ID: 1091076999

View in Genome Browser
Species Human (GRCh38)
Location 11:132628659-132628681
Sequence CTGGGGACACAGGTGGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 653}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091076999_1091077009 30 Left 1091076999 11:132628659-132628681 CCTTACACCACCTGTGTCCCCAG 0: 1
1: 0
2: 3
3: 63
4: 653
Right 1091077009 11:132628712-132628734 AATCCCCACGTGTCGTGGGAGGG 0: 49
1: 669
2: 3834
3: 8458
4: 8175
1091076999_1091077007 26 Left 1091076999 11:132628659-132628681 CCTTACACCACCTGTGTCCCCAG 0: 1
1: 0
2: 3
3: 63
4: 653
Right 1091077007 11:132628708-132628730 TCATAATCCCCACGTGTCGTGGG 0: 5
1: 103
2: 944
3: 3952
4: 7981
1091076999_1091077006 25 Left 1091076999 11:132628659-132628681 CCTTACACCACCTGTGTCCCCAG 0: 1
1: 0
2: 3
3: 63
4: 653
Right 1091077006 11:132628707-132628729 CTCATAATCCCCACGTGTCGTGG 0: 6
1: 116
2: 1083
3: 4318
4: 7968
1091076999_1091077008 29 Left 1091076999 11:132628659-132628681 CCTTACACCACCTGTGTCCCCAG 0: 1
1: 0
2: 3
3: 63
4: 653
Right 1091077008 11:132628711-132628733 TAATCCCCACGTGTCGTGGGAGG 0: 52
1: 661
2: 3458
3: 7818
4: 9010

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091076999 Original CRISPR CTGGGGACACAGGTGGTGTA AGG (reversed) Intronic
900689391 1:3971109-3971131 CTGGGGCCCCAGGGGGTGTCAGG + Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
903047103 1:20572906-20572928 TTGGGGAAACAGGTGATGTTTGG + Intergenic
903176081 1:21581645-21581667 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
903496210 1:23769306-23769328 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
903548485 1:24141769-24141791 CTGGGGAGACATGTGTTGTGTGG + Intronic
903610211 1:24605917-24605939 ATGTGGACACAGTTGGGGTAGGG - Exonic
903846129 1:26280742-26280764 CTGGGGACAGAGGGTGGGTAGGG - Intronic
904377040 1:30088183-30088205 GTGAGGACACAGGTGGTGCTGGG + Intergenic
905367841 1:37464774-37464796 CTGGGGTCACAGGGATTGTAAGG + Intergenic
905389938 1:37629807-37629829 CTGGGGACAGAGAGGGTGTGGGG + Exonic
905740899 1:40370693-40370715 CTGGGGACTGTGGTGGGGTAGGG + Intronic
906711749 1:47935366-47935388 GTGCGAACACATGTGGTGTAAGG - Intronic
906956207 1:50377011-50377033 TTGGGGAAACAGTTGGTGTTTGG - Intergenic
907846093 1:58208317-58208339 TTGGGGAAACAGGTGGTGTCTGG + Intronic
907923129 1:58931555-58931577 TTGGGGACACAGGGGATGTGGGG - Intergenic
908356417 1:63328210-63328232 CCGGGGACACAGGTGGAGTCCGG - Intergenic
908604699 1:65783564-65783586 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
908614242 1:65899997-65900019 TTGGGGGAACAGGTGGTGTTTGG - Intronic
908668112 1:66514906-66514928 TTGGGGAAACAGGTGGTATTTGG - Intergenic
909060482 1:70873589-70873611 TTGGGGGAACAGGTGGTGTTTGG + Intronic
909396354 1:75174846-75174868 TTGGGGAAACAGGTGATGTTTGG + Intergenic
909811630 1:79938541-79938563 CTGGGGACTGTGGTGGGGTAGGG - Intergenic
909827876 1:80148417-80148439 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
909860595 1:80600220-80600242 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
910355080 1:86344050-86344072 CTTGGGGAACAGGTGGTGTTTGG + Intergenic
910836954 1:91523619-91523641 CTGGGCACACAAGGGGTGCAGGG + Intronic
910899143 1:92100949-92100971 GTGGGGGAACAGGTGGTGTTTGG + Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911620754 1:100064533-100064555 TTGGGGTCACAGGTGGAGCATGG - Intronic
912712605 1:111960614-111960636 CTTGGGCCAGAGGTGGGGTAGGG + Intronic
912853380 1:113146272-113146294 CTGGGGACACAGGAAGTTTCTGG + Intergenic
914377887 1:147089124-147089146 CTGGGGGAACAGGTGGTATTTGG - Intergenic
915477466 1:156161323-156161345 CTGGGGGCACAGGGGGAGTCAGG - Intronic
915527697 1:156486219-156486241 CTGGGGTCACAGGTGAGGAATGG - Intronic
915901636 1:159850862-159850884 CTAGGGCCACAGGAGGTGTGGGG - Intronic
916205048 1:162308309-162308331 GTGGGCACACAGGTGGAGTTGGG + Intronic
916917792 1:169428526-169428548 TTGGGGGAACAGGTGGTGTTTGG + Intronic
917663527 1:177201151-177201173 TGGGGGAAACAGGTGGTGTTTGG - Intronic
917706772 1:177642587-177642609 TTGTGGACAGAGCTGGTGTAAGG + Intergenic
917837726 1:178954080-178954102 GTGGGGTCCCAGGAGGTGTAAGG - Intergenic
919193773 1:194257127-194257149 CTGGGGACTGTGGTGGGGTAGGG - Intergenic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920130694 1:203729692-203729714 CTGGGGACACAGGTGCTTCCTGG + Intronic
920412685 1:205774748-205774770 CTGGGGACCCAAGTGGGGTGGGG - Intronic
920430443 1:205915268-205915290 CTGGGGTCACAGGGGGTGTCGGG - Intronic
920841891 1:209562144-209562166 CTGGAAACACAGGGGGTGCAGGG + Intergenic
921188627 1:212690911-212690933 CAGGGGACACTGGCAGTGTATGG + Intronic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
923000894 1:230005556-230005578 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
923036274 1:230287203-230287225 ATGGTGACACAGGTGGTGGGTGG - Intergenic
923787682 1:237083947-237083969 CTGTGGACACACGTGGCATATGG + Intronic
923945133 1:238877279-238877301 TTGGGGGCACAGGTGGTATTTGG + Intergenic
924056657 1:240130908-240130930 CTTGGGGGACAGGTGTTGTAAGG - Intronic
924089484 1:240487600-240487622 CTGGGAACACAGTTGGTGAGTGG - Intergenic
1063182846 10:3621623-3621645 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1063377234 10:5561609-5561631 CTGTGGTCACTGGTGGTGTGAGG - Intergenic
1063507543 10:6614521-6614543 CTGGGGGTACAGGTGATGTTTGG + Intergenic
1064070391 10:12223888-12223910 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1064116385 10:12580913-12580935 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1064271544 10:13870540-13870562 CTGGGGACACAGGTGACCCAAGG + Intronic
1064612908 10:17122408-17122430 CTGGGGACACTGGTGTGGTGGGG + Intronic
1064889240 10:20150267-20150289 TTGGGGAAATAGGTGGTGTTTGG + Intronic
1065896237 10:30165307-30165329 CTGAGGACAGAAGAGGTGTATGG - Intergenic
1066819949 10:39472668-39472690 CTGGGGACTGTGGTGGGGTAGGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067291522 10:44946992-44947014 CTGGTCACACAGCTGGTGAAGGG - Intergenic
1067303904 10:45040548-45040570 TTGGGGAAACAGGTGGTATTTGG - Intergenic
1068177297 10:53477775-53477797 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1068812786 10:61275408-61275430 CTGGAGACACAGGTAATCTAGGG + Intergenic
1068912282 10:62391254-62391276 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1069293760 10:66817185-66817207 TTTGGGAAACAGGTGGTGTTTGG - Intronic
1069856509 10:71443865-71443887 CTGGGAACACAGGTCCTGTTTGG + Intronic
1070421401 10:76241227-76241249 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1070629298 10:78073339-78073361 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1071020848 10:81053457-81053479 ATTGGGACACAGATGGTGTTTGG - Intergenic
