ID: 1091079294

View in Genome Browser
Species Human (GRCh38)
Location 11:132651550-132651572
Sequence CCTAGTCATGTTTACAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091079294_1091079300 14 Left 1091079294 11:132651550-132651572 CCTTATTTGTAAACATGACTAGG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 1091079300 11:132651587-132651609 GAGTGGATAGATGTAAGGAACGG 0: 1
1: 0
2: 6
3: 26
4: 494
1091079294_1091079299 9 Left 1091079294 11:132651550-132651572 CCTTATTTGTAAACATGACTAGG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 1091079299 11:132651582-132651604 CTGTAGAGTGGATAGATGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 145
1091079294_1091079298 -3 Left 1091079294 11:132651550-132651572 CCTTATTTGTAAACATGACTAGG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 1091079298 11:132651570-132651592 AGGGTGGATATTCTGTAGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091079294 Original CRISPR CCTAGTCATGTTTACAAATA AGG (reversed) Intronic
904154045 1:28467264-28467286 CTTAGTGATGTTTACATTTATGG - Intronic
904798711 1:33077415-33077437 CAAAGTCCTGTTTCCAAATAAGG - Intronic
905696365 1:39976985-39977007 GCTAGTCTTCTTTCCAAATAAGG + Intergenic
907389266 1:54146585-54146607 CCTAGTTCTGTTTACCAAGAAGG + Intronic
912642984 1:111364884-111364906 GCTAGTCTTCTTTCCAAATAAGG + Intergenic
912685401 1:111758231-111758253 CATATTCATTTTTAGAAATAGGG + Intronic
915086694 1:153394136-153394158 CCTGGTCATGTTTACAGGAAAGG + Intergenic
917590979 1:176476693-176476715 CCTAGTCATGGTTCCAAAACTGG - Intronic
918445762 1:184615355-184615377 CCTAGTGATGGTGACAAAGAAGG - Intronic
918999214 1:191807198-191807220 CCTCATTATGTTTACTAATATGG - Intergenic
919056288 1:192573520-192573542 CTTAGTGAAGTTTACAAAGAGGG + Intergenic
920979473 1:210819836-210819858 CCTAGTCTAGTTCACAAAAAGGG + Intronic
921994832 1:221406740-221406762 CATAGTCATGCCTACATATATGG - Intergenic
922135252 1:222818848-222818870 CCTAACCATGTTGACACATAAGG + Intergenic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
923891170 1:238216460-238216482 CCTATTCAAGTTTACAACCATGG + Intergenic
1070992859 10:80747702-80747724 GCTAGTCTTCTTTCCAAATAAGG - Intergenic
1073241881 10:102064720-102064742 CCTAGTCCCTTTTACAGATAAGG - Intergenic
1073737589 10:106367537-106367559 CATAATAATGTTCACAAATATGG + Intergenic
1074714796 10:116208313-116208335 TGTAGTCAAGTTTACAAATAAGG - Intronic
1076551995 10:131286463-131286485 CCAGTTAATGTTTACAAATAAGG - Intronic
1079549501 11:21676434-21676456 ACTAGTGATGTTTATAAATTTGG - Intergenic
1079744548 11:24107893-24107915 CCTAGCCATGTTTCCTATTAAGG + Intergenic
1080480770 11:32647524-32647546 CCTATTCATATTTAAAAATGAGG + Intronic
1085703329 11:78764225-78764247 CCTTCTCACCTTTACAAATAAGG + Intronic
1086842223 11:91700569-91700591 CCTAGGCATCTTTATAAAAAAGG - Intergenic
1087394513 11:97580438-97580460 CCTAGTCATGCTATCAGATATGG - Intergenic
1090484755 11:127102983-127103005 CCTAGTCAAGTTAATACATAAGG + Intergenic
1091079294 11:132651550-132651572 CCTAGTCATGTTTACAAATAAGG - Intronic
1091870000 12:3881548-3881570 CCTTGTCATGTTTCCTAATTAGG - Intergenic
