ID: 1091086594

View in Genome Browser
Species Human (GRCh38)
Location 11:132727341-132727363
Sequence GTTCCCATCCTCATTTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091086590_1091086594 6 Left 1091086590 11:132727312-132727334 CCTGTGCCTAGAGATTTAGGTGA 0: 1
1: 0
2: 0
3: 10
4: 174
Right 1091086594 11:132727341-132727363 GTTCCCATCCTCATTTCTCCCGG 0: 1
1: 0
2: 1
3: 19
4: 254
1091086591_1091086594 0 Left 1091086591 11:132727318-132727340 CCTAGAGATTTAGGTGAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1091086594 11:132727341-132727363 GTTCCCATCCTCATTTCTCCCGG 0: 1
1: 0
2: 1
3: 19
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091086594 Original CRISPR GTTCCCATCCTCATTTCTCC CGG Intronic
900004041 1:32440-32462 ATTTCCATCCTCCTCTCTCCAGG - Intergenic
900023769 1:202960-202982 ATTTCCATCCTCCTCTCTCCAGG - Intergenic
900392814 1:2441091-2441113 GTTCCCATCCTGACTGCACCTGG + Intronic
900726386 1:4219016-4219038 GTTTGCAGCCTCATTTTTCCAGG + Intergenic
901213713 1:7541275-7541297 TTTCCCATTCTCCCTTCTCCAGG - Intronic
901442375 1:9286220-9286242 GTTCTCATTCTCATTTCTGCAGG - Intergenic
902183400 1:14706991-14707013 GTTACCATGCTCTTGTCTCCCGG + Intronic
902355805 1:15899016-15899038 GTTCCCGTCTTCATTTCTCTTGG + Intronic
902407274 1:16191639-16191661 CTACCCCTCCTCATTCCTCCTGG - Intergenic
903790373 1:25888835-25888857 TTTCCCATCCTCCTTTTTCCTGG - Intronic
907765437 1:57405997-57406019 CTTCCCTGCCTCATTTCCCCTGG + Intronic
910758032 1:90711811-90711833 GTTACCCTCCTCTTTTCTCTGGG + Exonic
910842634 1:91575212-91575234 GTTTCCAATCTCATTTCTCTTGG + Intergenic
911761124 1:101618771-101618793 ATTCCCATCATCTTTCCTCCCGG - Intergenic
913010323 1:114676992-114677014 CTTCCCATGCTCATCTCTACTGG - Intronic
915085050 1:153380801-153380823 GTGACCATCGTCATTGCTCCTGG + Intergenic
915244962 1:154550327-154550349 GTTCCCTCCCTCATTTTTCCTGG - Exonic
915436902 1:155913812-155913834 GTTCCCATACACATTTGACCTGG - Exonic
915634819 1:157178616-157178638 GTTCCCACCCTCTCTTCCCCAGG - Intergenic
918143816 1:181738820-181738842 GTTCCCAGCCTCATCCATCCAGG + Intronic
920324068 1:205147745-205147767 GTTTCCATGCTCCTTTCTCTAGG - Exonic
922326858 1:224536083-224536105 TTTCCCATCCTCATCCCTGCTGG - Intronic
1067525335 10:47035202-47035224 TTTCCCACCCTCACTGCTCCCGG + Intergenic
1068688660 10:59894296-59894318 CCTCCCATCCTCATTTTTCTCGG + Intronic
1073743119 10:106434476-106434498 TTTCCCATCTGCATTTCTCAAGG - Intergenic
1075646702 10:124101499-124101521 GTTCCCAGCCACATCACTCCAGG + Intergenic
1076044571 10:127281417-127281439 GGTCCCATTCCCAATTCTCCTGG - Intronic
1076196418 10:128521559-128521581 CCTCCCATCCTCATATTTCCTGG - Intergenic
1076427999 10:130381036-130381058 GTTCCCAGCCTCACTTCAGCTGG - Intergenic
1076941512 10:133613100-133613122 TTTCCCAGCCTTATTTCGCCAGG - Intergenic
1077470721 11:2759316-2759338 GTTTCCCTCTTCATGTCTCCTGG + Intronic
1077663502 11:4089276-4089298 CCTCCCAGCCTCACTTCTCCTGG - Intronic
1077900608 11:6484577-6484599 GGTCCCATCCTCCTATCTTCTGG - Exonic
1077989001 11:7384951-7384973 CTTCCTTACCTCATTTCTCCAGG + Intronic
1078420306 11:11206378-11206400 GTCTGCAACCTCATTTCTCCAGG + Intergenic
1078647945 11:13159529-13159551 ATTCTTATCCCCATTTCTCCAGG - Intergenic
