229918 10:83573605-83573627 CTGTGTGATGGGAAGGCACCTGG - Intergenic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1072232320 10:93424307-93424329 ATCTGTGTGGGAAAGGCACTAGG - Intronic
1072445026 10:95491649-95491671 CTCTGTGTGGAGGAGACAATAGG - Intronic
1073267883 10:102239376-102239398 CTCTGTGTCAGGAAAGGAACAGG - Intronic
1073960689 10:108924141-108924163 CGCTGTGTGGGTAAGGCTGCTGG - Intergenic
1074157299 10:110810248-110810270 CCTTGTGTGGGGAAGACAAAAGG - Intronic
1074494207 10:113964873-113964895 GTCTGTTGGGGGAAGGCAAGTGG + Intergenic
1074707452 10:116147617-116147639 CTCTGTGTGAGGATGGCAGGTGG - Intronic
1075300114 10:121314675-121314697 CTCTGTCTTAGGAAGCCAACGGG + Intergenic
1075961178 10:126568746-126568768 CTCAGAGTGGGGAAGCCAAGGGG + Intronic
1076139784 10:128069874-128069896 ACCTGTGTGGCGAAGGCATCGGG - Intronic
1076442539 10:130490093-130490115 CTCAGTCTGTGGGAGGCAACAGG - Intergenic
1076447335 10:130525643-130525665 CTCTTTGTGGGGAGGGTAACAGG + Intergenic
1076817102 10:132920402-132920424 CTCTGAGTGGGGGAGGCTCCAGG + Intronic
1076838672 10:133033821-133033843 CTCTGGGTGGGGATGGCCGCTGG - Intergenic
1082262757 11:50089935-50089957 TGCTGTGTGGAGAAGGCACCAGG - Intergenic
1083717217 11:64584321-64584343 CTCTGTGTTGGGAGGACAAGAGG - Intergenic
1083846020 11:65334039-65334061 CTCCTGGTGGGGAGGGCAACAGG + Intronic
1083876908 11:65529079-65529101 CCGTGTGTGGGGAAGACAGCGGG + Intronic
1084594405 11:70108471-70108493 CTCTGTGGGAGGCAGGCAGCCGG + Intronic
1085991742 11:81856177-81856199 CTGTGTGTGGGAATGGGAACAGG - Intergenic
1087675650 11:101158387-101158409 CTCTGTGTGGGGAGCCCCACTGG - Intergenic
1088351343 11:108891832-108891854 CACTTTGTGGGGAGGGCACCGGG + Intronic
1089758663 11:120706753-120706775 CTGTGAGTAGGGATGGCAACTGG + Intronic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1091404178 12:198748-198770 GGCTGGGTGGGGAAGGCACCTGG + Intronic
1092570439 12:9715712-9715734 CAGTGGGTGGGGATGGCAACTGG - Intergenic
1092973479 12:13721374-13721396 TGTTGTGTGGGGAGGGCAACTGG + Intronic
1095098953 12:38162088-38162110 CTCTGGGTGGGTGAGGCAAGAGG - Intergenic
1099623180 12:85030521-85030543 CTCTCTGTGGGGAAGAAGACAGG - Intronic
1103083433 12:118043238-118043260 TGCTGGGTGGGGAAGGCCACGGG + Exonic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105597448 13:21852282-21852304 CTTTGTGTGGGGATGCCAAGAGG + Intergenic
1106621419 13:31374399-31374421 CTCTGTGAGGGGAATGGAGCAGG - Intergenic
1106632229 13:31487132-31487154 CTCTTTGTAGGGTAGTCAACTGG - Intergenic
1110080255 13:71300431-71300453 GTCTGGGTGTGGAGGGCAACTGG + Intergenic
1111991828 13:95124311-95124333 CTCTCAGTGAGGAAGGCACCGGG - Intronic
1112462915 13:99618706-99618728 CTGGGTGGGGGGAAGGGAACAGG - Intronic
1113700592 13:112383715-112383737 CTCTGTGTGGACAAGGCATGAGG + Intronic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1118498127 14:66329078-66329100 CTCTGGCTGTGGAAGCCAACTGG - Intergenic
1122092572 14:99349973-99349995 CTCTGGCTGGAGAAGGGAACGGG + Intergenic