1092189437 12:6507664-6507686 GCTAGTCTTCTTTCCAAATAAGG + Intronic
1092189442 12:6507748-6507770 GCTAGTCTTCTTTCCAAATAAGG + Intronic
1094150647 12:27279196-27279218 CTTAGTGATGTTTTCAAATTAGG + Intronic
1094195702 12:27747620-27747642 ACTACTCATGATTACAAGTAAGG - Intronic
1096903698 12:54913006-54913028 TCTAGCCTTGTTTAAAAATAAGG - Intergenic
1097245099 12:57603718-57603740 CCTACTCACCTTTACAAAGATGG - Intergenic
1099189566 12:79548505-79548527 ATTAGTCATGTATGCAAATATGG + Intergenic
1106630824 13:31470861-31470883 CCTTGTTTTGTTAACAAATAAGG - Intergenic
1108419299 13:50232713-50232735 CTTTGTCATGTTTACTGATATGG + Intronic
1108966902 13:56319014-56319036 CTAAGTCATGTTTCAAAATAGGG + Intergenic
1109779283 13:67086006-67086028 CCTAATCATGTTTATAACTAAGG + Intronic
1109884111 13:68520451-68520473 CCTATTACTATTTACAAATAAGG + Intergenic
1110326428 13:74221310-74221332 CTTAGTCTTTTTTAAAAATAAGG + Intergenic
1111356200 13:87106494-87106516 ATTAGTGATGTTTACAAATAGGG + Intergenic
1112066108 13:95794905-95794927 CTCAGACATGTCTACAAATATGG + Exonic
1112775470 13:102839169-102839191 CAGAGTCATGTGTACAAACAAGG + Intronic
1113692637 13:112322516-112322538 CCCAGTCAAGATTGCAAATATGG - Intergenic
1116389144 14:44371564-44371586 CCAAGTCATGTTTGCATATAAGG + Intergenic
1116399323 14:44486093-44486115 CCTAGCCAAGTTGACACATAAGG - Intergenic
1118917667 14:70121588-70121610 ACTAGTCATGTAGTCAAATAAGG + Intronic
1121138916 14:91523763-91523785 CCTACTCATGTTTAAGAACAGGG + Intergenic
1123901860 15:24885240-24885262 CATAGTCATGTTTATAATTGAGG - Intronic
1124203059 15:27694856-27694878 GCTAGTCTTCTTTCCAAATAAGG - Intergenic
1131456906 15:92588682-92588704 CCCAGTCATCTTGACAAAGAAGG + Intergenic
1133362969 16:5188514-5188536 GCTAGTCTTCTTTCCAAATAAGG + Intergenic
1133819535 16:9224239-9224261 GCTAGTCTTTTTTTCAAATAAGG - Intergenic
1136351310 16:29709989-29710011 GTTAGTCATTTTTCCAAATAAGG + Intergenic
1140425174 16:74855055-74855077 ATTAGTCATGCTTAGAAATAAGG - Intergenic
1140634166 16:76891347-76891369 CCTTGTCATGTTCTCAAATAAGG - Intergenic
1141647998 16:85377753-85377775 CCTGCCCATGTTTACAAATCTGG - Intergenic
1146307033 17:31738267-31738289 CCTCCTGACGTTTACAAATAGGG + Intergenic
1152670653 17:81603245-81603267 CAAAGTCATGTTTACAAACAAGG - Intronic
1155592357 18:27441573-27441595 TCTAGTCATGTTTTTTAATATGG - Intergenic
1155631564 18:27900068-27900090 CCCAGTGATGTTTACAAACACGG + Intergenic
1157714935 18:49877975-49877997 CCTATTCTTGTTGACAAATTAGG - Intronic
1158741479 18:60147107-60147129 CCTAGACATATTTGCAAATATGG + Intergenic
1159295541 18:66482300-66482322 CACAGTCATTTTTAAAAATAAGG - Intergenic
1165378983 19:35464452-35464474 GCTAGTCTTCTTTCCAAATAAGG + Intergenic
1167135440 19:47612801-47612823 CCCAGTTCTGTTGACAAATACGG - Intronic
1168658962 19:58151155-58151177 TCTAGTCATTTTAACAAATTAGG - Intronic
926689941 2:15726143-15726165 CCTATTCCAGTTTCCAAATAAGG + Intronic
927852093 2:26505880-26505902 CATACCCATGTTTACAAAGAAGG + Intronic
928114102 2:28534134-28534156 TCTAGTCATGTTGACATATATGG + Intronic
929480162 2:42298751-42298773 TTTTGTCATGTTTAGAAATACGG + Intronic
