ID: 1091066958

View in Genome Browser
Species Human (GRCh38)
Location 11:132523424-132523446
Sequence AAGGGCCTTCTCTGAGTATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091066958_1091066966 23 Left 1091066958 11:132523424-132523446 CCCTATACTCAGAGAAGGCCCTT 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1091066966 11:132523470-132523492 GACTAATCAACTTAGTTTTATGG 0: 1
1: 0
2: 0
3: 6
4: 123
1091066958_1091066963 1 Left 1091066958 11:132523424-132523446 CCCTATACTCAGAGAAGGCCCTT 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1091066963 11:132523448-132523470 CCCACCACTAGTTCTTATTTAGG 0: 1
1: 1
2: 1
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091066958 Original CRISPR AAGGGCCTTCTCTGAGTATA GGG (reversed) Intronic
902127501 1:14228506-14228528 ATGGCCCTTCTCTGAGCAAATGG - Intergenic
902826150 1:18975819-18975841 AAGTGCCTACACTGAGGATAAGG - Intergenic
906566000 1:46801521-46801543 AAGGGCCTTCTCTTGGCATCAGG + Intronic
908069053 1:60438447-60438469 AAAGGCCTTTTCTGCGTCTATGG - Intergenic
908564980 1:65345116-65345138 ATAGGCCTTCTCTCTGTATAAGG + Intronic
910247262 1:85152993-85153015 AACAGCCTGCTCTGAGAATAAGG - Intergenic
913237705 1:116799114-116799136 CAGGGCTTTCTCTGAGAATGTGG - Intergenic
916257259 1:162801810-162801832 AAGGGAGTTCTCAGAGTATCAGG - Intronic
917704369 1:177616700-177616722 AAGGGCTTTCTCTGTGTTAAAGG - Intergenic
1063611690 10:7568301-7568323 AAGGGCCTTCTCTGGGGCAAGGG + Intronic
1064087188 10:12354008-12354030 AAGTGACTTCTATGAGTCTAGGG - Intronic
1066723711 10:38367504-38367526 AAGGGAGTTCTCAGAGTATCAGG - Intergenic
1069637001 10:69930998-69931020 AGGGGCCTTCTCTGGGTCTCAGG + Intronic
1069727055 10:70586806-70586828 AAAGGCCTTCCTTGAGTAGAGGG + Intergenic
1070344081 10:75524610-75524632 AATGGAGTTCTCTGTGTATATGG + Intronic
1075584158 10:123645072-123645094 AGGAGCCTTCTCTGTGTAGAAGG + Intergenic
1076585962 10:131547820-131547842 AGGGGCCTTCTCAGAGGAAAGGG + Intergenic
1076605143 10:131684494-131684516 TTGGGCCTTTTCAGAGTATAAGG + Intergenic
1077718110 11:4601176-4601198 ATGGGCCTTATCTTAGTACAGGG + Intronic
1078642289 11:13108012-13108034 AAGGGCCTTCTCTGAAAAACAGG - Intergenic
1078849401 11:15150228-15150250 ATGCGCCTTCTCTGTGTATGTGG - Intronic
1079003194 11:16774621-16774643 AAGGGACCTCTCTGAGCACAAGG - Intergenic
1087299675 11:96417252-96417274 AAGTGTCTTCTCTGACTACATGG + Intronic
1088809937 11:113385430-113385452 AGGGACCCTTTCTGAGTATAAGG - Intergenic
1089767433 11:120778013-120778035 CAAGGCCTTCCCTGAGTAAAGGG - Intronic
1090518948 11:127458456-127458478 ACAGGCCTGCTCTGATTATATGG - Intergenic
1091066958 11:132523424-132523446 AAGGGCCTTCTCTGAGTATAGGG - Intronic
1091227842 11:133968389-133968411 AAGCCCCTTGTCTGAGGATAGGG + Intergenic
1093787386 12:23208204-23208226 AAGGAAGTTCTCTGAGGATAGGG - Intergenic
1094230340 12:28095395-28095417 AAGTGCCTTCTCTGTGTCTTGGG + Intergenic
1098467386 12:70803292-70803314 AGGGGCCAGTTCTGAGTATAGGG + Intronic
1099563919 12:84216253-84216275 AAGGCCATTCTCTGAGTTTGGGG - Intergenic
1101731685 12:107432093-107432115 CAGGGCCATTTCTGTGTATAAGG + Intronic
1105302614 13:19149969-19149991 GAGGGCCTTCTCTAAGAAGATGG - Intergenic
1112941017 13:104861715-104861737 AAGGGCCTTGTCTTAGAAGAAGG - Intergenic
1115100413 14:29691479-29691501 AAGGGCTTTCTGAGAGTATGTGG + Intronic
1117154960 14:52929692-52929714 AAAAGGCTTCTCTGAGAATATGG - Intronic