1123945680 15:25237741-25237763 CTCCATGTGGGGAAGGCAGTGGG - Intergenic
1125452994 15:39828270-39828292 GTCTGTGTGGGAAAGGCAGGAGG + Intronic
1127627694 15:60796297-60796319 CTCCATGTGGGGAAGTCAAAAGG - Intronic
1127772628 15:62243656-62243678 TTCTGTGTGGGGAAACCCACCGG - Intergenic
1128313665 15:66646912-66646934 CCCTGTCTGGGGGAGGCTACAGG - Intronic
1128511199 15:68314945-68314967 CTCTGTGTGGGGAAGGACAGAGG - Intronic
1129882761 15:79018003-79018025 CTCTGCGTTGGTAAGGCACCAGG + Intronic
1132302929 15:100787685-100787707 GGGTGTGTGGGGAAGGCAGCAGG - Intergenic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1132973450 16:2700199-2700221 CTCTGTGTGAGGGAGGGGACTGG + Intronic
1134092984 16:11401429-11401451 GTCTGTCTGGGCAAGGCCACTGG - Intronic
1139716286 16:68815918-68815940 GTCTGTGAAGGGAAGGGAACAGG - Intronic
1139719553 16:68841552-68841574 CACTGTGTGGGGAAGGCTTGAGG - Intergenic
1139802087 16:69530925-69530947 TTCTCTGTGGGGAAGGCAGGAGG + Intergenic
1141341660 16:83209381-83209403 CTCTGTGTGGAGGATGCACCCGG - Intronic
1142716237 17:1748473-1748495 TTCTGGGTGGGACAGGCAACGGG + Intronic
1143952734 17:10646493-10646515 CTCTGTGAGGGGCAGACAAGGGG + Intronic
1146703256 17:34980659-34980681 CCCGGCGTGGGGAAGGCAGCGGG + Intronic
1147169065 17:38607506-38607528 CTCTGTGTGGGGGAGGCTCAGGG + Intergenic
1147647646 17:42043426-42043448 CTGTGTGTGGGGGAGGCAGGGGG - Intronic
1148462423 17:47846347-47846369 ATCCCTGAGGGGAAGGCAACTGG + Exonic
1148825031 17:50386632-50386654 CACTGAGAGGTGAAGGCAACAGG + Intronic
1149423599 17:56533645-56533667 CTCAGGGTGGGGAAGGCACATGG - Intergenic
1151682722 17:75630276-75630298 CTCTGTGGGTGCAAGGTAACAGG + Exonic
1151973651 17:77471854-77471876 CTTGGGGTGGGGAAGGCATCAGG + Intronic
1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG + Intronic
1152633563 17:81421312-81421334 CTCTGTCTGGGGTTGGCCACTGG + Intronic
1152697097 17:81802964-81802986 CTCTGGGTGGGGAAGAAGACTGG + Intergenic
1152988894 18:344340-344362 CTCTGTCTGAGGAATGCCACTGG - Intronic
1153027670 18:686437-686459 CTCAGTGAGAGGAAGGCCACAGG + Intronic
1154029992 18:10745216-10745238 CTATGGGTGGGGAAGGGACCTGG - Intronic
1158177918 18:54678557-54678579 CTTTGTGTGGGAAAGGCCATAGG + Intergenic
1162348716 19:10136217-10136239 CCCGGTGTGGGGCAGGCACCAGG + Exonic
1162487856 19:10972698-10972720 CACTGTGTGGAGACGGCAAGAGG - Intronic
1163536872 19:17881939-17881961 TGCTGTGTGAGGAAGGCAGCGGG - Exonic
1165225750 19:34353301-34353323 CTGTGTGTTGGGAAGACATCAGG + Exonic
1165258701 19:34595822-34595844 CTGGGGGTGGGGAAGGCAGCAGG + Exonic
1166351932 19:42203190-42203212 TTCTGTGTGAGGTAGCCAACAGG - Intronic
1166997934 19:46728569-46728591 CCCTCGGTGGGGAAGGCAAGCGG + Intronic
1167608856 19:50496623-50496645 CTCTGCCTGGGGAAGGGGACAGG - Intergenic
925249951 2:2423821-2423843 TACTGTGTGGAGAAGGCTACAGG + Intergenic
925249957 2:2423867-2423889 TACTGTGTGGGGAAGGCTACAGG + Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928328823 2:30341649-30341671 CTATGTGTAGGGCAGGCACCGGG + Intergenic