1071488334 10:86118449-86118471 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1071801848 10:89072314-89072336 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1071870349 10:89787601-89787623 ATTGGGACACAGGTGGTGTTTGG + Intergenic
1072756215 10:98022877-98022899 CTGGGGCCAGGGGTGGGGTAGGG + Intronic
1072868339 10:99088232-99088254 TTGGGGAAACAGGTGGTATTTGG + Intronic
1072873692 10:99148987-99149009 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1073327316 10:102650369-102650391 GTGGGGGCCCAGGTGGTGGAGGG + Intronic
1073877182 10:107938425-107938447 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1075071624 10:119323721-119323743 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1075624265 10:123950620-123950642 CTGGGGACACAGGCTGTGTGGGG - Intergenic
1076561117 10:131364897-131364919 CTTTGGACACAGGTGGGGTCAGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076797540 10:132805578-132805600 CTCGGGTCCCAGGTGGTGGAGGG - Intergenic
1077452018 11:2654104-2654126 GTGGAGACACAGGTGGTGGCGGG + Intronic
1077833748 11:5904620-5904642 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1078558314 11:12349404-12349426 CTGAGTACCCAGGTGGTGTGTGG - Intronic
1079854912 11:25590800-25590822 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1079862590 11:25692724-25692746 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1080835480 11:35936659-35936681 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1082772436 11:57218743-57218765 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1083537735 11:63486777-63486799 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1084578869 11:70009797-70009819 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1084684932 11:70687885-70687907 GTGGGGACACCGGTGGTGGGTGG - Intronic
1086015533 11:82161715-82161737 CTGGGGACTGCGGTGGGGTAGGG + Intergenic
1086513362 11:87584892-87584914 ATTGGGATACAGGTGGTGTTTGG + Intergenic
1088363300 11:109013409-109013431 CTGTGGACTCAGGAGGTGTGCGG + Intergenic
1088496076 11:110432440-110432462 TTGGGGGCACAGGTGGTGTTTGG + Intronic
1088512214 11:110589422-110589444 CTGGGCACTCAGCTGGAGTAGGG + Intronic
1089077173 11:115747516-115747538 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1089477342 11:118775342-118775364 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1089583298 11:119494991-119495013 GTGGGGACACAGGCAGTGTGGGG + Intergenic
1089819982 11:121215991-121216013 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1089955099 11:122563208-122563230 TTGGGGGCACAGGTGGTTTTCGG - Intergenic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090767797 11:129892080-129892102 TTGGGGGAACAGGTGGTGTCTGG + Intronic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091408296 12:222531-222553 CTGTGCACACAGCTGGTGTGAGG + Exonic
1092303339 12:7273807-7273829 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
1092506022 12:9101021-9101043 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1092700478 12:11223769-11223791 TTGGGGGGACAGGTGGTGTTTGG - Intergenic
1092705885 12:11284073-11284095 CTTGGGGAACAGGTGGTGTTTGG + Intergenic
1092710619 12:11333361-11333383 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1092748261 12:11693720-11693742 CTGGGGACAGAGATAGTGCAGGG - Intronic
1094157910 12:27356780-27356802 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1094446761 12:30539387-30539409 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1094779160 12:33770574-33770596 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1094817063 12:34198382-34198404 TTGGGGCCACAGGTGGTGTTTGG - Intergenic
1095121670 12:38426180-38426202 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1096088698 12:48883754-48883776 CTGGGAACAAAGGAGGTGTTTGG - Intergenic
1096564161 12:52462411-52462433 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1096921887 12:55096410-55096432 CTGGGGACAGTGGTGGGGTCGGG - Intergenic
1097465808 12:59923162-59923184 TTGGGCACACAGGTGGTTTTTGG + Intergenic
1097466073 12:59926233-59926255 ATTGGGAAACAGGTGGTGTTTGG - Intergenic
1098755755 12:74361367-74361389 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1098829121 12:75338552-75338574 TTGGGGAAACAGGTGATGTTTGG + Intronic
1100421848 12:94442482-94442504 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1100520200 12:95367427-95367449 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1100906270 12:99303655-99303677 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1100948364 12:99815512-99815534 TTTGGGACACAGGTGGTTTTTGG + Intronic
1101295025 12:103413505-103413527 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1101337188 12:103807214-103807236 CTAGGGACACAGGTAGGGGAGGG - Intronic
1101800680 12:108019358-108019380 CTGGGGGCACACGTGCAGTAAGG - Intergenic
1101855121 12:108435754-108435776 TTGGGGATACAGGTGGTTTTTGG + Intergenic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102434860 12:112913970-112913992 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1102929189 12:116849559-116849581 TTGGGGTCAGAGGTGGTGGAGGG - Exonic
1103130496 12:118464319-118464341 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1103430390 12:120879951-120879973 CAGGGAACAGAGGTGGAGTATGG - Intronic
1104866923 12:131961317-131961339 CTGGGGTCCCAGGTGGTGGATGG - Exonic
1104885472 12:132104685-132104707 CTGGGGTCCCAGGTGGTGGATGG - Exonic
1105759020 13:23496080-23496102 CTGGGCACACAGCTGGTCTTGGG - Intergenic
1106353335 13:28955933-28955955 ATTGGGACACAGGTGGTATTTGG + Intronic
1106502310 13:30340610-30340632 CTGGGGACACAGGGAGCCTATGG + Intergenic
1106899354 13:34338700-34338722 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1107701335 13:43051303-43051325 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1108151309 13:47537643-47537665 CTGGGGAAACAGGTGGTGTTTGG - Intergenic
1108240580 13:48459285-48459307 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1108522201 13:51256586-51256608 CTGGGGACACTGGTTTTGTGAGG + Intronic
1108631043 13:52282494-52282516 CTGGGGACTGTGGTGGGGTAGGG + Intergenic
1108825246 13:54405976-54405998 ATGGGGACACAGGAGGTATTAGG - Intergenic
1108826058 13:54413941-54413963 TTGGGGATACAAGTGGTGTTTGG - Intergenic
1108945451 13:56017761-56017783 CACGGGCCACAGGTGGTCTAAGG + Intergenic
1110122516 13:71900856-71900878 TTGGGGGAACAGGTGGTGTTCGG + Intergenic
1110288804 13:73780263-73780285 TTTGGGAAACAGGTGGTGTTTGG + Intronic
1110793163 13:79607213-79607235 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1111160478 13:84388554-84388576 TTGGGGAAACAGGTGGTGTTTGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113049234 13:106190148-106190170 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1113114687 13:106862825-106862847 ATGGGGGAACAGGTGGTGTTTGG - Intergenic
1113332828 13:109347170-109347192 TTGGTGAAACAGGTGGTGTTTGG - Intergenic
