ID: 1091085782

View in Genome Browser
Species Human (GRCh38)
Location 11:132720286-132720308
Sequence GGCTGTGGCCAGGTCTTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 368}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091085782_1091085793 24 Left 1091085782 11:132720286-132720308 CCGGCCAAGACCTGGCCACAGCC 0: 1
1: 0
2: 1
3: 36
4: 368
Right 1091085793 11:132720333-132720355 ACCTCCTGAGCAGCTCTAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 122
1091085782_1091085792 23 Left 1091085782 11:132720286-132720308 CCGGCCAAGACCTGGCCACAGCC 0: 1
1: 0
2: 1
3: 36
4: 368
Right 1091085792 11:132720332-132720354 TACCTCCTGAGCAGCTCTAAAGG 0: 1
1: 0
2: 2
3: 6
4: 104
1091085782_1091085787 -2 Left 1091085782 11:132720286-132720308 CCGGCCAAGACCTGGCCACAGCC 0: 1
1: 0
2: 1
3: 36
4: 368
Right 1091085787 11:132720307-132720329 CCCTCTCTCCCAAGTCGTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 148
1091085782_1091085789 -1 Left 1091085782 11:132720286-132720308 CCGGCCAAGACCTGGCCACAGCC 0: 1
1: 0
2: 1
3: 36
4: 368
Right 1091085789 11:132720308-132720330 CCTCTCTCCCAAGTCGTTGTGGG 0: 1
1: 0
2: 0
3: 13
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091085782 Original CRISPR GGCTGTGGCCAGGTCTTGGC CGG (reversed) Intronic
900115699 1:1026940-1026962 GGCTGTGGCAAGATTGTGGCTGG + Intronic
900117889 1:1036268-1036290 GGAGGTGGCCAGGCCTTGGCAGG + Intronic
900206002 1:1432151-1432173 GGCTGTGGCCTGGGCCTGTCTGG + Intergenic
900237807 1:1600818-1600840 GGCTGTGGGGAGGTCAGGGCTGG + Intergenic
900291282 1:1924582-1924604 GTCGGTGCCCAGGACTTGGCTGG + Intronic
900344204 1:2203387-2203409 AGCTGTGCCCAGGCCTGGGCAGG - Intronic
900408143 1:2501392-2501414 GGCTGTGGCCAGGTGCTGGTGGG + Intronic
900480064 1:2893929-2893951 CGCTGTGGCAAGGCCTGGGCTGG + Intergenic
900524554 1:3122117-3122139 GTCTGTGTCCAGGCCATGGCTGG - Intronic
900898007 1:5497335-5497357 AGATGAGGCCAGGTGTTGGCAGG - Intergenic
900953519 1:5873135-5873157 GGCTGGGGCCAGGTCAGGGCAGG - Intronic
901319210 1:8329582-8329604 CTCTGTGGCCAGGGCTGGGCTGG + Intronic
901478057 1:9504500-9504522 GGCTGTGGGCAGGGCCAGGCTGG + Intergenic
901769328 1:11522543-11522565 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769342 1:11522587-11522609 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769349 1:11522609-11522631 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769367 1:11522664-11522686 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769422 1:11522807-11522829 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769429 1:11522829-11522851 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769436 1:11522851-11522873 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769446 1:11522884-11522906 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769460 1:11522928-11522950 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
902167668 1:14585391-14585413 GGACGTGGCTAGGGCTTGGCTGG + Intergenic
902822017 1:18949241-18949263 GACCTTGGCCAGGTCCTGGCTGG + Intronic
902835350 1:19043556-19043578 CGCAGTAGCCAGGTCTTGGCAGG + Intergenic
903426229 1:23256440-23256462 GACTGTGGCCAGGACATGTCTGG - Intergenic
903750853 1:25619436-25619458 GGCTCTGAGCAGGTCTTGACAGG - Intronic
904409642 1:30317710-30317732 GGCTGAGGCCTGGGCCTGGCTGG - Intergenic
905357804 1:37396816-37396838 GGCTGTGGCCCAGTCATGGGTGG - Intergenic
905932645 1:41800443-41800465 GCCTGGTGCCAGCTCTTGGCTGG - Intronic
906203558 1:43975106-43975128 GGGTGAGGCCGGGTCCTGGCGGG + Exonic
912060590 1:105663701-105663723 GTCTGTGGCCAGTGGTTGGCTGG + Intergenic
915515358 1:156409522-156409544 GGCTTTAACCAGGTCTGGGCAGG - Intronic
915522599 1:156456676-156456698 GGGTCTTGCCAGGTCTTGCCAGG - Intergenic
