ID: 1091060633

View in Genome Browser
Species Human (GRCh38)
Location 11:132458093-132458115
Sequence GTGGACAGAGAAGGTCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091060633 Original CRISPR GTGGACAGAGAAGGTCTCTT GGG Intronic
900279094 1:1854228-1854250 GTGGCCAGAGAAGGCCACTCTGG + Intronic
900768490 1:4521147-4521169 GTGGAGATAGAAGGTCTGTGTGG - Intergenic
901847267 1:11991386-11991408 GTGGTCAGAGAAGGCTTCCTGGG + Intronic
904692424 1:32303676-32303698 TTGTACAGACAAGGTTTCTTGGG - Intronic
904888343 1:33759116-33759138 GTGGTTAGAGATGGTCTCTCTGG + Intronic
905190089 1:36226994-36227016 GTGGTCAGTGAAGTTCTTTTTGG + Intronic
905386335 1:37606766-37606788 GTGGCTAGAGAAGGTGTCTTGGG - Intergenic
905477378 1:38238569-38238591 GTGGACAAAGAAGACCTCATAGG - Intergenic
905604198 1:39282691-39282713 GTGGTCAGAGATGGCCTTTTTGG + Intronic
906085510 1:43129981-43130003 GGGGAAAGTGAAGGTGTCTTGGG - Intergenic
906087997 1:43152408-43152430 GTGGCGAGAGAAGGCCTCTCTGG - Intronic
906785435 1:48611321-48611343 GTGGAGGGAGAAAGACTCTTCGG + Intronic
907388679 1:54142173-54142195 GTGGACAGTGAAGGTCACAAGGG - Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
908033410 1:60026230-60026252 GTGCTCAGATAAGGTCTGTTTGG - Intronic
908413207 1:63887040-63887062 GTGGAGACACAAGGTCTCCTGGG - Intronic
909462011 1:75927628-75927650 GTGGTTAGAGAAGGTCCCTGAGG - Intronic
909836201 1:80258674-80258696 ATGGACAGAGATGGCCTCTGTGG + Intergenic
913282722 1:117201298-117201320 CTGGACAGAGGAATTCTCTTGGG - Intronic
917192079 1:172428638-172428660 GAGGTCAGAGTAGGTCTCATGGG - Intronic
918203049 1:182285208-182285230 GTGGTCAGAGCAGGTGTCTGTGG - Intergenic
918278033 1:182973498-182973520 GTGGTCCGAGAAGTTCTCTCTGG + Intergenic
918935896 1:190921131-190921153 GTGTTCAGAGAAGATCTTTTTGG + Intergenic
918935903 1:190921310-190921332 GTGTTCAGAGAAGATCTTTTTGG + Intergenic
919307694 1:195864123-195864145 GTGGAGAGAGAAGGGTTCTTAGG - Intergenic
920159378 1:203984460-203984482 GTGGTCAGGGAAGGTCTCTGAGG - Intergenic
920228613 1:204455646-204455668 GAGGAGAGAGGAGGTCCCTTAGG - Intronic
920641339 1:207754351-207754373 GTGATCAGAGAAGGTCTCTGAGG - Intronic
920977301 1:210798009-210798031 GTGGTCAGAGAAGGCTTCTCTGG + Intronic
921303791 1:213775021-213775043 GTGATCAGAGAAGGTCTTTGAGG + Intergenic
923425621 1:233865959-233865981 GTGGTCAGGGAAGGCCTCTCTGG - Intergenic
1063179426 10:3584416-3584438 GGGGACTGAAAAGGTCTGTTGGG - Intergenic
1065363847 10:24915824-24915846 GTGGATAGAGAAGAGCTCTAAGG - Intronic
1065754043 10:28914326-28914348 TTGGAAAGCGAAGGTCTCCTTGG + Intergenic
1067283161 10:44888237-44888259 GTGGTCAGGGAAGGGCTCATGGG + Intergenic
1067323494 10:45244598-45244620 ATAGACAGAGAAGGTCTAATTGG - Intergenic
1068077283 10:52272137-52272159 ATGGACAAAGAGGGTTTCTTGGG - Intronic