1084901533 11:72313634-72313656 GTTGCCCTCCTCAGTCCTCCTGG - Intronic
1084957742 11:72700283-72700305 GTTCACAACCTCATTGCCCCAGG - Intronic
1087500199 11:98942088-98942110 TTTCTAATCTTCATTTCTCCAGG - Intergenic
1087998221 11:104838945-104838967 GTTACCTTCCTCATTTTGCCTGG + Intergenic
1089072876 11:115714977-115714999 GTTCTTATTCTCATTTTTCCGGG + Intergenic
1091086594 11:132727341-132727363 GTTCCCATCCTCATTTCTCCCGG + Intronic
1091300609 11:134504868-134504890 GCACCCATCCTCACTCCTCCAGG - Intergenic
1091307130 11:134543430-134543452 GTTTCCATCCTCCCTGCTCCTGG + Intergenic
1091339475 11:134799274-134799296 CATCCCACCCTCACTTCTCCTGG + Intergenic
1091377466 12:34492-34514 ATTTCCATCCTCCTCTCTCCAGG - Intergenic
1092746425 12:11676506-11676528 GGTGCCATCCTCTTCTCTCCTGG + Intronic
1092750146 12:11711216-11711238 TTTCCCAGCCATATTTCTCCAGG + Intronic
1096498823 12:52053586-52053608 GTTCCCTTCCTCTTTGCTTCTGG + Intronic
1096601221 12:52731096-52731118 TTTCTCATCCTCATTTCCACTGG - Intergenic
1100357991 12:93849928-93849950 GTTGCCTTGCTCATTTCACCGGG + Intronic
1102248599 12:111370445-111370467 GCTCCCTCCCTCATTCCTCCAGG - Intergenic
1104481239 12:129110107-129110129 CTTCCCATCCTCCTTTCCCAGGG + Intronic
1106385459 13:29281264-29281286 ATTCCTATTCTCACTTCTCCTGG + Intronic
1106594468 13:31124585-31124607 TTTCCCAAACTCATTTCTTCAGG - Intergenic
1107819345 13:44272218-44272240 CTTCCCATCCTCAGCTCTCACGG + Intergenic
1110471772 13:75867965-75867987 GTTCTCATACTCATTTCTTCTGG - Intergenic
1111689178 13:91539716-91539738 GTATACATCCTCATTTCTCAGGG - Intronic
1112318659 13:98387753-98387775 CCTCCCATCCTCAGTTCTACCGG + Intronic
1113611249 13:111646204-111646226 GTTCACATCCTCACTCCACCAGG + Intronic
1113843668 13:113374167-113374189 GTCCCCAGCCTCATCTCTCCGGG - Intergenic
1113880643 13:113623667-113623689 CTTCCCAGCCTGATGTCTCCAGG - Intronic
1114651513 14:24287747-24287769 GCCCCCTTCCTCAGTTCTCCAGG + Intergenic
1115309981 14:31969117-31969139 TGGCCCATCCTCACTTCTCCTGG - Intergenic
1117452533 14:55865390-55865412 GGTCCCACCCTCACTTCTCACGG - Intergenic
1118455389 14:65941574-65941596 GCTCCCCTCCCCATCTCTCCAGG - Intergenic
1119552119 14:75522594-75522616 GCTCCCTTCCTGACTTCTCCTGG - Exonic
1121271174 14:92639180-92639202 GCTCCCAGCCTCATGTCACCAGG + Intronic
1121653270 14:95575698-95575720 GTACCCATCCCTCTTTCTCCTGG + Intergenic
1122362911 14:101177983-101178005 GCTCCCATCCTCAGCCCTCCCGG + Intergenic
1123762540 15:23443972-23443994 GTTCCCATCTTCAAATTTCCTGG + Exonic
1124550932 15:30680731-30680753 GTTGCCATCCACATTCCTCTTGG + Intronic
1124680321 15:31724938-31724960 GTTGCCATCCACATTCCTCTTGG - Intronic
1125673808 15:41492060-41492082 GCTTCCTTCCTCAGTTCTCCAGG + Intergenic
1126109939 15:45169182-45169204 ATTGCCAGCCTCACTTCTCCGGG - Intronic
1126883105 15:53120377-53120399 ATGCCCATCCTAATTTCTCTTGG + Intergenic
1127622185 15:60744890-60744912 TTTCCCCACCTCATTTCACCCGG + Intronic
1128121916 15:65155611-65155633 GTTTCCATTCTCATATCTGCGGG - Intronic
1129769154 15:78192670-78192692 GTGCCTATCCTCATTTCTAGTGG - Intronic
1130077758 15:80704420-80704442 GTTCCCATCCTTGCTTCACCTGG + Intronic
1132215696 15:100060166-100060188 TTTCCCTTGCTCATTTCGCCTGG + Intronic