915646148 1:157274032-157274054 GGTTATGGCCAGGTCTAGGAGGG + Intergenic
919770205 1:201153881-201153903 GGCTGTGGTCGGGTGTTTGCTGG - Exonic
919845157 1:201637713-201637735 GGCTGTGCCCATGTGTTGGATGG - Intronic
920531553 1:206706278-206706300 GGCTGTGGCCAGGGAAAGGCAGG - Intronic
921418059 1:214913472-214913494 GGCTGTGGCAAGGTGTGGTCAGG + Intergenic
922350870 1:224733793-224733815 GGCTGTGGCCAGGTCCCTGGGGG + Intronic
922813833 1:228434811-228434833 GGCGGTGGAGAGGGCTTGGCAGG + Intergenic
922866781 1:228867245-228867267 GGCTGTGGCCTGCTCTTATCAGG - Intergenic
923211402 1:231807241-231807263 GGGAGTGGCCAGAGCTTGGCTGG - Intronic
1063261406 10:4393301-4393323 GGCTGTGCCCAAGACTTTGCTGG - Intergenic
1063270904 10:4509285-4509307 AGCTGTGGCCAGGCTTTGTCTGG + Intergenic
1064990338 10:21251317-21251339 AGCTGTGGCCAGGTCGGGGTAGG + Intergenic
1065490483 10:26277271-26277293 AGCTGTGGCCAGGTCATGGGTGG + Intronic
1067078839 10:43202795-43202817 GGCTGGGGTGAGGTCTGGGCTGG - Intronic
1069541181 10:69295111-69295133 AGCAGTGACCAGCTCTTGGCAGG - Intronic
1069590208 10:69636799-69636821 GGCTGCAGGCAGGTCTTAGCAGG - Intergenic
1069854607 10:71433013-71433035 GGCTGTGGCAAGATTTTGGTAGG + Intronic
1069906332 10:71734696-71734718 GGCTGTGGCCAGTGCTGGCCGGG + Intronic
1070793513 10:79203597-79203619 GGCTGAGAGCAGGTCTCGGCAGG - Intronic
1072679361 10:97495237-97495259 GGCTGGGGCCAGGTAGTGGCAGG + Intronic
1072710914 10:97714909-97714931 AGCTGAGGACAGGCCTTGGCTGG + Exonic
1072797296 10:98365830-98365852 GGCTGTGGCCAGGCCTCAGGAGG - Intergenic
1073379811 10:103069535-103069557 GCCTGTGGCCGGCTCTTGTCTGG + Intronic
1073963594 10:108962490-108962512 GGATCTGGCCAGGTGTTGGATGG - Intergenic
1074104773 10:110381175-110381197 GACTGTGGCCAGATGTGGGCAGG + Intergenic
1075425995 10:122342090-122342112 GCCTGTGGCCAGGCCTGAGCTGG - Intergenic
1075675606 10:124293782-124293804 GGGTTTGGCCAAGTCGTGGCCGG + Intergenic
1075905933 10:126082261-126082283 GGCTGTGGCCAGGAAATGGACGG - Intronic
1076546360 10:131248315-131248337 GACTGGACCCAGGTCTTGGCAGG + Intronic
1076586185 10:131549240-131549262 CTTTGTGGCCAGTTCTTGGCTGG - Intergenic
1076614484 10:131746753-131746775 AGCTGTGGACAGGGCTTGGGGGG + Intergenic
1077125035 11:929821-929843 GGCTGGCACCAGGTCTTGGAGGG - Intronic
1078451442 11:11443718-11443740 GGCCTTGGCCAGGACTGGGCAGG - Intronic
1078694788 11:13620395-13620417 GGCTGTGGCCAGGTACGTGCAGG + Intergenic
1079088019 11:17461091-17461113 AGCTGTGGCCAGCTCTGGGCAGG + Intronic
1079338188 11:19589679-19589701 GGCTGTGGCTCTCTCTTGGCTGG - Intronic
1079347279 11:19663974-19663996 AGCTGTGGTCTGGGCTTGGCAGG - Intronic
1081662486 11:44896574-44896596 GGCTGTGGCCATGTCTCAGGAGG + Intronic
1082933076 11:58629531-58629553 GGCTGTGGCCAGATCATTCCTGG - Intergenic
1084164474 11:67368737-67368759 GGATGTGGTGAGGTCTGGGCAGG + Intronic
1084913111 11:72407313-72407335 GGCTATGGCCAAGTGTTGACAGG - Intronic
1085456177 11:76666519-76666541 GGCTGGGCCCGGGCCTTGGCAGG + Intronic
1085697144 11:78714698-78714720 GTCTGTGGCCAGGTGTAGGGAGG - Intronic
1085761828 11:79247947-79247969 GCCTGTGGCCAGATCTTTGTAGG + Intronic
1086141503 11:83505308-83505330 GGCTGTAGCCAGGTCATCCCTGG + Intronic
1088451635 11:109987527-109987549 AGCAGTGGCCAGGTATTGGAGGG + Intergenic
1090793434 11:130112650-130112672 GCCTGTGGTCAGTTCTTGTCTGG + Intronic
1091085782 11:132720286-132720308 GGCTGTGGCCAGGTCTTGGCCGG - Intronic
1091645136 12:2267452-2267474 GGGTGTGGGCAGGACTGGGCAGG + Intronic
1091784001 12:3231423-3231445 GGCTGGGGCCAGGTCCAGCCTGG - Intronic
1091792974 12:3282032-3282054 GCCTGTGGCCAGGCCCAGGCTGG + Intronic
1092080894 12:5715321-5715343 GACTAAGGCCAGGTTTTGGCAGG - Intronic
1094819884 12:34216218-34216240 GGCTGTGGCATGGTCTTGGCTGG - Intergenic