1113519495 13:110929490-110929512 CTGGGCACACAGGTCATGTGAGG - Intergenic
1113703164 13:112403448-112403470 TTTGGGAAACAGGTGGTGTTTGG + Intronic
1113936288 13:113996740-113996762 CTGAGGACACAGGTGGGCTCAGG + Intronic
1114760671 14:25310277-25310299 TTGGGGAAACAGGTGGTTTTTGG - Intergenic
1114801327 14:25779015-25779037 CTGGGGACTGTGGTGGGGTAGGG - Intergenic
1115011001 14:28544558-28544580 CTGGGGACTGTGGTGGGGTAGGG - Intergenic
1115341659 14:32299236-32299258 TTGGGGAAACAGGTGGTGTTTGG + Intergenic
1116836888 14:49777365-49777387 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1117298614 14:54401651-54401673 TTGGGGGGACAGGTGGTGTTTGG + Intronic
1117465391 14:55988337-55988359 CTGGGGACTCTGGTGGGGTGGGG - Intergenic
1117825075 14:59693377-59693399 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1118531444 14:66711070-66711092 TTGGGGGTACAGGTGGTGTTTGG + Intronic
1119582181 14:75795449-75795471 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1120325321 14:83016918-83016940 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1121444809 14:93972176-93972198 CTGGGGACACACGAGGAGTCAGG + Intronic
1121471591 14:94159303-94159325 ATGGGGGTACAGGTGGTGTTTGG + Intronic
1122005110 14:98697015-98697037 CTGGGGCCACAGGTGGGGGTGGG + Intergenic
1122232909 14:100315985-100316007 CTGGGGCCACAGGTGGGCGAGGG + Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1122423324 14:101590872-101590894 CTGGAGGCACAGGCGGTGTGTGG + Intergenic
1122717624 14:103705196-103705218 CTGGGGACACTGGTGGGGAAGGG - Intronic
1122725422 14:103747544-103747566 TTTGGGAAACAGGTGGTGTTTGG + Intronic
1122946724 14:105014436-105014458 CTGGGGAAATGGGTGCTGTAGGG - Intronic
1124665240 15:31586704-31586726 CTAGGGACATGGGTGGTGTAAGG - Intronic
1124683018 15:31753325-31753347 ATTGGGAGACAGGTGGTGTTTGG + Intronic
1125871246 15:43104071-43104093 CTGGTGACACAGGTAATATAAGG - Intronic
1126221185 15:46215440-46215462 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1127022441 15:54763446-54763468 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1127090918 15:55466058-55466080 TTGGGGAAACAGGTGGTGTTTGG - Intronic
1127500439 15:59549537-59549559 CTGGTGAGACAGGAGGTGAAAGG + Intergenic
1127505853 15:59597025-59597047 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1127970243 15:63953009-63953031 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1128568738 15:68718274-68718296 CTGGAGACACAGGAGGCTTAGGG + Intronic
1129540164 15:76342134-76342156 ATGGGGACACAGGTGGGGCGTGG - Exonic
1129632394 15:77275281-77275303 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1131505004 15:93009904-93009926 TTAGGGAAACAGGTGGTGTTTGG + Intronic
1131902070 15:97098877-97098899 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1132254584 15:100364812-100364834 TTGGGGAAACAGGTAGTGTTTGG - Intergenic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132715970 16:1289963-1289985 CTGGGGACACTGGTGCTGGGGGG - Intergenic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1132746534 16:1438587-1438609 CTGGGGCCTCAGGTGCTGTCAGG - Intronic
1132845433 16:1998992-1999014 CTGGGGACACAGGCCGGGTGGGG + Exonic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1132959572 16:2614334-2614356 CTGGCGACACAAGGGGTGTGAGG + Intergenic
1132972633 16:2696309-2696331 CTGGCGACACAAGGGGTGTGAGG + Intronic
1133277146 16:4645850-4645872 CTGGGGACCCAGGGGATGTGGGG + Intronic
1133387640 16:5383195-5383217 GTGGGGAAACAGGAGGAGTAGGG + Intergenic
1133523216 16:6579008-6579030 TTGGGAAAACAGGTGGTGTTTGG - Intronic
1133681181 16:8121645-8121667 CTGGGAACCCAGGAGGTGGAGGG - Intergenic
1133685889 16:8165266-8165288 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1134466543 16:14483866-14483888 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1135238577 16:20782268-20782290 TTTGGGAAACAGGTGGTGTTTGG + Intronic
1136395115 16:29988250-29988272 CTGGGGCCAGGGGTGGTGGAGGG + Exonic
1136916166 16:34200521-34200543 CTGGGGACTCTGGTGGGGTGGGG - Intergenic
1137473138 16:48780733-48780755 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1137473675 16:48787376-48787398 CTGGGGACTGTGGTGGGGTAGGG - Intergenic
1137739551 16:50754501-50754523 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1138063836 16:53919951-53919973 TTTGGGAAACAGGTGGTGTTTGG - Intronic
1140707647 16:77645498-77645520 CTGGGGACTCAGTTGTTGCATGG + Intergenic
1141303704 16:82841060-82841082 CTGGGGACACATGGGATGCATGG + Intronic
1141979667 16:87542101-87542123 CTGGGGACACAGGTTGGGGGTGG + Intergenic
1142314528 16:89335246-89335268 CTGGGAACAGGGGTGGTGTGAGG - Intronic
1143013898 17:3881553-3881575 CTGGGGACACAGGGAGGGAAAGG + Intronic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1144624966 17:16839913-16839935 CTAGGGACAGGGGTGGTGTGAGG - Intergenic
1144881464 17:18432808-18432830 CTAGGGACAGGGGTGGTGTGAGG + Intergenic
1145150769 17:20511578-20511600 CTAGGGACAGGGGTGGTGTGAGG - Intergenic
1146741395 17:35286932-35286954 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1147479466 17:40745446-40745468 CTGGGGACCAAGTTGGTGCAAGG + Intergenic
1147550340 17:41437446-41437468 GTGGGCCCACAGGTGGTGCAGGG + Exonic
1148694371 17:49550175-49550197 CTGGCGCCTCAGGTGGTGTAGGG - Intergenic
1149279950 17:55092275-55092297 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1150286549 17:63957624-63957646 CTGAGGACTCAGATGGTGTGGGG - Intronic
1150431106 17:65118170-65118192 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1150469937 17:65428654-65428676 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1150911488 17:69392263-69392285 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1153107721 18:1547234-1547256 CTGGGGAGACAGGTTGGGAAAGG - Intergenic
1153532517 18:6062856-6062878 TTGGGGATACAGGTGGTTTTTGG + Intronic
1153727555 18:7972298-7972320 CTGGGGACTGTGGTGGGGTAGGG + Intronic
1155375259 18:25150398-25150420 TTAGGGAAACAGGTGGTGTTTGG - Intronic
1155641335 18:28019259-28019281 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1156021561 18:32605812-32605834 CTGGGGACTCTGGTGGGGTCGGG - Intergenic
1156354863 18:36332239-36332261 CTGGGGCCACAGCTGCTGCAGGG - Intronic
1156866386 18:41893327-41893349 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1157105547 18:44771339-44771361 ATGGGTGCACAGGTGGTGTCAGG + Intronic
1157112347 18:44833015-44833037 CTGGGGACAGTGGAGGTGGATGG + Intronic
1157144465 18:45147637-45147659 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1157339672 18:46768189-46768211 CTGGGGTCACAGGTGCTGATTGG + Intergenic
1157619553 18:49008484-49008506 CAGGGGACCCAGGTGGGGCAGGG - Intergenic
1157945572 18:51975985-51976007 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1158149309 18:54349527-54349549 TTGGGGAAACAGGTGGTTTTTGG + Intronic