929035690 2:37689324-37689346 CCCTGTGTCGGGAAGGCATGTGG - Intronic
932628972 2:73322144-73322166 CTCAGTGTGGGGAACGGAATGGG + Intergenic
933269457 2:80217459-80217481 TTCTCTGTGGGGAAGGCATTAGG - Intronic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934955033 2:98609924-98609946 CTCTCTGTGGGGATGTGAACAGG - Exonic
935512283 2:103991093-103991115 CTCTCAGTGGGGGAGGCAGCAGG + Intergenic
937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG + Intergenic
939268253 2:139903814-139903836 CTCTACGTGGTGGAGGCAACAGG - Intergenic
939541386 2:143498348-143498370 CTCTGTGGGAGGGAGGCAAGAGG + Intronic
940192819 2:151060688-151060710 CACTGTGTGGTGAAGGTAAAGGG - Intergenic
940525406 2:154807831-154807853 TTCTTTGTGAGGAAGGCACCAGG + Intronic
943144178 2:184020574-184020596 CTCTGTGTGGGGTTGGGAAGGGG - Intergenic
944572589 2:201059569-201059591 CTCTGTGAGGGGAAAGGAAAGGG - Intronic
944759641 2:202801096-202801118 CTGGTTGTGGGGAAGGGAACAGG + Intronic
945063342 2:205927205-205927227 AGATGTGTGAGGAAGGCAACAGG - Intergenic
947147681 2:227083398-227083420 ATCTGTGTGAGCAAAGCAACTGG - Intronic
948813684 2:240499081-240499103 CTGTGTGCTGGGAAGGCACCTGG + Intronic
1169038840 20:2476196-2476218 GTCTGTGTGGGGAAGGCCTAAGG + Intronic
1170289717 20:14755203-14755225 GCCTGAGTGGGGAAAGCAACAGG - Intronic
1171306618 20:24112523-24112545 TCCTGTGTGGGGAAGGGAAGGGG - Intergenic
1173287495 20:41686560-41686582 CTTTGTGTGTGGAAGTCAAATGG - Intergenic
1173627817 20:44486575-44486597 TCCTGTGTGGGAAAGGCAAAGGG - Exonic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1174013525 20:47469826-47469848 CTCAGTGTCTGGAAGGCATCAGG + Intergenic
1175700642 20:61134489-61134511 ATCTGTGTGGGGCAGGGGACGGG - Intergenic
1176304432 21:5115806-5115828 CTCAGTGGGAGGAAGGCCACTGG + Intergenic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1179852626 21:44146224-44146246 CTCCGTGGGAGGAAGGCCACTGG - Intergenic
1180411743 22:12617976-12617998 CTGTGTTTTGGGAAGGCAATGGG - Intergenic
1180816487 22:18792756-18792778 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
1181202674 22:21227088-21227110 CTGTGTGTGGGGAGGGCACGGGG - Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1183028115 22:35081602-35081624 ATCTTGGTGGGGAAGGGAACTGG + Intronic
1183516627 22:38270631-38270653 CTCTGTGTGGGGTCTGCACCAGG - Intronic
1183897186 22:40978736-40978758 CTCTGGGTGGGTAAGGGGACAGG - Intergenic
1184206583 22:43007867-43007889 ATCTGTGGGTGGAAGGCAACAGG - Intronic
1184615959 22:45639066-45639088 CGCAGTGTGGGGACGGCAAAAGG + Intergenic
1185019257 22:48364256-48364278 CTATGTGCCGGGAGGGCAACCGG + Intergenic
1203224239 22_KI270731v1_random:68325-68347 CTGTGTGTGGGGAGGGCACGGGG + Intergenic
1203266587 22_KI270734v1_random:18467-18489 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
949614998 3:5743786-5743808 TTCTGTGTGCCGAAGGCAAAGGG + Intergenic