1095094773 12:38140769-38140791 GGCTGTGGCGTGGTATCGGCTGG + Intergenic
1095712858 12:45308729-45308751 GGCTGTGGCCAGGGCCTGTGTGG + Intronic
1096552815 12:52384678-52384700 GACTTTAGCCAGGTGTTGGCTGG - Intronic
1096779544 12:53984280-53984302 AGCTGTGGCCTGGGCCTGGCAGG - Intergenic
1096844083 12:54395888-54395910 GGCTGAGGACAGATCTTTGCAGG + Exonic
1096950112 12:55459713-55459735 GGCTGTAGCCAGGTGTGGGGAGG + Intergenic
1101433753 12:104647797-104647819 GGCTGTAGTCAGATGTTGGCTGG + Intronic
1102038030 12:109783235-109783257 GGCTGAGGCTGGGGCTTGGCCGG + Exonic
1102058547 12:109914942-109914964 GCCTGTGGCCAGGTGTTTGGAGG - Intronic
1102185097 12:110941613-110941635 GGCTGTGCCCAGTCATTGGCTGG - Intergenic
1102258568 12:111429951-111429973 GACTGAGCCCTGGTCTTGGCAGG + Intronic
1102954811 12:117052615-117052637 GGCGGTGGCCAGGTATGGGGTGG - Intronic
1103041626 12:117700435-117700457 TGCTGTGGTCAGATCATGGCTGG - Intronic
1103922255 12:124405137-124405159 GGTTGTGGGCAGGCCCTGGCGGG - Intronic
1103936601 12:124480699-124480721 GCCCGTGGCCATTTCTTGGCTGG - Intronic
1103959942 12:124603221-124603243 GGCGGTGGCCAGGTCTCAGAGGG + Intergenic
1104196276 12:126541652-126541674 GGCCTTGGCCTGGTCTTGTCTGG + Intergenic
1105264914 13:18807562-18807584 GGCTGGGTCCAGGTCCTGCCTGG + Intergenic
1105838410 13:24231100-24231122 AGCTGTGGCCTAGTCTTGGGTGG - Intronic
1106781935 13:33067635-33067657 GGCAGAGGCCATGTCTTGTCTGG + Intergenic
1107987079 13:45784880-45784902 TGCTGTGGCCAGGGCCTTGCAGG + Intronic
1108161524 13:47645254-47645276 GGTTATGGCCAGGTGTTGGCTGG - Intergenic
1113709338 13:112453505-112453527 GGATGTCGCCAGGTGATGGCGGG + Intergenic
1113914399 13:113862219-113862241 GGCTGCGGCCAGGCCTTGCAGGG + Intronic
1118478646 14:66142000-66142022 GGCTGTGGCCAGGTGCTAGACGG - Intergenic
1118913363 14:70080337-70080359 GGCTGTGGACTGTTCCTGGCTGG + Intronic
1122264747 14:100541353-100541375 GACTGTGGCCAGCCCTTGCCAGG - Intronic
1122267699 14:100554356-100554378 GGCTGTGCCCAGGGCGTGGCGGG - Intronic
1122637517 14:103137262-103137284 AGCTGTGGCCAGGAAGTGGCCGG + Exonic
1122866262 14:104605309-104605331 GGGTGAGGCCAGGTGTGGGCAGG + Intronic
1122900852 14:104781760-104781782 GGCTGTTGTCAGGTCTGGGGTGG + Intronic
1122935869 14:104955857-104955879 GGCTGTGCCTAAGTCCTGGCAGG - Intronic
1123895365 15:24823645-24823667 GGCTGCGGCCAGCCCTTGGTGGG - Exonic
1124364998 15:29064857-29064879 GGCGGTGGCCACCTGTTGGCGGG + Intronic
1125676931 15:41507140-41507162 GGCAGAGGCCAGGACTGGGCCGG + Exonic
1127618770 15:60713064-60713086 GACTGTGGCCAGGGCTTCCCTGG + Intronic
1129222348 15:74138648-74138670 GGCTGTTGACAGTTCTTGGTTGG - Intergenic
1129326393 15:74802310-74802332 GGCTGTGGCCAGGGGGAGGCAGG - Exonic
1131003225 15:88954981-88955003 GGCTGCCATCAGGTCTTGGCAGG + Intergenic
1131676155 15:94672776-94672798 GCCTGTGGCCAGGTCGGGGCAGG + Intergenic
1132233524 15:100201967-100201989 GGCTGCAGCCAGGGCTGGGCGGG - Intronic
1132506877 16:314617-314639 GGCTGGGGCCAGGGCATAGCCGG + Exonic
1132575339 16:661334-661356 GGCAGAGGCCAGGACCTGGCAGG - Exonic
1132720089 16:1311487-1311509 AGCAGCAGCCAGGTCTTGGCAGG + Intronic
1133284374 16:4683788-4683810 GGCAGGGGCCAGGTCCCGGCAGG - Intronic
1133741992 16:8658832-8658854 GGCAGGGGCCAGGCCTTGGAGGG - Intergenic
1136510737 16:30737065-30737087 GGCTTGGTCCAGGTCTTTGCGGG - Exonic
1136560932 16:31038881-31038903 GGCTGGGGCCAGACCTGGGCAGG - Intronic
1136670820 16:31855309-31855331 GGCTGTGGTGAGGTTTTGGTAGG - Intergenic
1137601973 16:49762410-49762432 GCCTGTGGCCAGCCCTTCGCAGG + Intronic
1137754099 16:50887832-50887854 GGCTGGGGTCAGGGCATGGCTGG + Intergenic
1139703231 16:68722524-68722546 GGCTGTGTCTTGGTCTTGCCAGG - Intronic