1069931252 10:71883175-71883197 ATGGACAGAGAAGGTCCTGTGGG - Intergenic
1071550914 10:86565570-86565592 GTGGCCAGAGAATGGCACTTTGG - Intergenic
1071711789 10:88056960-88056982 GTGGTCAAAGAAGGCCTCTCGGG + Intergenic
1071895224 10:90059393-90059415 GTGGCCAGATAAGTTCTTTTTGG + Intergenic
1072625872 10:97111512-97111534 GTGGACAGACAGGGTATGTTTGG - Intronic
1073324527 10:102634656-102634678 CTGGAAAGAGAAGGACTCCTGGG + Intergenic
1074109577 10:110412965-110412987 GTTCACAGAGAAGGCCTCTAGGG - Intergenic
1075340104 10:121640306-121640328 ATGGAGAGAGAAGGTCTGATCGG + Intergenic
1076342607 10:129759956-129759978 GAGGACACAGAAGGGCTCTGGGG - Intronic
1076557433 10:131336406-131336428 CTGGACAGAGAAATTCCCTTTGG - Intergenic
1077904851 11:6523287-6523309 CTGCACAGGGAAGGTCTCTTTGG + Intronic
1079131496 11:17749449-17749471 GTGGGCAGAGAAGGTCCCCAGGG - Intronic
1079704932 11:23603069-23603091 GTGGTAAGAGAAGGCCTCTCTGG - Intergenic
1080727641 11:34914392-34914414 ATGGAAAGAGACAGTCTCTTTGG - Intronic
1081925641 11:46826228-46826250 GTTGACAGTGAACATCTCTTAGG - Intronic
1085196254 11:74673633-74673655 ATGGTCAGAGAAGGTTTCCTGGG - Intergenic
1085620787 11:78036649-78036671 GTGGTCACGGAAGGCCTCTTGGG - Intronic
1088615628 11:111624858-111624880 GTGGTCAGAGAAGGCCTCGCTGG + Intronic
1088982351 11:114875132-114875154 GAGCACAGAGAAGATCTCTAGGG + Intergenic
1089183334 11:116597840-116597862 GTGGGCAGAGAAGGCCTATCTGG + Intergenic
1090235303 11:125142462-125142484 GTGGATAGAGAGGGCCTCTGAGG + Intergenic
1090370882 11:126251630-126251652 ATGGTCAGAGAAGGTCTCTCAGG - Intronic
1091060633 11:132458093-132458115 GTGGACAGAGAAGGTCTCTTGGG + Intronic
1091440654 12:509951-509973 GAGGACACAGCAGGTCTCGTAGG - Intronic
1092056608 12:5512815-5512837 GTGGTCAGAGAAGGCATCCTTGG - Intronic
1092071264 12:5633324-5633346 ATGGAGAGAGAATGTCTGTTTGG + Intronic
1093567672 12:20627583-20627605 GTGGACTGAGAAGGCCTCTCTGG - Intronic
1093738900 12:22658182-22658204 GGGGACAGAGAAGTTCACATGGG + Intronic
1093910824 12:24744961-24744983 GTAGAGAGAGATGTTCTCTTTGG + Intergenic
1094693060 12:32788589-32788611 GTGAACAGTGGAGGTCTCTTTGG - Intergenic
1096670459 12:53195546-53195568 GGGGACGGAGAATGTATCTTTGG + Intronic
1097886563 12:64734744-64734766 GTGGTCAGTGAAAGCCTCTTAGG - Intronic
1097888495 12:64754336-64754358 GTGGTCAGAAAAGGCCTCTCAGG + Intronic
1098519181 12:71416576-71416598 GTGGTCAGGGAAGGTCTTTGAGG + Intronic
1099349881 12:81553131-81553153 GAGGCCAGAGAAGGTATCTTAGG + Intronic
1099429428 12:82564475-82564497 GTAAACAGAGAAGGTTTCATGGG - Intergenic
1100104086 12:91147333-91147355 ATGGTCAGGGAAGGTCTCTCTGG - Intronic
1101556066 12:105810826-105810848 GTGGTAAGAGAAGGGCTTTTTGG + Intergenic
1103902839 12:124312135-124312157 GTGGATACAGAGGGTCCCTTGGG - Intronic
