ID: 1091084688

View in Genome Browser
Species Human (GRCh38)
Location 11:132709873-132709895
Sequence TGACCAATGCTTAAATTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091084688_1091084695 29 Left 1091084688 11:132709873-132709895 CCCCCTAATTTAAGCATTGGTCA 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1091084695 11:132709925-132709947 AAACAAAAGTTGACTTTCATGGG 0: 1
1: 0
2: 0
3: 50
4: 424
1091084688_1091084694 28 Left 1091084688 11:132709873-132709895 CCCCCTAATTTAAGCATTGGTCA 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1091084694 11:132709924-132709946 TAAACAAAAGTTGACTTTCATGG 0: 1
1: 0
2: 5
3: 34
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091084688 Original CRISPR TGACCAATGCTTAAATTAGG GGG (reversed) Intronic
900593341 1:3469353-3469375 TGACCAATGCTTGGAACAGGAGG - Intronic
901735136 1:11307508-11307530 TTACCAATGTTAAAATTAGCAGG - Intergenic
903702135 1:25257228-25257250 TGATAAATGCTAAAAATAGGAGG - Intronic
905949348 1:41934935-41934957 TGAACAATTCTGAAATTAAGTGG - Intronic
907104884 1:51873853-51873875 TGACCAAAATTTAAATTAGAAGG + Intronic
908889577 1:68829174-68829196 TGACAAGTGCTTAGATTATGTGG + Intergenic
908891994 1:68859060-68859082 TGTCCACTGCCTGAATTAGGTGG + Intergenic
913106805 1:115622373-115622395 TGAGCAATGTTTCAACTAGGGGG + Intergenic
915645318 1:157267794-157267816 AGACCAATGAATATATTAGGAGG + Intergenic
916468538 1:165097211-165097233 TGTCCATTGCTGAAAGTAGGGGG - Intergenic
921297098 1:213714664-213714686 TGACCAATGCCAAAACAAGGAGG + Intergenic
921848818 1:219912402-219912424 TGGCCAATGCTAAAATAATGTGG + Intronic
1062830863 10:604756-604778 AGACAAATGTTTAATTTAGGGGG + Intronic
1063085704 10:2815877-2815899 TGACCAGTGATTGAAATAGGGGG - Intergenic
1065991695 10:31016640-31016662 TCACCAATGCTTCATTTACGGGG + Intronic
1069127021 10:64648671-64648693 TGAAAACTGCTTAAATTAGATGG + Intergenic
1069600357 10:69701598-69701620 TGACTAATGCTAAAATTAGTGGG - Intergenic
1080867569 11:36208830-36208852 TGATGAATGCTAAAATTAGTGGG + Intronic
1081043680 11:38244384-38244406 TTACCAATCCTTCAAGTAGGAGG - Intergenic
1081514085 11:43807707-43807729 TGATGAATGTTTACATTAGGAGG + Intronic
1082654881 11:55842061-55842083 AGATCAATGATTAAATTAGTCGG + Intergenic
1085821148 11:79795103-79795125 TGAGCAATGCAAAAATTATGAGG - Intergenic
1086780587 11:90900173-90900195 TAAACAATGCTTAAATTTTGGGG - Intergenic
1086977316 11:93149340-93149362 TGATGAATGCTGAAATTAGTGGG + Intronic
1089851317 11:121499122-121499144 TGACTACTTTTTAAATTAGGTGG - Intronic
1090178263 11:124671331-124671353 TCCCCAATGCTTAAAATAGTAGG - Intronic
1091084688 11:132709873-132709895 TGACCAATGCTTAAATTAGGGGG - Intronic
1095554236 12:43482172-43482194 TGACCACTGCCTGAATTAGCTGG - Intronic
1098477535 12:70922063-70922085 CCACCAGAGCTTAAATTAGGTGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1107343207 13:39431985-39432007 TGAGAAATGATTAAATTAAGGGG + Intronic