1140563582 16:76012849-76012871 GCATGTGGCCAGGTCAGGGCCGG - Intergenic
1141682053 16:85550582-85550604 GGTTGTGGCCTGGTCCTGGGGGG + Intergenic
1141742789 16:85905155-85905177 GGCAGTGGCCAGCTCTTATCAGG - Intronic
1142171277 16:88624074-88624096 GCCTGTGGGCAAGTCCTGGCCGG + Intronic
1142191356 16:88719711-88719733 GGCTGTGGGCAGGTTCCGGCTGG - Exonic
1142261193 16:89043200-89043222 GAGAGTGGCCAGGTCTGGGCCGG + Intergenic
1142356818 16:89605268-89605290 GGCTGGGGCGAGGTCTGGGCAGG - Intergenic
1142374546 16:89700432-89700454 GGCTGTGCCCAGGGCTGGCCTGG - Intronic
1143347704 17:6262145-6262167 GGCAGGGGCCAGATCTTGGAGGG - Intergenic
1143462926 17:7115311-7115333 GGCTGGGGCAGGGTCTGGGCCGG - Intronic
1144334756 17:14258709-14258731 GACTGTGATCAGGTGTTGGCTGG + Intergenic
1144547884 17:16215092-16215114 GGCTGTGGCCGGGCCGGGGCTGG - Intronic
1144602460 17:16629412-16629434 GTCTTTGGCCAGGTGTTGGGAGG - Intronic
1144740704 17:17580713-17580735 GGGTGAGGCCAGGTTTTGGCTGG - Intronic
1144759517 17:17699574-17699596 GTCTGTGGTCAGGACGTGGCAGG - Intronic
1146105207 17:30028743-30028765 GGCTGAGACAAGGTGTTGGCAGG + Intronic
1147263424 17:39221906-39221928 GGATGTGGCCAGGCCATCGCAGG - Intronic
1147400296 17:40176971-40176993 GTCTGTGGGCAGGTACTGGCAGG - Intergenic
1147627263 17:41908202-41908224 GGCTCTGGCCAGGACTTCTCAGG - Intronic
1147744336 17:42685970-42685992 TGGTGTGACCTGGTCTTGGCTGG - Exonic
1149136421 17:53370660-53370682 GGCTGTGGGCTGGTCTAGGTTGG - Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1150809355 17:68344598-68344620 GGTGGAGGCCAGGTCTAGGCAGG + Intronic
1151669287 17:75563182-75563204 GGCAGTGCCCAGGACATGGCAGG + Intronic
1152224986 17:79088665-79088687 GGCTGGGGCCAGGGCTGGACAGG - Intergenic
1152817265 17:82415454-82415476 CGCCGTGGCGAGGTCGTGGCAGG - Exonic
1152892476 17:82890414-82890436 GGCTGTGGCCAGGTGGTGTGGGG + Intronic
1153634830 18:7104608-7104630 GGCTGTGGAGAGGTCTGGGCAGG + Intronic
1154423481 18:14253985-14254007 GGCTGGGTCCAGGTCCTGCCTGG - Intergenic
1155061584 18:22233482-22233504 GCCTGTGTCAAGGTCCTGGCCGG + Intergenic
1155221624 18:23690211-23690233 GGCTGTGGTCAGGTTCGGGCTGG + Intronic
1160005942 18:75069162-75069184 GGCTGTGTCCAGGTCCGGGGTGG + Intergenic
1160319788 18:77879729-77879751 GGCAGATGCCAGGTCTTGGAAGG + Intergenic
1160429415 18:78801200-78801222 GGGGGTGGCTAGGACTTGGCTGG + Intergenic
1160433887 18:78831608-78831630 GGCTGTGGCCATTCCTTGGATGG - Intergenic
1160499263 18:79394341-79394363 GCCTGGGGCCAGGATTTGGCGGG - Intergenic
1160934172 19:1585358-1585380 GGCTGGGGCCAGGGCCTGCCTGG - Intronic
1161359348 19:3838609-3838631 GGCTGTGGCAGGGCCTTGGGAGG - Intronic
1161385153 19:3987722-3987744 GGATGGAGCCAGGTGTTGGCAGG + Intergenic
1161653261 19:5498044-5498066 GGATGTGGCCATGCCTTGGATGG - Intergenic
1161762601 19:6185434-6185456 AGCTGTGGCAAGATCTTGACTGG + Exonic
1162502047 19:11059680-11059702 GGCTGGGGCCAGGGCCGGGCAGG + Intronic
1162906957 19:13829881-13829903 GCCTGTGCTCAGGGCTTGGCCGG + Intronic
1163441252 19:17323703-17323725 GGCAGCGGCCAGGGCCTGGCGGG + Exonic
1163724360 19:18914006-18914028 GGCTGGGGCCAGGTCTGCGGCGG - Intronic
1164609237 19:29621059-29621081 GGCTGTGGCTGGGTGCTGGCAGG - Intergenic
1164752746 19:30668739-30668761 GGAGGTGCCCAGTTCTTGGCTGG + Intronic
1165855636 19:38878127-38878149 GGCTGTGGGCAGTGCGTGGCAGG + Intronic
1166060435 19:40322225-40322247 GGCTGGGGACTGGCCTTGGCTGG + Exonic
1166108252 19:40608121-40608143 GGCTAGGGGCAGGGCTTGGCTGG - Intronic
1166148603 19:40854217-40854239 GGCAGTGGCATGGTCTCGGCTGG + Intronic
1166152742 19:40886002-40886024 GGCAGTGGCATGGTCTCGGCTGG + Intronic
1166930600 19:46299087-46299109 GGGTGGGGCCAGGGCCTGGCGGG - Intronic
1167116571 19:47492346-47492368 GGCTGTAGCCAGGTGTTCGTGGG + Intronic