1158230310 18:55247431-55247453 CTGGGGAGATAGGTGGCTTATGG + Intronic
1158387288 18:57009409-57009431 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1158827781 18:61242870-61242892 CTGGGGACAGAGGTGTTTCATGG - Intergenic
1160905101 19:1448193-1448215 CTTGGGACACAGGGGGTGTCTGG - Intronic
1161687817 19:5712071-5712093 CTGGTGGCACAGGTGGTCCAAGG + Intronic
1162110784 19:8398526-8398548 CTGGGGACAGGGGTGGTGGGAGG + Intronic
1164823478 19:31267468-31267490 CTGGGGACACGGGTAGGGGAAGG - Intergenic
1165177049 19:33938184-33938206 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1165436151 19:35796678-35796700 CTCGGGACACAGTCGGTGTTCGG + Intergenic
1165772962 19:38389078-38389100 CGGGGGACACAGGATGTGTGGGG + Intronic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1165988278 19:39789834-39789856 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1166547432 19:43641592-43641614 CTGGGGACACAGGAGTTGATAGG - Intergenic
1166574580 19:43825886-43825908 TTTGGGAAACAGGTGGTGTTTGG - Intronic
1166616081 19:44247949-44247971 TTTGGGAAACAGGTGGTGTTTGG + Intronic
1167598553 19:50440287-50440309 ATTGGGAAACAGGTGGTGTTTGG - Intronic
1168083618 19:54028826-54028848 ATTGGGATACAGGTGGTGTTTGG + Intergenic
1168178901 19:54646191-54646213 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1168268667 19:55237753-55237775 CTGGGCACACAGTGGGTCTAGGG + Intronic
1168302416 19:55413516-55413538 TTGGGGGTACAGGTGGTGTTTGG - Intergenic
1168387022 19:55972454-55972476 TTGGGGAAACAGGTGGTGTCTGG + Intronic
925417834 2:3684443-3684465 TTGGGGGAACAGGTGGTGTTTGG + Intronic
925572992 2:5331523-5331545 CTGGGGAGGCAGGGTGTGTAGGG + Intergenic
925634624 2:5931100-5931122 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
925691266 2:6525717-6525739 CTGGGGACCCAGCAGGTTTAGGG - Intergenic
926866496 2:17365048-17365070 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
927107635 2:19841620-19841642 CTGGGGAGACAGATAGTGTAAGG + Intergenic
927156101 2:20222747-20222769 CTGGGGAGGCAGGTGGAGTTTGG - Intronic
927201100 2:20578517-20578539 CTCGGGATATAGGTGGTGTGTGG - Intronic
927785222 2:25969450-25969472 TTGGGGGAACAGGTGGTGTTTGG - Intronic
927972266 2:27313115-27313137 CAGGGTACACAGGTGTTGTCAGG + Intronic
928052799 2:28018017-28018039 TTTGGGAAACAGGTGGTGTTTGG + Intronic
928367919 2:30716953-30716975 CTGGGGCCACAGGTGCTGGTAGG - Intergenic
929398336 2:41550164-41550186 CTGGGGACAGTGGTGGGGTCGGG - Intergenic
930400768 2:50882464-50882486 CAGGTGACATAGCTGGTGTACGG + Intronic
930836369 2:55798096-55798118 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
931554201 2:63481857-63481879 TTGGGGGAACAGGTGGTGTTTGG - Intronic
931758994 2:65399935-65399957 TTGGGGGAACAGGTGGTGTTTGG - Intronic
931828759 2:66028801-66028823 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
932416911 2:71579092-71579114 CTGTGGCCACAGGGGGTGTGGGG - Intronic
932635494 2:73384838-73384860 TTGGGGGTACAGGTGGTGTCTGG + Intergenic
932925936 2:75974508-75974530 TTGGGGAAACAGGTGGTCTGTGG - Intergenic
933372953 2:81440513-81440535 CTGGGGGCACAGGTGGTGAATGG - Intergenic
933398704 2:81764846-81764868 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
933627163 2:84614053-84614075 TGGGGGAAACAGGTGGTGTATGG + Intronic
934946416 2:98545733-98545755 CTGGGTGCTCAGGTGGTGAATGG - Intronic
935213139 2:100955429-100955451 CCCGGGACACAGCTGGTGGAGGG + Intronic
935622309 2:105140999-105141021 CTGGGGACTGTGGTGGGGTAGGG + Intergenic
935837928 2:107075643-107075665 CTGGTGAGGCAGGTGGTGCAGGG + Intergenic
936007770 2:108905987-108906009 CTGGGGACACGGGAGGTCTGAGG + Intronic
936858330 2:116986870-116986892 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
937199459 2:120189447-120189469 ATGTAGACACAGGTTGTGTAGGG + Intergenic
937250044 2:120517911-120517933 CTGTGCACACAGGTGGTCTAAGG + Intergenic
937483661 2:122291114-122291136 CTTGGGGAACAGGTGGTGTTTGG - Intergenic
937699066 2:124842929-124842951 TTGGGGGAACAGGTGGTGTTTGG + Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938081989 2:128374957-128374979 GTGGAGGCACAGGTGGTGCAGGG + Intergenic
938387337 2:130876207-130876229 CTGGGGGCACAGGCGGCCTAGGG + Intronic
938853502 2:135286096-135286118 TTGGGGGAACAGGTGGTGTTTGG + Intronic
939139069 2:138331716-138331738 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
939304745 2:140396809-140396831 TTGGGGAAACAGGTGGTGTTTGG + Intronic
939329639 2:140740625-140740647 TTGGGGGAACAGGTGGTGTTTGG - Intronic
939919606 2:148092778-148092800 TTGGGGGAACAGGTGGTGTTTGG - Intronic
940056645 2:149520218-149520240 TTGGGGGCACAGGTGGTATTTGG - Intergenic
940423169 2:153502113-153502135 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
940812989 2:158266495-158266517 TTGGGGAAACAGGTGGTATCTGG + Intronic
941565538 2:167101344-167101366 TTGGGGCAACAGGTGGTGTTTGG + Intronic
941907571 2:170731633-170731655 TGGGGGAAACAGGTGGTGTTTGG - Intergenic
942275135 2:174315955-174315977 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
942628052 2:177924883-177924905 CTGGGGACTGTGGTGGGGTAGGG - Intronic
943276267 2:185870451-185870473 CTGGGGACAGTGGTGGGGTGGGG + Intergenic
944017963 2:195067676-195067698 CTGGGGACAGTGGTGGGGTGGGG - Intergenic
944102577 2:196044559-196044581 TTGGGGAAACAGGTGGTGTTTGG - Intronic
944340114 2:198586087-198586109 CTGGGGACTGTGGTGGTGTGGGG + Intergenic
945337554 2:208610719-208610741 TTGGGGGAACAGGTGGTGTTTGG + Intronic
945377091 2:209091620-209091642 CTGGGAGAACAGGTGGTGTTTGG + Intergenic
946025310 2:216668475-216668497 TTGGGGATACATGTGGTGAAGGG + Intergenic
946150040 2:217758472-217758494 CTGGGGACTCTTGTGGGGTAGGG - Intergenic
947105377 2:226663064-226663086 CAGGGAACCCAGGTGGTGCAGGG + Intergenic
947132952 2:226948404-226948426 CTGGGGACTGTGGTGGGGTAGGG + Intronic
947624468 2:231611180-231611202 CTGGGGAGTTAGGTGGTGTGAGG + Intergenic
948137572 2:235648218-235648240 CTGAGGGCACAGGAGGTGGAGGG - Intronic
1168884018 20:1232256-1232278 CAGGAGACACAGATGATGTAGGG + Intronic
1168989270 20:2080301-2080323 CTGGGAACACAGGTGCTGCTGGG + Intergenic
1169067155 20:2700562-2700584 GTGGGGACACAGGTGGGATGTGG - Intronic
1169188004 20:3635327-3635349 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1169451361 20:5714626-5714648 GTGGGGGCAGGGGTGGTGTAAGG - Intergenic
1169528738 20:6460312-6460334 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1169860912 20:10151286-10151308 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1170107909 20:12771923-12771945 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1170280917 20:14647920-14647942 CTGGGGAAAGAGGTGGTGTTGGG - Intronic
1170457749 20:16549194-16549216 CTGGGGACTGTGGTGGGGTAGGG - Intronic
1170995685 20:21355219-21355241 CTGGGGAGAAAGGAGGAGTAGGG - Intronic
1171188376 20:23139972-23139994 CTGGGGACTGTGGTGGTGTGGGG + Intergenic