1117604635 14:57415134-57415156 CAGGTCCTTCTCCTAGTATATGG - Exonic
1118639105 14:67775894-67775916 CAGGGCTTTCTCTGCGTATCTGG + Exonic
1126721091 15:51580617-51580639 TTGGGCCTTCTCTGTGTGTAGGG - Intronic
1127630870 15:60826432-60826454 AAGGGCCCTCTCTGAGCTAAGGG - Intronic
1130175996 15:81571566-81571588 AAAGCCATTCTCTGAGAATAGGG - Intergenic
1131217168 15:90547835-90547857 AAAGGGCTTCTCTCTGTATAGGG + Intronic
1134610541 16:15604878-15604900 GAGGGCCTACTCTGATTACAAGG + Intronic
1141164536 16:81651617-81651639 AGGGGCTTTCTCTGAGTTGAAGG - Intronic
1145099749 17:20064729-20064751 AAGGGCTTTCTGTAAGTACATGG - Intronic
1148671410 17:49413329-49413351 GAGGGCCTTCTCTGAGGATTTGG - Intronic
1149077623 17:52615457-52615479 AAAGGCCTTTTCTGCGTCTATGG + Intergenic
1151306070 17:73263360-73263382 TGGGGCCATCTCTGAGGATAGGG - Intergenic
1151858894 17:76743960-76743982 AAGGGGCTTCTCAGGGTCTAAGG + Intronic
1152495285 17:80666921-80666943 TAAAGCCTTCTCTGAGGATACGG - Intronic
1153096525 18:1412421-1412443 AAACCACTTCTCTGAGTATATGG - Intergenic
1155227920 18:23746292-23746314 AAGGGGCTTCTTTGAGCAAAGGG + Intronic
1157876267 18:51276512-51276534 AGGGGCCTCCCCTGAGTTTAAGG - Intergenic
1157942622 18:51945824-51945846 AATGGCTTTCTCTGACTTTAAGG + Intergenic
1162098542 19:8325263-8325285 AAGGTCCTTCACTGAGCAGATGG - Intronic
1163557773 19:18002141-18002163 GGGGGCCTTCTCTGAGAATCAGG - Intronic
1163947819 19:20556259-20556281 AAGGGCCTTATGTGACTGTAAGG - Intronic
1164121471 19:22269221-22269243 AAGGGGCTTCTCTCACTTTATGG + Intergenic
1164289577 19:23855247-23855269 ACGGGCCTTCTCTGACCACAAGG + Intergenic
1166254351 19:41591953-41591975 AAGGGCCATCTCAGAGTGTGGGG - Intronic
1168690422 19:58373363-58373385 AAGGAACTTCTCTGAGTACGAGG + Intronic
929819012 2:45258590-45258612 AAGGGCCTTTTCTGCGCAAAGGG - Intergenic
931138560 2:59431916-59431938 AAAGGCCTTTTCTGCGTCTATGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
933045134 2:77526004-77526026 AAGGGCCGTCTCCCAGTAGATGG - Intronic
933633526 2:84682459-84682481 CAGTGCCATCTCTGAGTAGATGG - Intronic
935315337 2:101827906-101827928 TAGGTCCTTCACTGAGTATTTGG + Intronic
937059115 2:118968467-118968489 AAAGGCTTTCTCAGACTATATGG + Intronic
937492500 2:122384392-122384414 AATGTCCTTCTCAGAGTATGGGG + Intergenic
938266045 2:129929058-129929080 AAGGGCCTTCTCAGAATGTGGGG - Intergenic
941067485 2:160919574-160919596 AAGTGACTTGTCTGAGTTTATGG - Intergenic
941942065 2:171050740-171050762 AAGCCTCTTCTCTGAGCATATGG - Intronic
942490423 2:176484372-176484394 GAGGGCCTTCTCTGAATATCAGG - Intergenic
944677579 2:202047150-202047172 AAGGGACATCTCAGACTATAGGG - Intergenic
945165769 2:206942797-206942819 AATAGCCTTTTCTAAGTATATGG + Intronic
947792346 2:232875675-232875697 AAAGCCCTTCTCTGCTTATAGGG - Intronic
1170113267 20:12828165-12828187 AAGGGGTTTCTCTGAGGATGTGG - Intergenic
1170203224 20:13767794-13767816 CAGGGCCTTATATGAGAATAGGG - Intronic
1176874291 21:14112993-14113015 AAGGGTCTTCTCTAAGTAGTGGG + Intronic
1180966986 22:19795320-19795342 AAGAGCCTTCTCTGCGTAACTGG + Intronic
1182850607 22:33470791-33470813 AAATGCCTCCTCTGAGTAAAAGG + Intronic
1184064033 22:42105677-42105699 AAGGGGCTTCTCTTATTTTATGG + Intergenic
950142552 3:10625412-10625434 CAGGGCCTTCTCTGAGTGATGGG + Intronic
950163203 3:10775094-10775116 AAGGGCCTTCTCTATGGATCTGG - Intergenic
950826012 3:15822113-15822135 ATGAGTCTTCTCTGAGCATATGG - Intronic