1167146259 19:47682055-47682077 GGCTGGGGCTGGGTCTTGGGCGG - Exonic
1167225092 19:48233086-48233108 GGCTGTGACCTGGTATTGGGTGG - Intronic
1167562897 19:50236946-50236968 GGCTGTGGACAGGGCCTGGGGGG - Intronic
925662064 2:6213177-6213199 GCCTGTGCCATGGTCTTGGCTGG + Intergenic
925815596 2:7745026-7745048 GGCAGGGGCCAGATCTTGCCTGG - Intergenic
926150135 2:10421102-10421124 GGCTTTCCCCAGGTCTTGGCAGG - Intronic
926415867 2:12649395-12649417 GGCAGTGACCAGGCCTGGGCAGG + Intergenic
926670390 2:15572138-15572160 GCCTATGGTCAGGTGTTGGCTGG - Intergenic
926878874 2:17518508-17518530 GGCTAAGGCCAGGTCTTGAGGGG - Intergenic
927510149 2:23639308-23639330 GACTGAGCCCAGGGCTTGGCGGG + Intronic
927518978 2:23688007-23688029 GGCTCTGGGCAGGACTTTGCCGG - Intronic
929231370 2:39564352-39564374 GGCTGTGGTCAGGTTTTGCTAGG + Intergenic
929435662 2:41926754-41926776 CCCTTTGGCCAGATCTTGGCTGG - Intergenic
931463762 2:62469613-62469635 GCCTGTTGCCAGGTGTTGGGAGG + Intergenic
931710576 2:64986665-64986687 GGCTGAGGCCAGATCATGGTAGG + Intergenic
932435809 2:71702073-71702095 AGCTGGGGCCAGGCCCTGGCAGG + Intergenic
932885549 2:75546093-75546115 GGCTGGGGCCAGGTCATGGGAGG + Intronic
933573492 2:84040599-84040621 GATTGTGGCCATGGCTTGGCAGG + Intergenic
934989653 2:98912416-98912438 GGGTGTGGCCAGGTCATGCCTGG - Intronic
936512334 2:113157972-113157994 GGCTGTGGCCCCGGCTTGGTGGG + Intronic
937125029 2:119469348-119469370 GGCTGTGGCCATTGCTTGCCAGG + Intronic
937545051 2:123005849-123005871 GGCTGTGGCAAGGTTTTTGCTGG - Intergenic
944579090 2:201116653-201116675 GGCAGTGGCCAGGGGATGGCGGG + Intronic
946200017 2:218065871-218065893 GGCTCTGGCCAGGCCGTGTCAGG + Intronic
947500706 2:230668789-230668811 TGCTTTGCCCAGGTCGTGGCAGG - Intergenic
947715880 2:232338595-232338617 GCCTGAGCCCAGGTCCTGGCTGG - Intronic
947734904 2:232449341-232449363 GCCTGAGCCCAGGTCCTGGCTGG - Intergenic
947875186 2:233463023-233463045 GAGTGTGGCCAGCTCTCGGCAGG - Intronic
948446546 2:238038028-238038050 GACTGTAGCGAGGACTTGGCAGG - Intronic
948696986 2:239737542-239737564 GGCTGTGGCTGGGGCTGGGCTGG - Intergenic
948697028 2:239737636-239737658 GGCTGTGGCTGGGGCTGGGCTGG - Intergenic
948697165 2:239737923-239737945 GGCTGGGGCCGGGGCTGGGCTGG - Intergenic
948697177 2:239737946-239737968 GGCTGGGGCCGGGGCTGGGCTGG - Intergenic
948697217 2:239738026-239738048 GGCTGGGGCCGGGGCTGGGCTGG - Intergenic
948697263 2:239738122-239738144 GGCTGGGGCCGGGGCTGGGCTGG - Intergenic
948697357 2:239738292-239738314 GGCTGTGGCTGGGGCTGGGCTGG - Intergenic
948915766 2:241034442-241034464 GGCTGAGGTCAGGACCTGGCTGG + Intronic
949023320 2:241753367-241753389 GGCTCTGGGCAGGTCTGGGCAGG + Intronic
1170180410 20:13523672-13523694 GGTTGTGGTCAGGACTTGCCAGG - Intronic
1170367661 20:15615613-15615635 GCCTGTGGTCACTTCTTGGCTGG - Intronic
1170608317 20:17890558-17890580 GGCTGCAGTCAGGTGTTGGCTGG - Intergenic
1171300907 20:24059586-24059608 AGCTGTGGCTAGGTCTGGCCGGG - Intergenic
1171382188 20:24742342-24742364 GGCTGTGGTCAGGGCTGGGGAGG - Intergenic
1172128084 20:32637037-32637059 TTCTGTGGCCTGGCCTTGGCAGG - Intergenic
1172586948 20:36092161-36092183 GGCGTGGGCCAGGTCCTGGCTGG + Intronic
1173263592 20:41458723-41458745 GGCTGAAGCCAGGTCTGGACAGG - Intronic
1174414501 20:50358077-50358099 GGCTGGGGCCAGGTCAGGCCAGG - Intergenic
1174486676 20:50865724-50865746 GGCTGGGGTCAGGGCTGGGCTGG + Intronic
1175734576 20:61376402-61376424 GGCTCTGGCCAGGCCTGGGAAGG + Intronic
1176429472 21:6567151-6567173 GCCTTTGGCTAGGCCTTGGCAGG + Intergenic
1176849991 21:13906024-13906046 GGCTGGGTCCAGGTCCTGCCTGG + Intergenic
1177078604 21:16610157-16610179 GGTTCTGCCCAGGACTTGGCTGG - Intergenic
1179704866 21:43174613-43174635 GCCTTTGGCTAGGCCTTGGCAGG + Intergenic