1171198087 20:23217080-23217102 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1171222365 20:23410528-23410550 CTGGGGACACTAGCGGGGTATGG + Intronic
1171721511 20:28568400-28568422 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1171736162 20:28788468-28788490 CTGGGGACAGATGTGGGGTGGGG - Intergenic
1172658009 20:36548779-36548801 CTGTGCACACAGATGGTGTTGGG - Intronic
1173705954 20:45110473-45110495 CTTGTGACACAGGTGGTTCATGG + Exonic
1174403278 20:50287771-50287793 CTGAGGCCACAGGTGGTGGTGGG - Intergenic
1174452907 20:50630797-50630819 CTGGGGACACAGGGGCCGTGGGG - Exonic
1174680209 20:52399341-52399363 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1174769835 20:53288841-53288863 TTGGGGAAACAGGTGGTTTTTGG + Intronic
1174782340 20:53401418-53401440 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1174832447 20:53825285-53825307 TTGGGGGCACAGGTGGTATTTGG - Intergenic
1174893760 20:54426771-54426793 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1174894445 20:54434145-54434167 CAGGGGACCCTGGTGGGGTAAGG - Intergenic
1174991539 20:55515907-55515929 CTGGGGACATAGGCTGTGAAAGG + Intergenic
1175241167 20:57550446-57550468 CTGGGGAATGAGGTGGGGTACGG + Intergenic
1175589551 20:60177718-60177740 CTGGGGTGACAGGTGGTAGAGGG + Intergenic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1175913917 20:62416881-62416903 ATGGGGACGCAGGGGGTGTGAGG + Intronic
1176203751 20:63876979-63877001 CTGGGGACCCGGGTGGTTCATGG + Intronic
1176588730 21:8618794-8618816 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1177908869 21:27005842-27005864 TTGGGGGTACAGGTGGTGTTTGG + Intergenic
1177935295 21:27337809-27337831 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1178367937 21:32003012-32003034 CTAGGGACCCAGATGGTTTAAGG + Exonic
1179108975 21:38428911-38428933 TTGGGGGAACAGGTGGTGTCTGG + Intronic
1180000737 21:44994198-44994220 CTGGGGACACCGGTGCCGAAGGG - Intergenic
1180035318 21:45245404-45245426 CTGGGGATGGAGATGGTGTACGG - Intergenic
1180083446 21:45497114-45497136 CTGGGGACACAGGCTCTGAAGGG + Intronic
1180251576 21:46593674-46593696 ATTGGGAAACAGGTGGTGTTTGG - Intergenic
1180271556 22:10595790-10595812 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1180295050 22:10927021-10927043 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1180398172 22:12377994-12378016 CTGGGGACTCTGGTGGGGTGGGG + Intergenic
1180413620 22:12639016-12639038 TTGGGGAAACAGGTGGTTTTTGG + Intergenic
1181025758 22:20126513-20126535 CTGGGGACACAGGTGCTTCCTGG + Intronic
1181724231 22:24800367-24800389 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1182204706 22:28611662-28611684 CTGGGGACTGTGGTGGGGTAGGG - Intronic
1182265926 22:29115400-29115422 CTTGGGGAACAGGTGGTGTTTGG - Intronic
1183411985 22:37660264-37660286 GTGGGGACACAGGAGGTGGAGGG - Intronic
1183643946 22:39111499-39111521 CTGGGGACGCGCGTGGTGGATGG + Intergenic
1184237861 22:43194662-43194684 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
949138592 3:602975-602997 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
949190757 3:1245651-1245673 TTTGGGAAACAGGTGGTGTTTGG - Intronic
950610941 3:14126087-14126109 TTGGGGACAGAGGCGGTGTCTGG - Intronic
951302217 3:21011883-21011905 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
951761547 3:26152913-26152935 ATTGGGATACAGGTGGTGTTTGG - Intergenic
952101486 3:30018040-30018062 CTTGGAACACAGGTGGTCCAAGG - Intergenic
952984355 3:38764242-38764264 TTTGGGAAACAGGTGGTGTTGGG + Intronic
953206776 3:40838257-40838279 CTGGACACACAGGTGGGGTTTGG + Intergenic
953336608 3:42099152-42099174 CTGGGGAGTCAGGTGGTGTCAGG + Intronic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953413004 3:42700840-42700862 CTGGGGAGACAGGTTGGGTGAGG + Intronic
954105464 3:48407467-48407489 CTGGGGAGAGAGGTGGTCTGTGG - Intronic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955450286 3:59058859-59058881 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
955877521 3:63508436-63508458 CAGGTGACTCAGGTGATGTAAGG + Intronic
956205485 3:66750559-66750581 TTGGGGAAACAGGTGGTTTTTGG - Intergenic
956376863 3:68622675-68622697 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
957188423 3:76973900-76973922 ATGGGGACACAGGTGGGGATGGG + Intronic
957471409 3:80662136-80662158 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
957845942 3:85735450-85735472 ATGGAGACACAGGTCATGTAAGG + Intronic
958014313 3:87920367-87920389 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
958837475 3:99162724-99162746 ATGGGGAAACAAGTGGTGTAGGG - Intergenic
958912130 3:100005911-100005933 ATGGGGACACAGCTGGTCTGTGG - Intronic
958969398 3:100594760-100594782 TTGGGGATACAGGTGGTATTTGG + Intergenic
959347615 3:105219035-105219057 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
959463781 3:106659566-106659588 TTGGGGACGCAGGTGGTTTTTGG - Intergenic
959867523 3:111288214-111288236 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
960717372 3:120590060-120590082 ATGGGGGCACAGGTGGTATATGG + Intergenic
961146603 3:124599029-124599051 CTGGGGACAGGGGTGGGGTGGGG + Intronic
961534292 3:127560197-127560219 CTGGGGACACAGGAAGTGCAGGG - Intergenic
962342737 3:134598757-134598779 CTGGGGACCCAGGAGGAGTTGGG + Intronic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
963864341 3:150344228-150344250 TTGGGAACACAGGGGGTGAAGGG - Intergenic
964050143 3:152381972-152381994 CTGGGGACATAGTAGGTGTTTGG + Intronic
964115089 3:153128169-153128191 TTGGGGAAACAGGTGGTATTTGG + Intergenic
965345639 3:167545829-167545851 TTGGGGGTACAGGTGGTGTTTGG - Intronic
966491907 3:180537240-180537262 TTGGGGTAACAGGTGGTGTTTGG + Intergenic
966546136 3:181151177-181151199 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
967246843 3:187495991-187496013 TTGGGGAAACAGGTGGTTTTTGG - Intergenic
967374374 3:188783949-188783971 TTGGGGGCACAGGTGGTGTTTGG + Intronic
967976946 3:195040829-195040851 CGGGTGACACAGGTGTTGGAGGG - Intergenic
968599584 4:1502669-1502691 CTCGGGGCACAGGCGGTGCATGG - Intergenic
968877929 4:3283955-3283977 TTGGGGACACAGGTGGAATGGGG + Intergenic
969217596 4:5734799-5734821 CTGGGGATAGAGGGGGTGAAGGG - Intronic
969454452 4:7293339-7293361 CAGGGGACAAAGGTGGTGGCTGG - Intronic
969498883 4:7541213-7541235 CTGTGGCCTCCGGTGGTGTAGGG + Intronic
969642586 4:8407879-8407901 CAGGGGACACGGGTGGTGTCTGG + Intronic
969696326 4:8737193-8737215 CTGGGGACGCAGAGGCTGTAAGG + Intergenic
970016546 4:11518502-11518524 CTGGGGTTACAGGTGGTTTTTGG - Intergenic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
971014700 4:22475894-22475916 TTGGGGGAACAGGTGGTGTTTGG - Intronic
971577025 4:28287428-28287450 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
972952648 4:44347307-44347329 TTTGGGCCACAGGTGGTGCAGGG + Intronic