933969874 2:87461705-87461727 CCTAGTCTCCTTTACAGATACGG + Intergenic
936323907 2:111488792-111488814 CCTAGTCTCCTTTACAGATACGG - Intergenic
940777560 2:157900693-157900715 CCTCCACATGTTTACAAATATGG - Intronic
941322944 2:164078066-164078088 ACTAATCATGTTGGCAAATATGG + Intergenic
942973602 2:181987451-181987473 CCTTATCCTGTTTAAAAATAAGG + Intronic
943961504 2:194270303-194270325 CATAGTGATGATTACAAATGAGG + Intergenic
944265384 2:197719092-197719114 CATAGTTATGTCTACAAATATGG + Intronic
945332381 2:208554735-208554757 CATAGTCATTTTCAAAAATATGG - Intronic
1173054840 20:39601699-39601721 CATAATTATGTTTTCAAATATGG + Intergenic
1173096800 20:40040669-40040691 CCAAGTGATGTTTAGAGATATGG + Intergenic
1175444554 20:59011038-59011060 CCTATTCATTTCTAAAAATAAGG + Intergenic
1177190801 21:17849001-17849023 TCTTCTCATGTTTTCAAATATGG - Intergenic
1177648651 21:23932921-23932943 CTTAGGCATGTCTACAATTAAGG + Intergenic
955459331 3:59163499-59163521 CATGGTCATTTTTACAATTAAGG - Intergenic
955828609 3:62976697-62976719 CATGGACATGTTTACAATTAGGG + Intergenic
960202300 3:114851786-114851808 AATAGTCATGTTTAAAGATATGG + Intronic
960977440 3:123188851-123188873 CTTGTTCGTGTTTACAAATAAGG - Intronic
961211930 3:125132070-125132092 CCTGGTTCTGTTTACAGATAAGG + Intronic
962973128 3:140423753-140423775 GCTAGTCTTCTTTCCAAATAAGG - Intronic
963697436 3:148578668-148578690 CCTAGTGCTGTTTACATTTATGG - Intergenic
963814849 3:149818121-149818143 CCAAGTAATGTTTCCAAAAATGG - Intronic
964218497 3:154317301-154317323 CCTAGTCATTATTACAAGTCGGG - Intronic
964584870 3:158286169-158286191 CCTAATCATGTTTCCAATTAAGG + Intronic
966413992 3:179670468-179670490 CCCACTCATGTTTACAAAAGGGG - Intronic
966817031 3:183897721-183897743 CCTAGCCATGTGTACCAATAGGG + Intergenic
967428826 3:189358404-189358426 CCTAGTCATTCTTCCAAATGAGG - Intergenic
968691919 4:1994960-1994982 CCCAGTCAAGTTGACACATAAGG - Intronic
969814618 4:9677865-9677887 CCTGGTCATGTTTAGCAAGATGG - Intergenic
970009040 4:11438461-11438483 CCTGGTTATTTCTACAAATAAGG + Intergenic
970955990 4:21811874-21811896 CCTTGTCATGGTTACAAATGAGG + Intronic
972853233 4:43074903-43074925 GCTAGTCCTCTTTCCAAATAAGG - Intergenic
978310281 4:107379699-107379721 GCTAGTCTTCTTTCCAAATAAGG - Intergenic
978704202 4:111685919-111685941 CCTTGCCATGGTTACAAAGAAGG - Intergenic
979897915 4:126183908-126183930 CATAGTCATGTTTGCAATTTAGG + Intergenic
981158333 4:141466951-141466973 CCTAGTTCTGTTCACCAATAAGG + Intergenic
981159082 4:141475569-141475591 TCTAGTCATGTTTAGTATTATGG + Intergenic
981861861 4:149364989-149365011 TATAGATATGTTTACAAATATGG + Intergenic
981932610 4:150207363-150207385 CCCAGACATGTATACAAAGAGGG - Intronic
983801529 4:171935894-171935916 CCTAGTCAGGGTTAAAAATTTGG + Intronic
984611103 4:181838528-181838550 CCTAGTCTTTTTTACAAGTTTGG - Intergenic
986120138 5:4827376-4827398 CATACTCTTGTTTGCAAATAGGG + Intergenic
987435610 5:17890193-17890215 CATAGTCAAGTTGAAAAATATGG - Intergenic
990002532 5:50910945-50910967 CCTATTCATGTTGAGAAATGAGG + Intergenic
991924711 5:71693547-71693569 CCTAATCATGCTTAAAAACAAGG - Intergenic