1179790580 21:43753857-43753879 GGCAGTGGCCAGGCCATGACAGG + Intronic
1179833315 21:44012096-44012118 AGCTGAGGCCAGGACTCGGCAGG - Intergenic
1181000757 22:19986902-19986924 GGCTGGGGCCAGGGCCGGGCGGG - Intronic
1181112760 22:20611590-20611612 GGCTGTGGCCAGGTCCTCGGGGG - Intergenic
1184176744 22:42793348-42793370 GGCTGTGGCCACAGCTTGCCAGG + Intergenic
1184290873 22:43497591-43497613 TGATGGGTCCAGGTCTTGGCTGG + Intronic
1184341939 22:43891029-43891051 GGGGGTGCCCAGGGCTTGGCTGG - Intronic
1184363078 22:44030440-44030462 GGCTGTGGCCAGCCCTGGTCGGG + Intronic
1184693524 22:46127991-46128013 GGGTGTGGCCAGGGCCTGACGGG - Intergenic
1185318057 22:50187221-50187243 GACTGTGACCAGGTCCTGGGAGG + Intronic
1185368475 22:50447652-50447674 TGCTGGGGCCTGGGCTTGGCTGG - Intronic
949344291 3:3062345-3062367 GGCTGTGCCCTGGGCCTGGCCGG - Intergenic
950773124 3:15328124-15328146 GGGGGTGGCCAGGGCTGGGCTGG - Intronic
952160528 3:30688968-30688990 GGCTGTGTACAGGTGTTTGCAGG + Intronic
952867501 3:37863594-37863616 GGCTGTGGCCAGCTCCGGCCTGG - Intronic
952964115 3:38610530-38610552 GGCTGTGGTCAGGTGTGTGCTGG + Intronic
954140549 3:48602935-48602957 GGCTGTGGCAGGGACTGGGCAGG - Intronic
954866390 3:53733180-53733202 GGGTGTGGCCAGGTCCTGGGAGG + Intronic
955045068 3:55351977-55351999 GGCTGGGGTCAGATCTTGGCTGG + Intergenic
955071923 3:55578813-55578835 GGCTGTGACCTGGTCTAGGGTGG + Intronic
955631763 3:60982215-60982237 GGCTGGGGCCAAGTCCTGGAAGG - Intronic
955843166 3:63133215-63133237 GGCTGTTGCCAGGTCTGAGTTGG - Intergenic
956657110 3:71563119-71563141 GACTGTGGCCAGGGAGTGGCTGG + Intronic
958614645 3:96476225-96476247 GGAAGTGGTCAGGTCTTGACAGG - Intergenic
960406162 3:117262418-117262440 GGCTGGAGCCAGGTCATGGTGGG - Intergenic
960631652 3:119738168-119738190 GGCTGAGGGCAGGTGTTGGTGGG + Intronic
963705769 3:148686635-148686657 TGCTGAGGCCAGGGCTTGGCTGG - Intergenic
966881991 3:184355698-184355720 GGCTTTGGACAGTTCATGGCTGG - Exonic
968233289 3:197016614-197016636 GGCTGTGGCCAGGCATGGGACGG + Intronic
968584274 4:1408722-1408744 GGCTGAGGTCAGGCCGTGGCAGG - Intergenic
968726738 4:2251351-2251373 AGCCTTGGCTAGGTCTTGGCAGG - Intronic
969340034 4:6534897-6534919 CGCTGTGGCCAGCACTGGGCCGG - Intronic
969447244 4:7252320-7252342 TGCTGGGGCCAGGTGTGGGCAGG + Intronic
969562368 4:7957582-7957604 GGCAGTGGCCAGATGATGGCCGG + Intergenic
969597335 4:8156888-8156910 GGCTGGGGACAGGGCTGGGCAGG + Intronic
969670576 4:8587899-8587921 GTCTGTGGTCAGGACCTGGCAGG + Intronic
969838741 4:9864911-9864933 TGCCTTGGCCAGGTCTTGGCTGG + Intronic
971189909 4:24417365-24417387 GGCTGTGGCCATTTCTTCCCAGG - Intergenic
971775599 4:30960343-30960365 GGCTGTGGCTAGGTCATGTAAGG + Intronic
975302692 4:72809357-72809379 GGTTGTTTCCAGTTCTTGGCTGG - Intergenic
975320998 4:73010854-73010876 GCCTGGGGCCAGGTCATGCCTGG - Intergenic
975649954 4:76583118-76583140 GGCTGTGGGCAGGTCTTACCTGG + Intronic
977871297 4:102093668-102093690 CTCTGTGCCCAGGTATTGGCTGG - Intergenic
979719526 4:123882657-123882679 AACTGTGGCCAGGCCATGGCCGG - Intergenic
983185198 4:164692466-164692488 GGCTGTAGCCAGGTCTTCCCTGG - Intergenic
984304471 4:177969956-177969978 GCCTGTAGCCACGTCATGGCAGG - Intronic
984919069 4:184748208-184748230 GGCGGAGGCCACGTCTTGCCAGG - Intergenic
985885644 5:2675702-2675724 GGCAGTGGGCAGGTCGTGGCAGG + Intergenic
986066682 5:4240957-4240979 GGGTGTGGCCAGGGCTGGACTGG + Intergenic
986244563 5:5994677-5994699 GGCTGTGGGTTGGTCTTGTCTGG + Intergenic
988781856 5:34529582-34529604 GGCCGTGGCCTGGGCTGGGCTGG - Intergenic
990529379 5:56658705-56658727 GGGAGTGGCCAGTTCTTAGCAGG - Intergenic
991274019 5:64822005-64822027 GACTGGGGCCAGGTCATGACGGG + Intronic
992570833 5:78055241-78055263 GGCACTGGCCAGGTCTTCTCAGG + Intronic