949952217 3:9238689-9238711 CTCTGCCTGGGGAAGGGATCCGG - Intronic
950052509 3:10003145-10003167 CTCTTGGTGGAGAAGGCCACAGG - Intronic
950161434 3:10764038-10764060 GTGAGTGAGGGGAAGGCAACAGG - Intergenic
950426492 3:12927380-12927402 ACCTGTGTGGGGAAGGGACCAGG - Intronic
954400219 3:50315578-50315600 ATCTGTGTGGGGGAGGTCACAGG + Intergenic
954626512 3:52024780-52024802 CTCTGTTTGGGTCAGGCAATGGG - Intergenic
954861319 3:53693211-53693233 GTCTGTGGGGGGAAGACAGCTGG - Intronic
954990696 3:54838459-54838481 ATCAGTTTGGGGAAGGCACCAGG + Intronic
955466130 3:59238873-59238895 CCCTTTGTGGGGAATGGAACTGG - Intergenic
956299092 3:67750071-67750093 CTCTGTGAGGCCAAGGCAAGTGG - Intergenic
956925850 3:73987476-73987498 TTCAGTGTAGGGAAGGCAAGTGG + Intergenic
959681722 3:109104221-109104243 CTCTCTGTGGGGAGGGAAAAAGG + Intronic
959971403 3:112413939-112413961 GCCTGTTTGGGTAAGGCAACTGG + Intergenic
961173571 3:124816167-124816189 CTCAGTGTCCTGAAGGCAACCGG - Intronic
961225023 3:125236305-125236327 CTCTGTGAGGGCAAGGCAGGAGG - Intronic
961445954 3:126981917-126981939 CTCTGTGTGGTGAGGGCACAGGG - Intergenic
961545806 3:127632151-127632173 CCCAGAGTGGGGAAGGAAACAGG + Intronic
961607684 3:128109300-128109322 CTCTGTGGGGCCAAGGCAAAAGG + Intronic
962851901 3:139314276-139314298 CTCTGTCAGGGGAAGCCAGCAGG + Intronic
963673742 3:148282499-148282521 CTGTTTCTGGGGAAGCCAACTGG + Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964540618 3:157775250-157775272 CTCTGATAGGGAAAGGCAACAGG + Intergenic
965499753 3:169443358-169443380 CTCTGTGGGGGGAAGGGAAGGGG + Intronic
966878221 3:184335624-184335646 CCCTGTGTGGGGAAGGCTTTTGG + Intronic
966953419 3:184846657-184846679 CTCTGTGCCTGGAAGGCAAGCGG + Intronic
975339488 4:73223091-73223113 CTCTGTGTCAGCAAGGGAACAGG + Intronic
975389443 4:73799679-73799701 CTCTATGTGGGGAAGGAGAGTGG + Intergenic
975754840 4:77562098-77562120 CTCCCTGTGGGGAAGGCCTCAGG + Intronic
975980658 4:80155035-80155057 TTCAGTGTGGGGAAGACCACTGG + Intergenic
980725789 4:136758670-136758692 CTTTGTGAGGCCAAGGCAACAGG - Intergenic
982864206 4:160489660-160489682 CTCTTTCTGGGAAAGGCAATGGG + Intergenic
985203128 4:187505312-187505334 TTCTGGGTGGGGAAGGCCGCTGG - Intergenic
985754027 5:1702482-1702504 CTCTGTGTGGGGGTGGGAGCAGG + Intergenic
985800822 5:2004590-2004612 CCCTGTGTGGGGCAGGAAAGTGG + Intergenic
985800834 5:2004630-2004652 CCCTGTGTGGGGCAGGAAAGGGG + Intergenic
985801008 5:2005285-2005307 CCCTGTGTGGGGCAGGAAAGGGG + Intergenic
985801031 5:2005365-2005387 CCCTGTGTGGGGCAGGAAAGGGG + Intergenic
985801041 5:2005405-2005427 CCCTGTGTGGGGCAGGAAAGGGG + Intergenic
985982703 5:3485489-3485511 GTCTGTGTTGGAAAGCCAACAGG - Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
989164922 5:38424420-38424442 CTCTGTCTGGGGTAGGGAGCAGG - Intronic
990630329 5:57661812-57661834 CTCTGAGTCAGGAAGGCAAAGGG + Intergenic
992499488 5:77327860-77327882 CTGTGTGGGGGGAAGGCTCCCGG - Intronic
993030208 5:82696839-82696861 CTCTGAATGGGGAAGCCCACAGG + Intergenic