974081770 4:57221349-57221371 CTGGGGACTGAGGTGGGGTCGGG - Intergenic
974874908 4:67692040-67692062 TGGGGTACACAGGTGGTGTTTGG + Intronic
974944427 4:68509959-68509981 CTGGGGACTGTGGTGGGGTAGGG - Intergenic
975068166 4:70096405-70096427 TTGGGGAAACAGATGGTGTTTGG + Intergenic
975301365 4:72795221-72795243 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
975397010 4:73887171-73887193 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
976352715 4:84078344-84078366 CTGGGGACTGTGGTGGGGTAGGG + Intergenic
976664064 4:87571481-87571503 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
976791834 4:88887252-88887274 TTGGGGGAACAGGTGGTGTTTGG - Intronic
976879526 4:89902163-89902185 CTGGGGACTGTGGTGGGGTAGGG + Intronic
977000895 4:91500788-91500810 TTTGGGAAACAGGTGGTGTTTGG + Intronic
977263251 4:94823427-94823449 CTGGGGGCAAAGCTGGTGTTCGG + Intronic
977636003 4:99299359-99299381 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
977655417 4:99515733-99515755 TTGGGGACACAGGTGATTTTTGG - Intronic
977904798 4:102464624-102464646 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
978004210 4:103596757-103596779 CTGGGGACTCTTGTGGGGTAGGG - Intronic
978019869 4:103794201-103794223 TTGGGGATACAGGTGGTTTTTGG - Intergenic
978456244 4:108895746-108895768 TTGGGGGAACAGGTGGTGTTTGG + Intronic
978598251 4:110401789-110401811 GTGGGAACAGAGGTGGGGTAGGG + Intronic
979143807 4:117214771-117214793 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
980431419 4:132703277-132703299 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
980580695 4:134746389-134746411 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
980644631 4:135627315-135627337 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
980846907 4:138334710-138334732 CTGATGGAACAGGTGGTGTAAGG - Intergenic
981651777 4:147068463-147068485 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
981968807 4:150639190-150639212 CTGGGGACTGTGGTGGGGTAGGG + Intronic
982065238 4:151649398-151649420 GTGGGGACAAAGGTAGTGGATGG - Intronic
982593690 4:157350425-157350447 TTGGGGGAACAGGTGGTGTTTGG + Intronic
982632343 4:157846567-157846589 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
982885763 4:160780753-160780775 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
983350562 4:166582481-166582503 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
985235768 4:187872320-187872342 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
986064365 5:4221260-4221282 GTGGGGCCACAGCTGGTGCACGG - Intergenic
986355366 5:6918939-6918961 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
986439169 5:7763537-7763559 ATGGAGACACAGTTGCTGTAGGG - Intronic
987167200 5:15212947-15212969 TTGGGGGTACAGGTGGTGTTTGG - Intergenic
987788539 5:22534225-22534247 ATTGGGAAACAGGTGGTGTTTGG + Intronic
987888381 5:23842073-23842095 TTGGGGACACAGGTGGTGCTTGG + Intergenic
988724611 5:33913859-33913881 TTGGGGAAACAGGTGGTATTTGG + Intergenic
988876392 5:35451594-35451616 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
989338148 5:40342970-40342992 CTTGGGGAACAGGTGGTGTTTGG - Intergenic
989665385 5:43847800-43847822 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990573475 5:57102565-57102587 CTGGGGGAATAGGTGGTGTTCGG - Intergenic
990799121 5:59579706-59579728 CTGGGTACACACTTGGTGTGTGG - Intronic
991370186 5:65910493-65910515 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
991418769 5:66418960-66418982 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
991574027 5:68084059-68084081 ATTGGGGAACAGGTGGTGTATGG - Intergenic
992339561 5:75808650-75808672 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
992535817 5:77702155-77702177 TTGGGGGCACAGGTGGTATTTGG - Intronic
992899167 5:81276170-81276192 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
992931936 5:81656492-81656514 CTGGGGGAACAGGTGGTATTTGG + Intronic
993383503 5:87235100-87235122 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
996210217 5:120798999-120799021 CTGGGGCCAGAGGTGCTGTCTGG - Intergenic
996671865 5:126127380-126127402 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
996930620 5:128882287-128882309 TTGGGGGAACAGGTGGTGTTTGG + Intronic
997140942 5:131380134-131380156 TTGGGGCTACAGGTGGTGTTTGG + Intronic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
998217520 5:140248490-140248512 CAGGGTGCCCAGGTGGTGTATGG - Intronic
999912982 5:156226091-156226113 CTGGGGGGACAGGTGGTGTTTGG + Intronic
1000067342 5:157706063-157706085 CTAGGGACGCAGGTGGGGTGAGG - Intergenic
1000104382 5:158044914-158044936 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1000158571 5:158576957-158576979 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1000265061 5:159628206-159628228 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1000629081 5:163571682-163571704 CAGGCAACACAGGTGGTGTCAGG - Intergenic
1001190947 5:169630640-169630662 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
1001788319 5:174432901-174432923 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1002001315 5:176197784-176197806 CAGAGGACAGAGGTGGTGCAGGG - Intergenic
1002132862 5:177092100-177092122 ATGGGGAGCCAGGTGGTGGAGGG + Intronic
1002214513 5:177620481-177620503 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1002253024 5:177941185-177941207 CAGAGGACAGAGGTGGTGCAGGG + Intergenic
1003712481 6:8608162-8608184 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1004128842 6:12899951-12899973 CAGGGGCCACTGGTGGTGTAAGG - Intronic
1004227114 6:13795852-13795874 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1004520956 6:16360034-16360056 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1004592613 6:17068454-17068476 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1004858652 6:19778049-19778071 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1005715894 6:28548033-28548055 TTGGGGACTCAGGAGGTGTGGGG + Intergenic
1006191802 6:32213975-32213997 CAGGGGACACGGGTGATGTGTGG - Intronic
1006279764 6:33041421-33041443 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
1006311829 6:33266513-33266535 CTGGGGACAAAGGTGTTGAATGG + Intronic
1007105189 6:39279015-39279037 CTGGGGAAATAGGTGGTGCCAGG - Intergenic
1007891455 6:45296850-45296872 CACGGGGCACAGGTGGTGTTTGG - Intronic
1008171734 6:48216103-48216125 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1008446752 6:51600556-51600578 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1008479885 6:51974822-51974844 TTTGGGAAACAGGTGGTGTTTGG - Intronic
1008793038 6:55262227-55262249 TTGGGGAAACAGTTGGTGTTTGG - Intronic
1008800542 6:55363591-55363613 CTGGGGACTGAGGTGGGGTGGGG - Intronic