1104047003 12:125170564-125170586 GTGGTCAGACAAGGTCTCAGAGG + Intergenic
1104165833 12:126229008-126229030 ATGGACAGAGAAGGCCTGTTTGG + Intergenic
1105280902 13:18962100-18962122 GTGCACTGAGAATGGCTCTTTGG - Intergenic
1105290092 13:19048112-19048134 GTGCACTGAGAATGGCTCTTTGG - Intergenic
1105356157 13:19661890-19661912 ATGGACTGAGAGGATCTCTTTGG + Intronic
1105623075 13:22087788-22087810 GTGGGCATAGAAGGCCTCCTTGG + Intergenic
1106127339 13:26911249-26911271 GTGGACTGAGAAAGCCTGTTGGG + Intergenic
1108211964 13:48148304-48148326 ATGGATCTAGAAGGTCTCTTTGG + Intergenic
1109169041 13:59073850-59073872 ATGGCCAGAAAAGGTCCCTTTGG - Intergenic
1109746321 13:66627651-66627673 CTGGAGAGAGCAGGGCTCTTAGG - Intronic
1110050636 13:70893883-70893905 GTAGACAGAGAATGTCTATGTGG + Intergenic
1110577474 13:77075540-77075562 GTGGTCAGAGAAGGCTTCTTAGG - Intronic
1112788235 13:102975067-102975089 TTTGATAGAGTAGGTCTCTTTGG + Intergenic
1113198775 13:107840664-107840686 GTGAAGAGAGAATGTCTATTGGG + Intronic
1113565869 13:111319502-111319524 GTGGACAGAGGAGGCATCTAGGG - Intronic
1113940638 13:114016944-114016966 GTGGAGAAAGAAGGTCTCCCTGG + Intronic
1114649696 14:24276632-24276654 TTGGACAGAGCAGGTCTCTTGGG + Intergenic
1114926484 14:27406809-27406831 ATTGCCAGAAAAGGTCTCTTAGG - Intergenic
1119188136 14:72659220-72659242 GCTGACAGAGCAGGTATCTTTGG - Intronic
1122772004 14:104101722-104101744 GTGCACAGAGGAGGGCTCTGGGG - Intronic
1125301387 15:38257126-38257148 GGGAAGAGAGAAGGTCTTTTGGG - Intronic
1127360932 15:58244674-58244696 GTGGCCAGAGAAGGTCGTGTGGG - Intronic
1127700180 15:61491788-61491810 GTGGACACACAAGTACTCTTTGG - Intergenic
1130903332 15:88223369-88223391 GTGGGCAGAGAGGGGCTCTGGGG - Intronic
1131783638 15:95887412-95887434 GAGGACAGAGCATGTCTCATGGG - Intergenic
1131813534 15:96199144-96199166 GTGGTCAGGGAAGGCCTCTCTGG - Intergenic
1131962131 15:97800907-97800929 TTGGAGAGAGAAGGTCTGTCTGG - Intergenic
1132283961 15:100645909-100645931 GTGGCCAGAGAAGGTCACTATGG + Intronic
1134382656 16:13742546-13742568 GTGGACAGGGAAGGGCAATTGGG - Intergenic
1135164384 16:20125925-20125947 GTGGGCAGAGGATGTCTTTTGGG + Intergenic
1135189581 16:20343999-20344021 GTGGCCAGAGAGGGTCCCTAGGG - Intronic
1135620865 16:23954301-23954323 GGTGTCAGAGAAGGTCTCCTTGG + Intronic
1135886087 16:26309498-26309520 GGGGAAAGAGAAGCTCTCTCAGG - Intergenic
1135895697 16:26400260-26400282 GTAGACAGGGAAGGTCTTTAGGG + Intergenic
1137509019 16:49081956-49081978 GGTGTCAGAAAAGGTCTCTTGGG - Intergenic
1138119206 16:54384678-54384700 GTGGCCAGGAAATGTCTCTTTGG - Intergenic
1138297583 16:55900102-55900124 GTTGACAGAGAGGGTCCCTAGGG - Intronic
1139185082 16:64796786-64796808 GCGGAAAGAGGAGATCTCTTGGG + Intergenic