994643021 5:102433786-102433808 GGCTGTGGCAGGGTGCTGGCAGG + Intronic
995250901 5:109992253-109992275 GGTTGTGTCCTGGTCTTGACTGG + Intergenic
995274642 5:110264185-110264207 GAAGGTGGCCAGGTCTGGGCTGG - Intergenic
996095987 5:119399844-119399866 GGTTGTGGTCAGATCATGGCTGG + Intergenic
1000074049 5:157768193-157768215 GGATGGGGACAGTTCTTGGCAGG + Intergenic
1000801759 5:165736779-165736801 GGCTGTGGCTTAGTCTTTGCTGG + Intergenic
1002277761 5:178114439-178114461 GGCTGTGGCCGGGACTGGACCGG - Intronic
1002427889 5:179186549-179186571 GCCTCTGGCCAGGGCTGGGCAGG - Intronic
1002526745 5:179819500-179819522 GGCTATGGCCCGGTCTGAGCAGG - Intronic
1002662022 5:180797716-180797738 GGTGGAGGCCAGGGCTTGGCCGG - Intronic
1003588734 6:7418485-7418507 GGCTGTGGGAGGGTTTTGGCAGG + Intergenic
1004493634 6:16142513-16142535 GAATCTGGCCATGTCTTGGCTGG + Intronic
1004620366 6:17325966-17325988 GGCTGTGGCCACCTCTTGGAGGG + Intergenic
1004709945 6:18160262-18160284 GGCTGGGGCCAGATCATGCCTGG + Intronic
1005311555 6:24564080-24564102 GGCTGGCTCCAGCTCTTGGCTGG - Intronic
1005970348 6:30756076-30756098 GGCTCTGCCCAGGTCTTGTGGGG + Intergenic
1006391387 6:33761098-33761120 GGCTCTGGCTTGGTTTTGGCAGG + Intergenic
1006473825 6:34242867-34242889 GGCTGTGGGGAGGTCTGGGAAGG + Intronic
1006919070 6:37615656-37615678 GGCAGTGGCCAGCTCATGGATGG - Intergenic
1006924793 6:37648382-37648404 GGCTGTGGCCTGGGCTTGAGGGG + Intronic
1007430020 6:41771198-41771220 GGCTGTGGCGAGGGGCTGGCTGG - Exonic
1009994870 6:70886718-70886740 TGCTGTGGCCAGGGCTGTGCTGG - Intronic
1011049383 6:83127465-83127487 GGCAGAGGCCAGGTCTTAGAGGG + Intronic
1011083374 6:83512558-83512580 TGCTGTGGCCCGGCCTTGGCGGG + Exonic
1011193989 6:84763926-84763948 GGCTGGGGCGACGTCTGGGCCGG - Exonic
1011388454 6:86823228-86823250 GCCTATGGTCAGGTTTTGGCTGG + Intergenic
1011850357 6:91620117-91620139 GGCCATGGCCAGGGCTGGGCTGG - Intergenic
1012948781 6:105495690-105495712 TGCTGTGGTCAGGTCTTGCCCGG + Intergenic
1016894335 6:149037600-149037622 GGCTGTGGCCAGGCCGCCGCAGG - Intronic
1019080436 6:169425939-169425961 GGCTGTGTCCATGCCTGGGCTGG - Intergenic
1019183751 6:170208995-170209017 AGCTGTAGCCAGGCATTGGCAGG - Intergenic
1019359572 7:597786-597808 GGCTGTGCCCAGGCCATTGCAGG - Intronic
1019422499 7:957592-957614 GGCTGTGGTCAGGGCTGGGCGGG + Intronic
1019504776 7:1385404-1385426 GGCAGTGGCCGGGTCTGAGCTGG - Intergenic
1019733415 7:2639259-2639281 GGCTCAGGCCAGGGCCTGGCTGG + Intronic
1020098752 7:5382672-5382694 GGGTGGGGCCAGGTCTGGGAGGG - Intronic
1021084902 7:16410646-16410668 GGCTGAGGTCAGGTCTTGAAGGG - Intronic
1022042454 7:26593427-26593449 GGCTCTGGGCAGGGCTTGGTGGG - Intergenic
1022836596 7:34122452-34122474 AGGTGAGGCCAGGTCATGGCTGG + Intronic
1023766265 7:43513942-43513964 TGCTGTGGCCAGGTCTCGCAGGG - Intronic
1023828889 7:44028085-44028107 GGCTGGGGGCAGGGCTTGGTGGG + Intergenic
1023831117 7:44039485-44039507 GGCTGTGGGCGGGTCTGTGCAGG + Intergenic
1023834124 7:44058555-44058577 GCCTCTGCCCAGGTCTGGGCTGG - Intronic
1024550171 7:50556123-50556145 GGGTTTGGGCAGCTCTTGGCTGG + Intronic
1026520125 7:71110178-71110200 GCCTATGGTCAGGTGTTGGCTGG - Intergenic
1026868860 7:73838792-73838814 GGCTGTGGCTAAGCCTGGGCAGG - Intronic
1027233263 7:76283754-76283776 GGCTGTGCCCAGGGCGTGGCTGG + Intronic
1029739189 7:102482342-102482364 GGCTGGGGGCAGGGCTTGGTGGG + Intergenic
1029741445 7:102493791-102493813 GGCTGTGGGCGGGTCTGTGCAGG + Intronic
1029757190 7:102581521-102581543 GGCTGGGGGCAGGGCTTGGTGGG + Exonic
1029759437 7:102592960-102592982 GGCTGTGGGCGGGTCTGTGCAGG + Intronic
1029775130 7:102680582-102680604 GGCTGGGGGCAGGGCTTGGTGGG + Intergenic
1029776804 7:102688870-102688892 GGCTGTGGGCGGGTCTGTGCAGG + Intergenic