1009845857 6:69133711-69133733 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1010028173 6:71243987-71244009 TTGGGGGGACAGGTGGTGTTTGG - Intergenic
1010596923 6:77775212-77775234 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1011320667 6:86088993-86089015 TTGGGGGAACAGGTTGTGTATGG + Intergenic
1011965353 6:93150604-93150626 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1012183214 6:96181464-96181486 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1012281728 6:97335818-97335840 CCAGGGACACAGGTGGGGTGGGG + Intergenic
1012302515 6:97606787-97606809 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1012703898 6:102496940-102496962 TTGGGGGTACAGGTGGTTTATGG + Intergenic
1012717086 6:102688902-102688924 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1012819834 6:104072363-104072385 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1014276493 6:119395530-119395552 ATGGGGAGACAGGTAGTCTAGGG + Intergenic
1014660530 6:124165670-124165692 CTGGGGACTGTGGTGGGGTAGGG - Intronic
1014859073 6:126441484-126441506 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1015567931 6:134593120-134593142 TTGGGGACACAGGAAGGGTAGGG - Intergenic
1015601294 6:134913597-134913619 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1015636973 6:135286595-135286617 CTGGGGGCACAGGAGGTGTAGGG + Intronic
1015802943 6:137078803-137078825 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1016409339 6:143765571-143765593 CTGGAGCCACAGGGGGTGGAGGG - Exonic
1016571248 6:145515582-145515604 CTGGGGACTCAGGTTTTATAAGG + Intronic
1018778240 6:167038825-167038847 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1019102186 6:169640601-169640623 CTGCGGACACCGCTGGTGTTCGG - Intronic
1019372846 7:672059-672081 CTGGGAACACAGTGGGGGTAGGG - Intronic
1019442790 7:1055888-1055910 CTGGGGACTCAAGTGGAGTCTGG + Intronic
1020152597 7:5695046-5695068 ATGGGGACACAGATGGGTTAGGG + Intronic
1020281150 7:6650695-6650717 CAGGGGACCCAGGTGGGGTGAGG + Intronic
1020558833 7:9703130-9703152 TTGGGGTAACAGGTGGTGTTTGG - Intergenic
1020703566 7:11513275-11513297 ATTGGGATACAGGTGGTGTTTGG - Intronic
1021620239 7:22544007-22544029 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1022335217 7:29415572-29415594 CTCGGGACACAGTTGGTGGAGGG + Intronic
1022351777 7:29572872-29572894 CTGGGGAAACAGGTTATGTCTGG + Intergenic
1022487901 7:30794495-30794517 CTAGGGGCACAGGTGGGGTTAGG + Intronic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1023022143 7:36019831-36019853 CTGGGGACCCAGGAGAAGTAAGG - Intergenic
1024096676 7:45987728-45987750 CTGGGGTCACAGGACTTGTAGGG + Intergenic
1024481453 7:49867575-49867597 CAGAGGACACAGGTGCTGTGTGG + Intronic
1024588492 7:50860912-50860934 CTGGAGACAGAAGCGGTGTAAGG + Intergenic
1024827758 7:53412415-53412437 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1024949062 7:54839622-54839644 CTGGGGACACAGGGCGTGGGTGG - Intergenic
1025097558 7:56108172-56108194 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1025801491 7:64790720-64790742 TTGGGGGTACAGGTGGTGTTTGG - Intergenic
1028819036 7:95184491-95184513 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1028968908 7:96834737-96834759 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1029124765 7:98288260-98288282 GTGGGGACACAGCTGGTGCTTGG + Intronic
1029128642 7:98313098-98313120 TTGGGGACAGGGGTGGTGTGAGG - Intronic
1029154762 7:98508247-98508269 CTGGGGGTAGAGGTGGTGGAGGG + Intergenic
1029469533 7:100745479-100745501 CTGGGGGCCGAGGTGGTGTTGGG + Intronic
1030013251 7:105192081-105192103 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1030621291 7:111794074-111794096 GTGGGGACACAGATGCTGGAGGG + Intronic
1030625346 7:111839852-111839874 TTGGGGAAACAGGTGGTATTTGG + Intronic
1032754479 7:134875641-134875663 CTGGGCTCACAGATGGTTTAAGG - Intronic
1033588171 7:142789585-142789607 TTGGGGAGACAGGTGGTTTCAGG + Intergenic
1035995337 8:4540336-4540358 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1036076958 8:5512796-5512818 CTGGGGTGACAGGAGGTGGAAGG + Intergenic
1037211508 8:16393835-16393857 TTGGGGGAACAGGTGGTGTCTGG - Intronic
1037341754 8:17853131-17853153 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1037366898 8:18132293-18132315 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1037450312 8:19010233-19010255 TTGGTGACACCGGTGGTGTGAGG - Intronic
1037549746 8:19958598-19958620 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1038397705 8:27259145-27259167 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1038517196 8:28197222-28197244 CTGGGGACAGAGGTGAAATAAGG - Intergenic
1038721738 8:30042756-30042778 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1038973092 8:32659710-32659732 CTGGGGAGACAGCTGGAGTTAGG - Intronic
1039615954 8:38955083-38955105 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1039967476 8:42293645-42293667 CGGGGGACCCTGGTGGAGTAGGG + Intronic
1040352964 8:46587029-46587051 CTGGTGAGACAGAAGGTGTAAGG - Intergenic
1040533301 8:48283342-48283364 CTGGTGACTGGGGTGGTGTAGGG + Intergenic
1040670623 8:49685736-49685758 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1040765284 8:50902398-50902420 CTGGGGATACAGGTGCAGTATGG - Intergenic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041761347 8:61370236-61370258 TTGGGGGAACAGGTGGTGTTCGG + Intronic
1042099756 8:65262309-65262331 TTGGGGTAACAGGTGGTGTTTGG + Intergenic
1042578226 8:70246353-70246375 GTGGGGAAAAAGATGGTGTAAGG + Intronic
1042900900 8:73726396-73726418 TTTGGGAAACAGGTGGTGTTTGG - Intronic
1043278803 8:78436944-78436966 TTGGGGAAACAGGTGGTATTTGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043376972 8:79660675-79660697 TTGGGGATACAGGTGGTGTTTGG + Intronic
1043448661 8:80344157-80344179 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1043638614 8:82419291-82419313 TTGGGGATACAGGTGGTGTTTGG - Intergenic
1044080541 8:87876967-87876989 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1044510720 8:93075420-93075442 CTGTGGAAACATGTGGTCTAAGG + Intergenic
1044637568 8:94341806-94341828 ATAGGTACACAGGTAGTGTAGGG + Intergenic
1045746100 8:105424115-105424137 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1047220831 8:122917008-122917030 CTGGGGACAGAGGTGCTGGAGGG - Intronic
1047487503 8:125345091-125345113 CTGGGGACATAGATGGTTTCTGG + Intronic
1047611380 8:126524058-126524080 ATTGGGAAACAGGTGGTGTTTGG - Intergenic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1048846285 8:138606288-138606310 CTGAGGACACAGGAGGTGGCAGG + Intronic
1050050847 9:1599911-1599933 CTGGGGAGGCAAGTGGTGTATGG + Intergenic
1051567537 9:18517572-18517594 CTGGGGACTGTGGTGGTGTGGGG - Intronic
1051663523 9:19446763-19446785 CTGGGGAAAGAGGTGATGTGAGG + Intronic
1051675165 9:19551679-19551701 GTAGGGACACAGGTGCTGGAGGG - Intronic