954495267 3:50952905-50952927 AAGGCCCTTTCCTGAGTATGTGG + Intronic
955916162 3:63911063-63911085 AAGTGCTTTCTCTGACTAGATGG - Intronic
956278318 3:67527796-67527818 AATGTCCCTCACTGAGTATAAGG + Intronic
958521154 3:95187527-95187549 AAGGGCATTGTCTGAGTAGTGGG + Intergenic
958613901 3:96465587-96465609 AAGGGGCATTTCTGAGTATTAGG - Intergenic
960277932 3:115748294-115748316 AAAGGCCTTTTCTGTGTCTATGG - Intergenic
961981488 3:131083967-131083989 AAGGGCATTCTCAGAGGATATGG - Intronic
962619689 3:137165252-137165274 GATCGCCTTCCCTGAGTATAAGG - Intergenic
963255949 3:143145156-143145178 GAGAGCCTTCTCTGACTACATGG + Intergenic
967912196 3:194551734-194551756 AAGGGGCATTTATGAGTATAAGG - Intergenic
968310608 3:197680636-197680658 AGGGGCCTTCCCTGACTAGAGGG - Intronic
969515587 4:7646393-7646415 AAGGGCCCTATCTGTGAATATGG - Intronic
971485228 4:27153178-27153200 AAGGGCCTTCTCTGAGTGCATGG - Intergenic
980034049 4:127863436-127863458 AAGGGCCTTTTCTGCATCTATGG - Intergenic
982537114 4:156620587-156620609 ATGGGGCTTCACTGAGAATATGG + Intergenic
987233798 5:15922558-15922580 AAAGGCCTTCTCAGAATTTAAGG + Intronic
987597293 5:20018772-20018794 AAGAGAGTTCTCTGAGAATAAGG + Intronic
996318691 5:122190031-122190053 TAGGGGCTTCTCTGACTATAGGG + Intergenic
998128502 5:139639447-139639469 AAGGGCCTTCTCTGCCTGTGGGG + Intergenic
999578757 5:153010747-153010769 AAGAGACTTCTCTAAGTTTAAGG - Intergenic
1001650243 5:173310814-173310836 AAGTGCCTTCTCAGAGTAAGTGG - Intergenic
1007727904 6:43927761-43927783 TGGGGCCTTCTCTTAGTCTAAGG + Intergenic
1008932634 6:56955513-56955535 AAGGGCCTTCCCTGGGAATTGGG + Intronic
1015537376 6:134280250-134280272 AAGTGCCTTTTCTCTGTATAAGG + Intronic
1026644196 7:72153722-72153744 AAAGGCCCTCTCTGAGTAAGGGG + Intronic
1028214241 7:88112550-88112572 AAGGGCCTGATCTCAGTAAAAGG + Intronic
1028731594 7:94157476-94157498 AAGAGCCTTCTCTTAGGATCTGG - Intergenic
1029224101 7:99012439-99012461 ATGGGGCTTCTGTGAATATAAGG - Exonic
1030165681 7:106552800-106552822 AAGGGAGTTCTCTGAGTTTAGGG - Intergenic
1032364624 7:131287551-131287573 AAGGTCCTCCTCTCAGGATAAGG + Intronic
1033234738 7:139629327-139629349 TACAGCCTTCTCTGAGTCTAAGG + Intronic
1037124295 8:15326832-15326854 TGTGGCCTTCTCTGAGTACAGGG - Intergenic
1037637910 8:20717031-20717053 AAGTGCCTTATCTAAGTTTAGGG + Intergenic
1039460596 8:37740672-37740694 AAGAACCTGTTCTGAGTATATGG + Intronic
1046119258 8:109824819-109824841 AAGGGACTTCTCTGACCACAAGG - Intergenic
1048465588 8:134662362-134662384 AAGGGCCTTCTCTGTCACTAAGG - Intronic
1051146788 9:14035319-14035341 CTGGCCCTTCTCTGAGTATAGGG + Intergenic
1051364931 9:16315208-16315230 AAAGGCCTGCTCTGAGGATAAGG - Intergenic
1052473492 9:28929454-28929476 AGCTGCCTTCTCTGAGGATATGG - Intergenic
1054858521 9:69926535-69926557 AAGGGGCTTCTCTTATTTTATGG + Intergenic
1056599893 9:88038626-88038648 AAGGGGCTTCTCTTATTTTACGG + Intergenic
1056733690 9:89186226-89186248 AAGGCCCTTCTCTGAGGACAGGG - Intergenic
1187733076 X:22276459-22276481 CAAAGCCTTCTCTGAGTAAAAGG - Intergenic
1188712133 X:33413914-33413936 GATGGCTTTCTCTAAGTATATGG + Intergenic
1189022803 X:37359369-37359391 AAGTGCTTTTTCTGAATATATGG + Intronic
1189221551 X:39376432-39376454 CAGGGCCTTCTCTGACACTATGG - Intergenic
1195013590 X:100756565-100756587 AAGCCCCTACTCTGAGTGTAGGG + Intergenic
1195603398 X:106774082-106774104 AAGGGCCCACTCTGATTTTACGG - Intronic
1200043370 X:153386546-153386568 CAGGACTTTCTCTGAGTCTATGG + Intergenic