1139648455 16:68348979-68349001 CAGGACAGAGCAGCTCTCTTGGG + Intronic
1140286586 16:73608201-73608223 GTGGACAAAGAAGTGCTCTGGGG - Intergenic
1140815597 16:78618077-78618099 GTGGACAGTCATGGCCTCTTAGG - Intronic
1144074824 17:11707911-11707933 GTGGTCAGGGAAGGCCTCTGAGG - Intronic
1147408321 17:40229817-40229839 GCAGTCAGAGAAGGTCTCTGAGG + Intronic
1147591523 17:41686958-41686980 GTGGTCAGAGAAGGCCTCTGGGG - Intergenic
1148272016 17:46268574-46268596 CTGGACAGAGATGGCCTCTCAGG - Intergenic
1152005053 17:77675528-77675550 GAGGACAGACAGGGGCTCTTGGG - Intergenic
1152030513 17:77839344-77839366 GTGGACAGGGAAGACCTCTTGGG - Intergenic
1153585056 18:6612402-6612424 TTGCACAGATAAGGTCTTTTGGG + Intergenic
1155747581 18:29378566-29378588 GTTGCCAGTGAAGGACTCTTTGG + Intergenic
1156220902 18:35051097-35051119 GAGGACAGTGAGGGTTTCTTGGG + Intronic
1156403218 18:36759439-36759461 GTGGACAGAGAATTTTCCTTTGG + Intronic
1156593794 18:38522592-38522614 GTGGATAGATAAGGTGTATTTGG - Intergenic
1157421765 18:47553861-47553883 GTGGAAAGAGATGCTCTCTGTGG - Intergenic
1158284914 18:55869634-55869656 GTGGACAGATAAGGTCTTCTGGG + Intergenic
1159211911 18:65334173-65334195 GTAGTTAGAGAAGGCCTCTTGGG - Intergenic
1161548416 19:4896575-4896597 GGGGACAGAGAAGGTCCCATGGG - Intronic
1161963857 19:7537067-7537089 GTGGAAGGAGAAGGTCACTGAGG - Intronic
1162535657 19:11261920-11261942 GGGGACAGAGATGGGCTCCTTGG - Intronic
1163883264 19:19945418-19945440 GTGGACACAGACGATCCCTTTGG - Intergenic
1164475037 19:28569178-28569200 GAGGACACAGAAGTTCTGTTGGG + Intergenic
1164515461 19:28931671-28931693 GTGGCAAGAGAAGAACTCTTCGG + Intergenic
1164600984 19:29563007-29563029 GTGGACAGACAAGGTTGCTGTGG + Intronic
1164732871 19:30519308-30519330 GTGGACAGGGAAGGGCCCTGTGG + Intronic
1165340824 19:35210963-35210985 GTCAACAGAGAAGGGCTCTGTGG + Intergenic
1165403375 19:35615770-35615792 GTGGTCAGCGAAGGCCTCTGAGG + Intronic
1166194445 19:41196715-41196737 TTGGACAGGGAAGGTCTGTCTGG + Intronic
1166919199 19:46217278-46217300 GAGAAAAGAGAAGGTCTCTCAGG + Intergenic
1167406502 19:49312344-49312366 GTGGACAGGGAAGGCATCTCTGG - Intronic
925078434 2:1039991-1040013 GTTGAAAGAGAAGGTCTCTGGGG + Intronic
925645938 2:6037198-6037220 GTGGACAGTGATGGTCTCCATGG + Intergenic
926219355 2:10924831-10924853 GTGGTCAGAGAAGGCTTCCTGGG - Intergenic
927646250 2:24878823-24878845 GTGGGCAGGGAAGGCCTCTGAGG - Intronic
928381892 2:30825186-30825208 CTGGGCAGAGCAGATCTCTTGGG + Intergenic
928578448 2:32680519-32680541 GTGGTCAGGGAAGGTCTCAGTGG + Intronic
928731257 2:34235994-34236016 GGGGACAAACAAGGTCCCTTGGG + Intergenic
929298153 2:40271437-40271459 GTGGTCAGAGAAATTCTCTGAGG - Intronic
930221167 2:48748223-48748245 GAGGGCAGAGATGGTATCTTTGG + Intronic
930334695 2:50030085-50030107 GAGGAGAAAGAGGGTCTCTTTGG + Intronic