1052343820 9:27388487-27388509 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1052624486 9:30957446-30957468 CTGGGGACAGTTGTGGTGTGGGG + Intergenic
1052847321 9:33348461-33348483 CTTGGGGAACAGGTGGTGTTTGG - Intronic
1053103703 9:35392629-35392651 CTGGGGACTGTGGTGGGGTAGGG + Intronic
1053471477 9:38348644-38348666 ATTGGGAAACAGGTGGTGTTCGG + Intergenic
1054702053 9:68422748-68422770 ATTGGGAAACAGGTGGTGTTTGG + Intronic
1054943248 9:70767160-70767182 CTGGTGAGTCCGGTGGTGTAAGG + Intronic
1055186663 9:73464713-73464735 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1055245078 9:74230080-74230102 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1056299665 9:85227930-85227952 GTGGGTACCCAGGTGATGTACGG + Intergenic
1056658931 9:88530843-88530865 CTGGGGGCCCAGGTGGTGGGGGG - Intergenic
1056897023 9:90560443-90560465 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1056898359 9:90573357-90573379 CTGGAGACAGAGGTTGTGAATGG - Intergenic
1056999301 9:91492854-91492876 CTGGAGCCACAGGTGCTGGAGGG + Intergenic
1058277635 9:103065218-103065240 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1058921400 9:109618764-109618786 CTGGGGACCCAGGTGCTATCAGG + Intergenic
1059408741 9:114118722-114118744 CTGGGGACACTGGAGGTGCTGGG + Intergenic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060371047 9:123071857-123071879 CTGGGGAAACACTTGGTGTATGG + Intronic
1060387215 9:123242001-123242023 CTAGGGACACAGTGGGTGTGTGG - Intronic
1060477331 9:123996605-123996627 CTGGGGACGGAGGGGGGGTAGGG + Intergenic
1060918191 9:127403518-127403540 CTGAGGACACAGGGGGTGCTGGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061510322 9:131057087-131057109 CAGGGGACACAGCTGGCATAGGG - Exonic
1062068766 9:134543915-134543937 CAGGGGACACAGATGTCGTAGGG + Intergenic
1062143455 9:134973266-134973288 CAGGGGACTGTGGTGGTGTAAGG + Intergenic
1062192158 9:135253573-135253595 CTGGGGGCACGGGTGGGGTGGGG + Intergenic
1062528603 9:136989410-136989432 CTGGGGACACGCGTGGTGGATGG + Intergenic
1202801932 9_KI270720v1_random:8177-8199 TTGGGGAAACAGGTGGTTTTTGG - Intergenic
1203446487 Un_GL000219v1:61929-61951 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1203379385 Un_KI270435v1:16685-16707 CTGGGGACTCTGGTGGGGTGGGG + Intergenic
1203618737 Un_KI270749v1:97373-97395 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1185823746 X:3229022-3229044 ATGGGGAAACAGGGGGAGTAAGG + Intergenic
1185978255 X:4745993-4746015 TTAGGGAAACAGGTGGTGTTTGG - Intergenic
1186207350 X:7214569-7214591 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1186363809 X:8871068-8871090 TTTGGGACACAGGTGCTGCATGG - Intergenic
1186528946 X:10276149-10276171 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1186587335 X:10889301-10889323 TTGGGGAAACAGGTGGTGTTAGG + Intergenic
1186997175 X:15136048-15136070 ATGGGGGAACAGGTGGTGTCTGG - Intergenic
1187396009 X:18920221-18920243 TTAGGGACACAGGTAGTGTGTGG + Intronic
1187509819 X:19907697-19907719 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1187697686 X:21938035-21938057 CTGGGGGGAGAGGTGGTGTTTGG + Intergenic
1187716016 X:22103330-22103352 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1188393883 X:29656292-29656314 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1188530912 X:31139822-31139844 CAGGGAACCCAGGTGGTGTTTGG - Intronic
1188890050 X:35599133-35599155 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1189133540 X:38525595-38525617 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1189729894 X:44008788-44008810 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1189836014 X:45023667-45023689 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1189905553 X:45755326-45755348 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1190037238 X:47036946-47036968 CTGGGGACTGTGGTGGGGTAGGG + Intronic
1190048531 X:47131972-47131994 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1190589779 X:51988083-51988105 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1191203007 X:57804806-57804828 CTGGGGCCTCTCGTGGTGTAGGG - Intergenic
1191609108 X:63092407-63092429 CTGGGGACAGATGTGGTGTGGGG - Intergenic
1191629171 X:63302603-63302625 TTGGGGAAACAGGTGGTGTTTGG + Intergenic
1191783704 X:64895018-64895040 CTGGGCACACAGGTGCAGTAAGG + Intergenic
1191819274 X:65285143-65285165 TTTGGGAGACAGGTGGTGTTTGG + Intergenic
1191820585 X:65301820-65301842 TTGGGAAAACAGGTGGTGTTTGG - Intergenic
1191821730 X:65317403-65317425 TTGGGGAAACAGGTGGTCTTTGG + Intergenic
1193076475 X:77361249-77361271 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1193208199 X:78773817-78773839 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
1193313827 X:80041255-80041277 TTGGGGAAACAGGTGGTGTTTGG + Intergenic
1193636854 X:83961571-83961593 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1193695109 X:84699098-84699120 TTGGGGAAACAGGTGGTGTTTGG + Intergenic
1194028236 X:88780942-88780964 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1194032572 X:88834721-88834743 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1194138215 X:90174548-90174570 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1196530093 X:116776233-116776255 ATGGGGAAACAAGTGGTGTTTGG - Intergenic
1197376196 X:125684607-125684629 TTAGGGAAACAGGTGGTGTTTGG - Intergenic
1197664107 X:129204727-129204749 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1197889549 X:131255590-131255612 CAGGAGAAACAGGTGGTATATGG - Intergenic
1198530548 X:137547018-137547040 CTGGGGACAGAGGAGGTGGTAGG + Intergenic
1198685601 X:139225232-139225254 CTGGGGTCACAGGTGCTGTCAGG + Intergenic
1198987306 X:142469991-142470013 TTGGGGACACAGGTGATGTCTGG - Intergenic
1199001445 X:142642517-142642539 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1199090983 X:143692114-143692136 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
1199120606 X:144048663-144048685 TTGGGGAAACAGGTGGTGCTTGG - Intergenic
1200110316 X:153737598-153737620 CTGGGGACACAGGTGATCTGTGG - Intronic
1200447454 Y:3282509-3282531 TTGGGGTAACAGGTGGTGTTTGG + Intergenic
1200484012 Y:3744788-3744810 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1200738058 Y:6821743-6821765 TTGGGGAAACAGATGGTGTTTGG + Intergenic
1200784675 Y:7249710-7249732 CTGGGGACTGTGGTGGTGTTGGG - Intergenic
1201269565 Y:12241798-12241820 TTGGGGGAACAGGTGGTGTTGGG + Intergenic
1201579213 Y:15493466-15493488 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1201670026 Y:16509522-16509544 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1201935275 Y:19405250-19405272 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1202348143 Y:23957026-23957048 CTGGGGACTGTGGTGGTGTCGGG - Intergenic
1202522631 Y:25713078-25713100 CTGGGGACTGTGGTGGTGTCGGG + Intergenic