994077581 5:95670612-95670634 CTTTGTGTGGGGAAGTAAAAGGG - Intronic
994231826 5:97316333-97316355 TTCTGTAAGGGGAAGGCAAATGG - Intergenic
994544276 5:101143387-101143409 CTCTGTGTGTGGAAGATAACAGG + Intergenic
995260071 5:110093458-110093480 CTCTGTGTGGGCAAGGAGAGAGG + Intergenic
996411245 5:123161769-123161791 CTCTGTGTGAGCTAGGCAAAGGG + Intronic
996922896 5:128789978-128790000 CTCTGGGAGGCCAAGGCAACTGG + Intronic
997597139 5:135114629-135114651 CTGTGTGTGGGGGGGGGAACAGG - Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
1000245953 5:159448736-159448758 CTCTGAGAGGGGAAGGAAGCGGG + Intergenic
1001593382 5:172881653-172881675 CACTGTGGGGGAAAAGCAACAGG + Intronic
1003745257 6:8993965-8993987 CTCTGGGTGGGGAAAGTTACTGG - Intergenic
1003963145 6:11228056-11228078 ATCTGTGTGTGGGAGGCAAGGGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006594941 6:35185964-35185986 CTATTTCTGGGGAAGGCCACAGG + Intergenic
1007687110 6:43673541-43673563 CTCCGTGTGGCGCAGGCATCAGG - Intronic
1008542383 6:52556523-52556545 CTCTGTGGGGGCAAGGCGAGTGG - Intronic
1009277026 6:61695921-61695943 CTCTCTGTGGGGAAGAGAAAAGG - Intronic
1009524670 6:64728880-64728902 CTCTCTGTGGGGAGGGGAGCTGG + Intronic
1009849810 6:69180939-69180961 CTCTGTGAGGGAAAGACACCAGG - Intronic
1011625408 6:89279267-89279289 GTCTGTGTGAGGCAGGCAGCGGG + Intronic
1012423930 6:99094072-99094094 GTGTGTGTGGTGAAGGCAAGTGG - Intergenic
1012459670 6:99446680-99446702 CTATTTGTGGGGAAGGAAATAGG + Intronic
1012602452 6:101114885-101114907 CTTTGTGTGGGTAAGGCAAAGGG - Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018828416 6:167424072-167424094 CTCTGTGTGGGGGAGCCGCCGGG - Intergenic
1018848796 6:167573104-167573126 CTCTGTGTAGGGAGAGGAACGGG - Intergenic
1021121223 7:16797950-16797972 CTGTGTTTGGGGAAGACATCTGG + Intronic
1022488179 7:30796264-30796286 CCTTGTGTGGAAAAGGCAACAGG + Intronic
1025051363 7:55737238-55737260 ATCTGAGTGGTGGAGGCAACTGG - Intergenic
1025910694 7:65826109-65826131 TGCTGTGTGGAGAAGGCACCAGG + Intergenic
1026044863 7:66900072-66900094 TGCTGTGTGGAGAAGGCACCAGG + Intergenic
1026366084 7:69649958-69649980 GACTGTGTGGGGAAGGAAAAGGG - Intronic
1027173290 7:75888005-75888027 CTCTGTGTGGGGTAGGAGCCAGG - Exonic
1027232233 7:76279551-76279573 CTCTGTGTAGGGAGGGAGACAGG + Intronic
1028358062 7:89933685-89933707 CTCTCAATGGGGAAGGCCACAGG - Intergenic
1028685102 7:93583064-93583086 CTTTGTGTGGCCAAGGCAAGTGG + Intergenic
1031452345 7:121937438-121937460 CTCTGGGTGGGGAAGGCCCCAGG - Intronic
1032440015 7:131935404-131935426 CTCTGTGTGGGCAGGGCATGAGG + Intergenic
1032485750 7:132286234-132286256 CTCTGTGTGGGGCATGCAGTGGG + Intronic
1032914816 7:136478028-136478050 CTCTGTTTGTGTAAGGCAAATGG + Intergenic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1034678643 7:152910986-152911008 CTCAGTGTGGGGCAGGGAATAGG + Intergenic
1035739500 8:1915488-1915510 CTCTGTCTGGGGGAGGAAACGGG + Intronic
1037027461 8:14056841-14056863 CTTTGTGAGGGCAAGGCACCTGG + Intergenic