1030081505 7:105782594-105782616 GACTGTGGCCAGCCCTGGGCGGG + Intronic
1031999841 7:128257730-128257752 GGCTGTGGCCAAGCCTGGGGCGG - Intergenic
1033229469 7:139584913-139584935 GGCTTTGGATAGCTCTTGGCCGG + Intronic
1033308520 7:140242115-140242137 GGCTGTCTCCAGGGCTGGGCCGG - Intergenic
1033366734 7:140677932-140677954 GGGTGAGGCCAGGTCTTGGGTGG + Intronic
1034786857 7:153934250-153934272 AGCTGTGGCCAGGTGCTGGGAGG + Intronic
1035890043 8:3333192-3333214 GGACGTGACCAGGTGTTGGCTGG - Intronic
1036753002 8:11455069-11455091 GGCCGGGGTCAGGTCTCGGCAGG - Intronic
1037725176 8:21477459-21477481 GGCTGGGGCCTGGCGTTGGCTGG + Intergenic
1037878640 8:22561884-22561906 GCCTGTGGGCAGGTCTTTGCTGG - Exonic
1038395235 8:27241608-27241630 GGCTGTGGCCGGGGGTGGGCGGG - Intronic
1040280153 8:46036816-46036838 GGCTGTGGCGTGGTCTCGGCTGG - Intergenic
1040280249 8:46037305-46037327 GGCTGTGGCCTGGTCTCTGCTGG - Intergenic
1040988989 8:53328685-53328707 GGCTGTGCCCAAATCTTGGCTGG + Intergenic
1043775145 8:84257633-84257655 GTTTGTGGCCAGTTGTTGGCAGG + Intronic
1045358549 8:101411341-101411363 GGTAGAGGCCAGGTCATGGCAGG + Intergenic
1049006305 8:139857755-139857777 GGCTGTGTGCAGCTGTTGGCAGG - Intronic
1049105225 8:140608591-140608613 GGCTGAGGGAAGGTCATGGCTGG + Intronic
1049237496 8:141519387-141519409 GGCAGAGGCCAGGTCATTGCTGG - Intergenic
1049339327 8:142103592-142103614 GGCAGTGGCCAGGACCAGGCAGG - Intergenic
1049382609 8:142324984-142325006 GGGTGTTGCCAGGTCTAGGACGG - Intronic
1049684558 8:143934132-143934154 GTCTGTGGCCAGGGCTGTGCCGG - Intronic
1049829976 8:144694208-144694230 GGCAGGGGCCAGGTGGTGGCAGG + Intergenic
1053166329 9:35846406-35846428 GGCTGGGACCGGGACTTGGCGGG + Intronic
1053306408 9:36987215-36987237 GGAGGTGCCCAGGTCTAGGCTGG - Intronic
1057464106 9:95295797-95295819 GGCTGTTGCCAGGGGCTGGCAGG + Intronic
1057859229 9:98626220-98626242 GGCTGTTGCCAGGGGTTGGGTGG + Intronic
1059489435 9:114654968-114654990 GGCAGTGGCATGATCTTGGCTGG - Intergenic
1060088348 9:120721354-120721376 GGCTGTGCCCAGGCCTTGCAGGG + Intergenic
1060593311 9:124832966-124832988 GGCTGAGGCCTAGCCTTGGCTGG + Intergenic
1060721697 9:125983874-125983896 GGCAGGGGCCAGGTATTGTCAGG - Intergenic
1060881730 9:127122489-127122511 GGCTGGGGCCAGGGCTGGCCAGG + Exonic
1061708133 9:132468578-132468600 GGCTGTGGCCTGCTCTTGAGTGG - Intronic
1062265033 9:135683123-135683145 GGGTGTGCCCAGGTGTGGGCTGG - Intergenic
1062385731 9:136310812-136310834 GGCTGTGGCCTCTCCTTGGCGGG - Intergenic
1203791010 EBV:151532-151554 GGCCGTGGCCAGGTACGGGCTGG - Intergenic
1189283448 X:39835410-39835432 GACTCTGGGCAGGGCTTGGCTGG - Intergenic
1190817056 X:53938302-53938324 GGCTGTGGCTGGGCCCTGGCAGG - Exonic
1192051717 X:67730483-67730505 GGATGTGGCCAAGTTTTAGCTGG - Exonic
1192498050 X:71629382-71629404 GGCTGGGGCCAGATCATGGAAGG - Intergenic
1192511061 X:71720619-71720641 GGCTGTGGGCTGGCCCTGGCTGG + Intergenic
1192515636 X:71760934-71760956 GGCTGTGGGCTGGCCCTGGCTGG - Intergenic
1192528844 X:71869688-71869710 GGCTGTGGGCTGGCCCTGGCTGG - Intergenic
1194365677 X:93011004-93011026 GGCTGTGGCAGGGTGTTAGCAGG + Intergenic
1196456652 X:115895851-115895873 GGTGGTGGCCATGTCTGGGCGGG - Intergenic
1197922273 X:131608127-131608149 GGCTGGGTCCAGATCTTGGAAGG - Intergenic
1198933128 X:141880659-141880681 GGCTATGGCCAGGTGCTGCCAGG - Intronic
1198935116 X:141896332-141896354 GGCTATGGCCAGGTGCTGCCAGG - Intronic
1200075170 X:153547163-153547185 GGGTGCGGCCAGAGCTTGGCAGG + Intronic
1200150939 X:153951150-153951172 GACTGTGGCCCGGTACTGGCGGG + Intronic
1200673895 Y:6127254-6127276 GGCTGTGGCAGGGTGTTAGCAGG + Intergenic
1201766354 Y:17576771-17576793 GGCGGTGGCATGGTCTCGGCTGG - Intergenic
1201835198 Y:18329218-18329240 GGCGGTGGCATGGTCTCGGCTGG + Intergenic