1107571552 13:41664740-41664762 TAACAAAAGCTTAAAATAGGAGG + Intronic
1108854033 13:54771537-54771559 TGACCAAGGATTAAATTATGTGG - Intergenic
1110287798 13:73770324-73770346 TGACCAGTGTTTAAATTCAGTGG + Intronic
1110831744 13:80039565-80039587 TGAACAATGCTTGTATTAGAAGG + Intergenic
1120431981 14:84430545-84430567 GGACAAATTCTTAAACTAGGGGG + Intergenic
1122257062 14:100486271-100486293 TAACAAATGCTTAAATCAGATGG - Intronic
1124473178 15:30007135-30007157 TGTCTAAAGCTTAAATCAGGTGG - Intergenic
1127011850 15:54639818-54639840 TTCCCAATTTTTAAATTAGGTGG - Intergenic
1128631736 15:69274818-69274840 TTACCACTGCTTAAATTTAGTGG - Intergenic
1140605030 16:76526152-76526174 TGGCCTCTGCTCAAATTAGGAGG - Intronic
1153684098 18:7528189-7528211 TGGCCAACGGTTAAATGAGGTGG - Intergenic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1154491294 18:14924405-14924427 TGAACAATGATTCAATTAGTTGG - Intergenic
1155438302 18:25835471-25835493 TGATGAATACTAAAATTAGGAGG + Intergenic
1156584463 18:38416334-38416356 TGCCCAATGCTTACAGTAGAAGG + Intergenic
1156705899 18:39882095-39882117 TATCAAATGCTTAAATTAGGAGG + Intergenic
1160213640 18:76906658-76906680 TGACCAATGCTGTAATTGCGGGG + Intronic
1168228468 19:55013494-55013516 TGACCCATTCTTACATTTGGAGG + Intergenic
925646502 2:6042598-6042620 TGCAAAATGTTTAAATTAGGTGG - Intergenic
928907441 2:36382114-36382136 TGCCAAAGGCTTTAATTAGGAGG - Intronic
929236736 2:39613060-39613082 TGATAAATGCTAAAATTAGTGGG - Intergenic
931035291 2:58234888-58234910 TGTCCAATTTTTAAATAAGGAGG - Intronic
937479141 2:122241125-122241147 TGACCGATGCTTGAAGGAGGGGG - Intergenic
938797147 2:134727271-134727293 TGACTAATGCTTAATTGTGGGGG + Intergenic
946132267 2:217615909-217615931 TGACCAATGCATTTGTTAGGTGG - Intronic
1171749547 20:29035416-29035438 TGCCCAATGCTTACATTGTGCGG - Intergenic
1173238181 20:41267416-41267438 TGAAGAATGCTTACGTTAGGAGG - Intronic
1176315688 21:5240587-5240609 TGCCCAATGCTTACATTGTGCGG + Intergenic
949731648 3:7120703-7120725 TCACAAATGCTTAAATTACTTGG + Intronic
953251772 3:41250477-41250499 TAACCAAAGCTGAAATTAAGGGG + Intronic
953261611 3:41344660-41344682 TGAGAAATGCTTAAACTCGGGGG + Intronic
953821366 3:46210084-46210106 TGATGCATGCTTAAATTTGGGGG + Intronic
957878503 3:86180291-86180313 TTCCCATTGCTTAAATTAGTCGG - Intergenic
959081772 3:101809478-101809500 TGATGAATGCTAAAATTAGTTGG - Intronic
959212620 3:103407181-103407203 TGACCAATTCTAAAATTAGATGG - Intergenic
959876266 3:111385954-111385976 TGAACAAGGCTTGATTTAGGAGG - Intronic
966114587 3:176446498-176446520 TGACTAATACTTAAAATAAGAGG - Intergenic
969451967 4:7279044-7279066 GGAGCAAAACTTAAATTAGGTGG - Intronic
971424412 4:26501957-26501979 AGACCCATGCTTAATCTAGGTGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
977665389 4:99641635-99641657 TGACCAGTACTTAAATTATGTGG + Intronic