931496866 2:62817272-62817294 GTGGGCAGAGAAGGCCTCTCTGG + Intronic
931790806 2:65662399-65662421 GTGGGCAGAGCAAGTCCCTTGGG + Intergenic
931879705 2:66555722-66555744 GAGGAGAGAGAGGGTCTCTCTGG - Intronic
932264613 2:70356825-70356847 GTGGACTAATAAGGGCTCTTTGG - Intergenic
932461645 2:71885639-71885661 GTGGACAGAAAAGGTCCCTGAGG - Intergenic
935241863 2:101185816-101185838 GTGGTCAGAGCAGGTGTTTTAGG - Intronic
938153407 2:128905600-128905622 GTGAACAGAAAATTTCTCTTGGG - Intergenic
938176991 2:129142789-129142811 CTGTGCAGAGAATGTCTCTTTGG - Intergenic
939290905 2:140193711-140193733 GTGGCCAGGGAAGGCCTCTATGG - Intergenic
939682849 2:145160179-145160201 GTGCACAGAGTAGCTTTCTTTGG + Intergenic
939841744 2:147197739-147197761 GTGGACAGAGAAGATCATCTAGG - Intergenic
942022813 2:171883737-171883759 GTGGTCAGTGAAGGGCCCTTAGG - Intronic
942115684 2:172726767-172726789 GTAGTCAGAGAAGGCCTCTCTGG - Intergenic
942318675 2:174717196-174717218 GGGGACAAAGAAGGGCTCCTAGG - Intergenic
943762769 2:191628040-191628062 GTGGACACAAAAGATCTTTTGGG + Intergenic
944768022 2:202884509-202884531 GTGGCCAGAGAGGGTCACTATGG + Exonic
945097842 2:206236559-206236581 TTGGAGAGAGAATGTCTCTTTGG + Intergenic
946498664 2:220222168-220222190 TTGGAAAGAGATGCTCTCTTGGG + Intergenic
946929703 2:224659667-224659689 GTGGGCAGAGAAGGACACATAGG - Intergenic
947544903 2:231003645-231003667 GTGGAAAGAGCAGCTCCCTTTGG + Intronic
947884699 2:233558204-233558226 GTGGTAGGAGAAGGTCTCTGTGG - Intronic
1168731329 20:84124-84146 ATGGAGAGAGAAGGTCTATATGG - Intergenic
1168952750 20:1813734-1813756 GTGGTCAGGGAAGGCCTCTCTGG + Intergenic
1169179815 20:3553810-3553832 ATGGTCAGAGAAGATCTCTCTGG - Intronic
1169702484 20:8463299-8463321 GGGTACACAGAAGGTCTCTAAGG - Intronic
1169919695 20:10721663-10721685 GTGGATAAAGAAGGTCACTGTGG - Intergenic
1171062996 20:21984543-21984565 AGGGACAGAGAAGTGCTCTTTGG + Intergenic
1171487193 20:25493737-25493759 GTGGGCAGGGAGGGTCTCTGTGG - Intronic
1173049294 20:39543630-39543652 GTGCCCAGAGAAGGCCTCCTAGG - Intergenic
1173618251 20:44416818-44416840 GAGGTCAGAGAAGGCCTCTAAGG - Intronic
1173691532 20:44964941-44964963 GGGGACAAAGGAGGTCTGTTTGG + Intergenic
1174037034 20:47674751-47674773 GTGGCCCGAGGACGTCTCTTAGG - Intronic
1174186606 20:48710717-48710739 GTGGTCTGAGAAGGTCTCTCTGG + Intronic
1174305372 20:49611036-49611058 GTGGGCAGAGCAGGTTTCTGCGG + Intergenic
1174503534 20:51002605-51002627 GTGGTCAGGGAAGGCCTCTCTGG + Intergenic
1175130848 20:56788544-56788566 ATGGTCAGGGAAGGCCTCTTTGG + Intergenic
1175227361 20:57452393-57452415 GTGGTCAGAGAAGGCCTCTGGGG + Intergenic
1175348649 20:58301821-58301843 GTGGCCAGAGAAGGCATCTCTGG - Intergenic
1178448968 21:32674318-32674340 GTGGTCAGAGAAGGCCTCATTGG - Intronic