1037346961 8:17911247-17911269 CTCTTTGTGGAGAATGAAACTGG + Intergenic
1037581263 8:20247209-20247231 CTCTGTGTATGGAAGGTACCGGG + Exonic
1038033992 8:23671556-23671578 CTATGGGTGGGGAAGGCATGAGG - Intergenic
1038335908 8:26645289-26645311 CTCGGTGTGGGGGAGGCAGGAGG + Intronic
1038644866 8:29352684-29352706 CTCCCTGTGGGGAGGGCAAAAGG + Intergenic
1039968409 8:42300294-42300316 CACTGAGTGAGAAAGGCAACAGG - Intronic
1041778665 8:61553749-61553771 CTCTTTGTGGGGACGGGAATGGG - Intronic
1042557328 8:70044416-70044438 TTCTGTGTGGGGAAGGTAGGGGG - Intergenic
1043091750 8:75913119-75913141 CTCTGTATCAGGAAGGCCACTGG - Intergenic
1044624199 8:94220173-94220195 CTAAGATTGGGGAAGGCAACTGG + Intergenic
1044752947 8:95433592-95433614 CTCTGTGTTGGGAAAACATCTGG + Intergenic
1046027793 8:108746236-108746258 CTCTGGATGGGAAATGCAACTGG - Intronic
1046303956 8:112337280-112337302 ATGTGTGTGGGGAAGGGAAGGGG - Intronic
1048976228 8:139674498-139674520 CTCTGTGAGGGGCAGGGACCCGG + Intronic
1049299560 8:141862399-141862421 CTCTGTTTGGGGAGGGGAAGCGG - Intergenic
1049314104 8:141950563-141950585 CACTGAGTGAGGAAGGCATCTGG + Intergenic
1050410844 9:5363348-5363370 GGCTGAGTGGGGAAGGCCACTGG - Intronic
1050829915 9:9998031-9998053 CTCTGTGTGGGGCAGAAAAGTGG - Intronic
1051128433 9:13832488-13832510 CTCTGTGTCTGAAAGTCAACAGG + Intergenic
1054816839 9:69483766-69483788 CACTCTGTGGGGAAGCCAAGAGG + Intronic
1057147042 9:92765195-92765217 CTGAGTGTGGGGAAGGCCGCGGG - Intergenic
1058160741 9:101568062-101568084 ATGTGTGTGAAGAAGGCAACAGG + Intergenic
1058547473 9:106076247-106076269 CTCTGTGTAAGGAAAGCCACAGG - Intergenic
1059859702 9:118446335-118446357 TTCTGTGGGGGGAAGCCAGCTGG - Intergenic
1060442355 9:123653799-123653821 ATCTGTATGTGGCAGGCAACAGG + Intronic
1061202214 9:129144383-129144405 CGCTGTGTGGGGAAGGGGACAGG + Intronic
1061882449 9:133575059-133575081 CTCTGTCTGGGGGAGGCCACTGG - Exonic
1061929430 9:133824825-133824847 CTCTGAGAGAGGAAGGCACCTGG - Intronic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1062444184 9:136586830-136586852 CTCTGTGTGTGCAGGGCAAGAGG + Intergenic
1186716385 X:12256278-12256300 CTGTTTGTGGGGAAGGTCACTGG - Intronic
1188434308 X:30142952-30142974 CTCAGTGTGAGGATGGGAACTGG + Intergenic
1190357306 X:49617729-49617751 CACTGAGTTGAGAAGGCAACAGG - Intergenic
1192034035 X:67544664-67544686 CTCGGGGTGGGGAAGGCAGGAGG - Exonic
1194084845 X:89513732-89513754 CTGTGTGTGGGGATAGGAACAGG - Intergenic
1195325574 X:103755613-103755635 CTCTGTGTGGAGAAGACTACTGG - Intergenic
1198794210 X:140378476-140378498 CTCTGTGGTGGGAAGGCAGGGGG + Intergenic
1200162503 X:154016730-154016752 CTTTCTGTGGGCAAGGCACCGGG - Intronic
1200283022 X:154794630-154794652 CACTGTGTGGGGAAGGAGAAGGG + Intronic
1201509648 Y:14744853-14744875 TTCTGTGTGTAGAAGGCATCTGG - Intronic
1201695008 Y:16815205-16815227 CTTTGTGTGAGGAAGGTAAGAGG + Intergenic
1201959274 Y:19660769-19660791 CTCTGAGTTGGGTAGGAAACTGG + Intergenic