983236196 4:165182227-165182249 TGACCAATACATATATTAGATGG + Intronic
983476522 4:168218811-168218833 TGACTAAGCCTTAAATTATGGGG - Intronic
983748118 4:171227038-171227060 TGAGCAACTCTTAAATTAGTTGG + Intergenic
983750820 4:171267529-171267551 TCACCAATTCTTAAAATAGGGGG + Intergenic
983949036 4:173618626-173618648 TGACCAATGCCTAATATAGGAGG - Intergenic
989664867 5:43842255-43842277 AAGCCAATGCTTAAATTTGGTGG + Intergenic
993699115 5:91097348-91097370 TCACCAATGATAAAATTAGAAGG - Intronic
994347777 5:98707657-98707679 AGACCACTGCTTCAATAAGGTGG - Intergenic
997030576 5:130123026-130123048 TGGCCATTTCTTGAATTAGGAGG + Intronic
1003530861 6:6936396-6936418 TTACCAATGCTTCCATCAGGAGG + Intergenic
1004129898 6:12909721-12909743 GGACCAATGCCTAAATCAAGGGG + Intronic
1004630068 6:17412592-17412614 GGACAAATGCTTAAACTACGAGG + Intronic
1008656929 6:53624644-53624666 TAACCAATGATTAAATAAAGTGG + Intergenic
1008882094 6:56390884-56390906 TGTCCAATGCTAAAAGTAGGTGG - Intronic
1009350298 6:62667424-62667446 TGATGAATGCTAAAATTAGCAGG + Intergenic
1015154065 6:130071430-130071452 TTACGAATGTTTAAATTAGCTGG - Intronic
1015830016 6:137358604-137358626 TGGCCAATGCATAAATTATATGG - Intergenic
1018384025 6:163286653-163286675 TGACCAAGGCTCACATTAGGAGG - Intronic
1023422788 7:40000941-40000963 TGACTCATACTTAAATTATGTGG + Intronic
1024173629 7:46815321-46815343 TTACCCATGCTTAAATGAGACGG - Intergenic
1027672214 7:81115788-81115810 TGACCAATGAGTAGTTTAGGGGG - Intergenic
1031050879 7:116944173-116944195 GGACCAATGCGTAAATGAGAGGG - Intergenic
1031425418 7:121599541-121599563 TGGCAAATGCTTAAATTAACTGG - Intergenic
1032731731 7:134649804-134649826 GGAGAAATGCTTAAATTAGGTGG - Intronic
1044290932 8:90468730-90468752 TGTACAATGTTTAAATTAGTGGG - Intergenic
1047120105 8:121893505-121893527 TGACGAAAGCTTTAATTTGGGGG + Intergenic
1048931385 8:139318207-139318229 TGTCCAATTCTTAAAGCAGGTGG + Intergenic
1053720595 9:40943009-40943031 TGCCCAATGCTTACATTGTGCGG - Intergenic
1054345392 9:63909147-63909169 TGCCCAATGCTTACATTGTGCGG + Intergenic
1054602454 9:67140078-67140100 TGACTAAAGCTAAAATCAGGAGG - Intergenic
1057985293 9:99707289-99707311 TTACTAATGATTAATTTAGGAGG - Intergenic
1059665971 9:116447013-116447035 TGACCAGAGCTCAAATGAGGGGG - Intronic
1186367890 X:8914338-8914360 TGTCCACTGCATAAGTTAGGAGG + Intergenic
1188618422 X:32189440-32189462 TGGACAATACTTAAATTAGTAGG - Intronic
1192831891 X:74758975-74758997 TGACCAATGTGAAAAGTAGGTGG - Intronic
1193287548 X:79730910-79730932 TGAGAAATGCTTTAATTAAGAGG + Intergenic
1193936026 X:87623004-87623026 TCACCAATGGTGAAATTATGTGG - Intronic
1195433564 X:104816697-104816719 AGCCCAATGGTTAAATTTGGGGG + Intronic
1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG + Intronic
1201666241 Y:16459204-16459226 TGACCAATGTTGAAATTTAGAGG - Intergenic
1201718024 Y:17067484-17067506 CAACCAATGCTTAAATAAGTGGG + Intergenic