1178472767 21:32908693-32908715 AAGGACAGTGAAGGTTTCTTGGG + Intergenic
1178492351 21:33060778-33060800 GTGGTCTGAGAAGGTCTCTGGGG + Intergenic
1178804713 21:35829365-35829387 GTGGACTGAGAAAGTCTCTCAGG + Intronic
1181271917 22:21664067-21664089 GTGGTTAGGGAAGGTCTCTCTGG + Intronic
1182026320 22:27121991-27122013 ATGGTCAGAGAAGGTCCCTCTGG - Intergenic
1182067524 22:27441414-27441436 GGGGACAGGGAAGATCTCTGGGG - Intergenic
1182253793 22:29023449-29023471 GGGGACAAAGAGGGTCTCTTAGG - Intronic
1182574388 22:31263001-31263023 GTGGACAGAGACTGACTCTCAGG - Intronic
1184404351 22:44291756-44291778 GGGGACAGGGAAAGTCTCTCTGG - Intronic
950649122 3:14396337-14396359 GTGGTCTGGGAAGGTCTCTGGGG + Intergenic
950838125 3:15940179-15940201 GTGGTCAAGGAAGGTCTCATTGG - Intergenic
953243660 3:41171478-41171500 GGGGTCAGAGAAGGGCTCTGAGG + Intergenic
953772332 3:45787341-45787363 GTGGACAGAGAAGGCGGCTCTGG - Intronic
955017692 3:55087996-55088018 GTGGAGAGAGAAGGGGTCTCAGG - Intergenic
956209055 3:66784652-66784674 GTGGGCAGAAAAGGACTCTAAGG - Intergenic
958145305 3:89615613-89615635 GTGGACAGAGCAAGTCACCTTGG - Intergenic
959971740 3:112417186-112417208 GTGGTCAGGGAAGGCCTCTGTGG - Intergenic
960536956 3:118825386-118825408 GTGGGCAGGGAAGTTCTCTCTGG - Intergenic
962071318 3:132036199-132036221 GTGTACAGAGAAGCTCCCTGAGG - Intronic
962151877 3:132902307-132902329 GTGGAAAGAAGGGGTCTCTTTGG - Intergenic
962365259 3:134774889-134774911 GTGGACAGGGAAGCCCTCCTAGG - Intronic
962431781 3:135326763-135326785 GTGGTCTTAGATGGTCTCTTTGG - Intergenic
964356139 3:155853837-155853859 GGGGACAGAGAAGCTCTTCTGGG - Exonic
964458413 3:156894154-156894176 CTGGACAGATAAAGCCTCTTTGG + Intronic
966382018 3:179353917-179353939 GTGGTCAGAGAAGGTGTCCAAGG - Intronic
968274975 3:197434040-197434062 GTGGAGAGAGAAGTGCTCGTTGG - Intergenic
970020666 4:11564037-11564059 TTGGACAGAAAAGGTCTCTGTGG + Intergenic
970365981 4:15358882-15358904 GTGGACAGAGTAGGATTCATGGG + Intronic
975509128 4:75172955-75172977 CTGAAGAGAGAAAGTCTCTTTGG - Intergenic
977576180 4:98676840-98676862 GTGGTCAGGGAAGGTCTTTGAGG + Intergenic
978200007 4:106014851-106014873 GTGGACAGGGAAGTTCTGATTGG + Intergenic
980394045 4:132185838-132185860 GTGGAAAGAGAAGGATGCTTGGG + Intergenic
980496363 4:133590832-133590854 TTGGACAGAGAAAGCCTCTGAGG + Intergenic
981235480 4:142410326-142410348 GGGGAAAGAGATGGTCACTTGGG - Intronic
984201077 4:176721915-176721937 GTCTGCAGAGAAGGTGTCTTAGG + Intronic
984592988 4:181637105-181637127 GTGGTCAGAGAAGGTCTTCATGG - Intergenic
985369250 4:189267753-189267775 GTGGAAACAGATGGTCTCTGTGG + Intergenic
989564231 5:42885582-42885604 GTGAACAAAGATGGTTTCTTTGG - Intronic
995128030 5:108599575-108599597 GTGGTCAGAAAAGGCCTATTGGG + Intergenic