992836552 5:80647518-80647540 CCTAGTCAAGTTTAACACTATGG - Intronic
994873764 5:105388539-105388561 TATAGTCATGTTTACAAGAAAGG + Intergenic
995035622 5:107530946-107530968 ACTAGTAAAGTATACAAATATGG - Intronic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
996097334 5:119412748-119412770 CCTATTCAAGTTTTCAAAAAAGG - Intergenic
999869764 5:155737110-155737132 CCTAGTAAAGTTTGAAAATAAGG - Intergenic
1001721893 5:173863753-173863775 TTTACTCATTTTTACAAATAAGG - Intergenic
1002015812 5:176321699-176321721 CCTATTAATGTTAACAACTAAGG - Intronic
1003702430 6:8482792-8482814 CTTAATCATGTTTAAAAATATGG + Intergenic
1006006426 6:31005701-31005723 CACTCTCATGTTTACAAATATGG - Intergenic
1008221064 6:48853890-48853912 CCTAAAGATATTTACAAATATGG + Intergenic
1008465551 6:51826305-51826327 CCCATTCATGTCTTCAAATAAGG + Intronic
1008658326 6:53639322-53639344 CATTGTTATGTTTACAAATGTGG + Intergenic
1010844143 6:80684036-80684058 CCTAAACATGTGTAGAAATAAGG - Intergenic
1011349326 6:86405154-86405176 CCAATTCATGGGTACAAATAAGG - Intergenic
1013273795 6:108564511-108564533 CCTAGTCATGTGTGCATAAAGGG + Intronic
1014308709 6:119771801-119771823 GCTAGTCTTCTTTCCAAATAGGG + Intergenic
1017457175 6:154612066-154612088 CCCAGAAATGTCTACAAATAAGG + Intergenic
1020963479 7:14835754-14835776 CTTAGTCATGTTTCCAAAATAGG - Intronic
1022952542 7:35352274-35352296 CCTACTCATGTTTACAGATGAGG + Intergenic
1023345007 7:39262550-39262572 CCTAGTCATTTATAAAAAGAAGG - Intronic
1027825929 7:83116226-83116248 CAGAGTCATGTTCACAAATCTGG + Intronic
1031942126 7:127800092-127800114 CCTGGGCATATTTACAATTAAGG - Intronic
1033718653 7:144032598-144032620 AGTAGGCATATTTACAAATACGG - Intergenic
1035222639 7:157415156-157415178 CCCAGTCATGTTGACAATTGTGG + Intronic
1035754185 8:2018673-2018695 CCAAGTCATGTTTCCACATGCGG + Intergenic
1038048254 8:23785523-23785545 ACTTGTCAGTTTTACAAATAAGG + Intergenic
1038593367 8:28861908-28861930 CCTTCTCATCTATACAAATAAGG - Intronic
1039014377 8:33129612-33129634 GCTAGTCTTCTTTCCAAATAAGG + Intergenic
1042860909 8:73313000-73313022 CCTAGAATTGCTTACAAATATGG + Intronic
1046652004 8:116845725-116845747 CCTAGTTCTGTTAACAAAGAAGG + Intronic
1050479900 9:6078879-6078901 GCTAGTCTTCTTTCCAAATAAGG - Intergenic
1051698932 9:19798494-19798516 CCAAGTCATTTTTACAAAGAGGG + Intergenic
1052027773 9:23593032-23593054 CCTAATCCTGTTTACAAAGGAGG - Intergenic
1055722298 9:79189106-79189128 CCTAGACATATTTACATTTAAGG + Intergenic
1058307427 9:103460873-103460895 GCTAGTCTTCTTTCCAAATAAGG - Intergenic
1058745412 9:107985738-107985760 CCTAATCATGGTGACAAAAATGG + Intergenic
1059283250 9:113152096-113152118 CCAACCCTTGTTTACAAATAAGG + Intronic
1186132463 X:6482710-6482732 CCCAGTCTTCTTCACAAATATGG + Intergenic
1186156260 X:6729767-6729789 GCTAGTCTTGCTTCCAAATAAGG - Intergenic
1188701481 X:33269837-33269859 CTTAGTGATGTTTGCAAATTCGG + Intronic
1190470597 X:50775421-50775443 CCTAGGCATGAATACAAAGAGGG + Intronic
1192081252 X:68049988-68050010 CGTAGTCAGGTATACAAATGGGG + Intronic
1197331956 X:125163644-125163666 AATAGTCATGTTTTCCAATATGG + Intergenic
1201673057 Y:16546865-16546887 CATAGTCATATTAAGAAATAAGG - Intergenic