995394991 5:111677998-111678020 GGGGACAGAGAAGTTTCCTTAGG + Intronic
995561050 5:113381999-113382021 GTGGGCAGAAAAGGAATCTTTGG + Intronic
996393124 5:122985320-122985342 GTGGTGAGAGAAGGACTCTTAGG + Intronic
996422702 5:123279554-123279576 GGGGACAGAGAATGGCTGTTGGG - Intergenic
996901768 5:128551286-128551308 CTGGACAGAGGAGGTTTCATTGG - Intronic
998260941 5:140631604-140631626 GAGGACAGATAGGGTTTCTTAGG + Intergenic
999191065 5:149747846-149747868 GAGGACAGTGATGGTGTCTTGGG + Intronic
1000462754 5:161543793-161543815 GTGGTTAGAGAATGTTTCTTGGG - Intronic
1000923000 5:167160617-167160639 GTGGGCAGGGAAGTTCTCTGAGG - Intergenic
1002360953 5:178670444-178670466 GTGTACACAGAAGGGCTCTGAGG + Intergenic
1003300503 6:4876976-4876998 AGGGACAAAGAAGCTCTCTTGGG - Intronic
1006934830 6:37710071-37710093 GTAGACAGGGAAGGTCTCTCTGG + Intergenic
1008699939 6:54086855-54086877 TTGGACAGAGAAGGCTTCCTTGG - Intronic
1009590398 6:65662276-65662298 GTGAAGAGAGAAGGTCACTGTGG + Intronic
1010958658 6:82120347-82120369 GTGGACAGAGCACATCTCCTGGG - Intergenic
1012092317 6:94914611-94914633 GTGGTCAGAGTGGGTCTCATTGG - Intergenic
1012448346 6:99329112-99329134 GAGGACAGAGAGGGTCAATTTGG + Intronic
1013108039 6:107042710-107042732 GTGTACAGAGCAGGTGTCTGAGG + Intronic
1014115476 6:117664018-117664040 GTGGCCAGAGAATGACACTTTGG - Intergenic
1017932140 6:158965802-158965824 GTGGCAAGATAAGGTGTCTTTGG + Intergenic
1018229411 6:161661469-161661491 GTGGTCAGGGAAGGCCTCTGTGG - Intronic
1019079182 6:169417973-169417995 GTGGCCAGGGAAGGTCTTTGTGG - Intergenic
1019649838 7:2150823-2150845 GTGGGCAGAGGAGGCCTCTCTGG - Intronic
1019924309 7:4182225-4182247 GGGGACAGAGAGGGTGTCCTGGG - Intronic
1020224152 7:6266686-6266708 GTGGCCAGGGAAGGCCTCTGAGG - Intronic
1022031922 7:26499607-26499629 GTTGACAGTGAAGGTGTCTGGGG + Intergenic
1022175620 7:27869417-27869439 GTGGACAGACTAGGTATTTTGGG + Intronic
1023169563 7:37377531-37377553 GTAGACAGAGCAGGTCACTGGGG + Intronic
1024402459 7:48940739-48940761 GTTGTCAGAGATGGTCTCATTGG + Intergenic
1028076918 7:86527819-86527841 GGAGACAAAGAAGGTCTCTAAGG + Intergenic
1031453531 7:121951789-121951811 CTGGACAGAGAAGGTTTATCAGG - Intronic
1032681664 7:134190976-134190998 GTGGAGAGAAAAGGCCTCTTTGG + Intronic
1033038106 7:137894021-137894043 TTGGAGAGAGACAGTCTCTTGGG + Intronic
1033581796 7:142744598-142744620 GTGGTCAGGAAAGGTCTCTTTGG - Intergenic
1033824715 7:145175287-145175309 GTGGCCAGAGAAGGTGTTTCAGG - Intergenic
1033994106 7:147324093-147324115 GAGGCCAGAGAAAGTATCTTTGG + Intronic
1034821181 7:154217800-154217822 GTGGTCACAGCAGGGCTCTTTGG - Intronic
1034841893 7:154405682-154405704 GTGGACAGAGAAGGGAACCTGGG + Intronic
1036244427 8:7104301-7104323 ATGGACAGAGAAGGTCCTCTTGG + Intergenic
1036256315 8:7209442-7209464 ATGGACAGAGAAGGTCCTCTTGG - Intergenic
1036308366 8:7668026-7668048 ATGGACAGAGAAGGTCCTCTTGG - Intergenic
1036361169 8:8078052-8078074 ATGGACAGAGAAGGTCCTCTTGG + Intergenic
1036499451 8:9299914-9299936 GTGGGCAGAGAAGGACTCAGAGG + Intergenic
1037202690 8:16276953-16276975 GAGGTCAGAGAAGGTCTTTAAGG + Intronic
1037856424 8:22374444-22374466 GGTGACAGAGAAGGCTTCTTGGG + Intronic
1038833339 8:31088301-31088323 GTGGACAGGGAAAGTGACTTGGG + Intronic
1039427503 8:37497952-37497974 GAGGAAAGGAAAGGTCTCTTTGG - Intergenic
1039555298 8:38470869-38470891 ATGGGCAGGGAAGGCCTCTTGGG - Intergenic
1039830200 8:41207295-41207317 GTGGTCAGGGAAGGTTTCTAGGG - Intergenic
1042088393 8:65132682-65132704 GTGGGCAGTGAAGTACTCTTTGG - Intergenic
1042726917 8:71888806-71888828 GTGGAAAGAAGGGGTCTCTTTGG + Intronic
1042796482 8:72668641-72668663 GTGGTCAGAAATGGCCTCTTTGG - Intronic
1043160106 8:76836447-76836469 GTAGTCAGAGAAGTTCTCTGAGG + Intronic
1043435942 8:80236527-80236549 GGGGACAGAGAAGGCCTCTCCGG - Intergenic
1045524935 8:102933481-102933503 GTGTACAGAGCTGGTCTGTTGGG - Intronic
1046828082 8:118713913-118713935 GTACACAGAGAAAGTCTCTTTGG + Intergenic
1047457707 8:125031253-125031275 GTGGACTTAGAAGATCACTTTGG + Intronic
1049923984 9:391223-391245 GTGGTCAGAAAAGGCCTCTTGGG - Intronic
1058649015 9:107157611-107157633 GTGATCAGAGAAGGGCTCTCTGG - Intergenic
1058652482 9:107189496-107189518 GTGGATATAGAAGGGCTTTTGGG - Intergenic
1058699370 9:107587987-107588009 ATGGAGAGACAAGGGCTCTTGGG + Intergenic
1059280160 9:113126081-113126103 CTGGACAGTGAAGATCTCTGAGG + Intergenic
1061196119 9:129108173-129108195 GGGGGCAGAGACGGCCTCTTGGG + Intronic
1061371285 9:130198934-130198956 GTGGAGAGGGAAGGTGTCCTTGG - Intronic
1062373853 9:136253358-136253380 GTGGCCAGGGAAGGTCTGTCAGG - Intergenic
1062443839 9:136585159-136585181 GTGGGCAGGGAAGGCCTCTCTGG + Intergenic
1187069602 X:15875044-15875066 GTGGTCAGGGAAGGCCTCTCTGG + Intergenic
1187986274 X:24815298-24815320 CTAGACAGAGAAGGTCTCTGTGG - Intronic
1189327363 X:40120894-40120916 GTGCTCAGGGGAGGTCTCTTGGG + Intronic
1189770125 X:44417096-44417118 GTGGAAGGAAAGGGTCTCTTTGG + Intergenic
1191799119 X:65058083-65058105 CTGGACAGAGAATGCCTCTGAGG - Intergenic
1192510630 X:71718694-71718716 GTGCACAGAGGAGGTCTCATTGG + Intergenic
1192516067 X:71762859-71762881 GTGCACAGAGGAGGTCTCATTGG - Intergenic
1195139748 X:101947545-101947567 TTGGAAAGAGTTGGTCTCTTTGG - Intergenic
1195449753 X:104998247-104998269 GAGGACAGAGAATTTCTATTTGG + Intronic
1198298350 X:135309011-135309033 GTTGAGAGAGTAGGTCTCTTTGG - Intronic
1198683613 X:139205501-139205523 GTGGGGAGAGAAGGGCTCTCTGG + Intronic
1199239086 X:145525983-145526005 GTGGAAAAAGGAGGTCTTTTTGG - Intergenic
1200232005 X:154448793-154448815 GTGGACAGGGAAGCTGGCTTGGG - Intronic