1132449462 15:101958501-101958523 ATTTCCATCCTCCTCTCTCCAGG + Intergenic
1132746211 16:1437346-1437368 ATTCCCATCCCCACTTCCCCTGG - Intronic
1134634673 16:15783321-15783343 TTTCCCTTCCTTATTTTTCCAGG + Intronic
1135481705 16:22826108-22826130 TTTCTCATCTTCATTTCTCCAGG - Intronic
1136179791 16:28543281-28543303 TTTCCCATCCTCAAGCCTCCAGG + Intergenic
1138440272 16:57030119-57030141 TTTCCCCTCCTCTTTTCTCAAGG - Intronic
1140941806 16:79728553-79728575 GTTCACATCCACATTCCACCGGG + Intergenic
1141330291 16:83104845-83104867 TTTCAGATCCTTATTTCTCCTGG - Intronic
1141599929 16:85119477-85119499 GGTCCCATTCACCTTTCTCCAGG - Intergenic
1142620419 17:1162120-1162142 TTTCACATCCTCAGTTCTGCTGG - Intronic
1143256212 17:5559871-5559893 GTTAAAATCCTCATTTTTCCAGG + Exonic
1144505800 17:15829592-15829614 CTTCCAATCCACATTTCACCTGG - Intergenic
1145117830 17:20227904-20227926 GCTCCATTCCACATTTCTCCTGG - Intronic
1145169976 17:20647524-20647546 CTTCCAATCCACATTTCACCTGG - Intergenic
1146413460 17:32610045-32610067 GTTACCATTCTCATTTCTTTAGG - Intronic
1148511837 17:48177638-48177660 ATTCCCTTCTTAATTTCTCCAGG + Intronic
1149017067 17:51920297-51920319 TTTCACTTCCTCTTTTCTCCTGG - Intronic
1149192894 17:54085480-54085502 GTTCCTGATCTCATTTCTCCTGG + Intergenic
1149465651 17:56876967-56876989 GTTCACCTCCTTATCTCTCCTGG - Intergenic
1150036103 17:61800059-61800081 GTGGCCATGCTCTTTTCTCCAGG + Intronic
1151319069 17:73342051-73342073 GTTCCCATCCTGTGGTCTCCAGG - Intronic
1156971522 18:43162879-43162901 GCCCCCATCCCCATTGCTCCCGG + Intergenic
1160635793 19:74049-74071 ATTTCCATCCTCCTCTCTCCAGG - Intergenic
1161003407 19:1922586-1922608 TTTTCCATCCGCATTGCTCCCGG + Intronic
1161573078 19:5040910-5040932 GTACCCCTCCTCAGTTATCCTGG - Intronic
1163107624 19:15134875-15134897 CTTTCCATCCTCTTGTCTCCAGG - Intergenic
1163778055 19:19229425-19229447 GCTCCCATTCACATTTGTCCAGG - Intronic
1164437446 19:28243276-28243298 GTTCCAATCCTCAACCCTCCTGG + Intergenic
1167607608 19:50489760-50489782 CTTCCCTTCCTCCTTTCTCCTGG - Exonic
1167851337 19:52204698-52204720 GTTCCCAGCCTCAGTTTCCCTGG - Intronic
1168442364 19:56380924-56380946 GATCCCATCCTCATTTGTCATGG - Intronic
926171095 2:10553032-10553054 GCTCCCATCCTCAGTGCCCCTGG - Intergenic
926787385 2:16531501-16531523 CTTCCCATGCTGATTTGTCCTGG - Intergenic
927329542 2:21845966-21845988 GCTTCAATCCTCCTTTCTCCTGG - Intergenic
928746233 2:34418969-34418991 ATTCCCATCCCCTATTCTCCAGG + Intergenic
929118900 2:38467538-38467560 TTTGCCATCCTCCTTTCTCCCGG + Intergenic
929139341 2:38653571-38653593 GTTCTCATCCTCAAATCTCTTGG - Intergenic
929435994 2:41928882-41928904 GTGCCCAGCCTCCTTTCTCTTGG + Intergenic
931006710 2:57857993-57858015 GTTCCCATCTTCATATCTATGGG + Intergenic
932340692 2:70961135-70961157 GCTCCCATCCTCACCCCTCCTGG - Intronic
933574292 2:84049848-84049870 GTTCCCATCCTGGATTTTCCCGG + Intergenic
933762534 2:85682204-85682226 GTGCCCAGCCTCATTTCTTTTGG + Intergenic
936565683 2:113581001-113581023 ATTTCCATCCTCCTCTCTCCAGG + Intergenic
936861731 2:117027745-117027767 CTTCCCATCCTGATTTCCACTGG - Intergenic
940042657 2:149376905-149376927 GCTCCCATGTTCTTTTCTCCTGG + Intronic
942505109 2:176633740-176633762 GTTCCAAGCTTCATTTCTCTAGG - Intergenic
942943231 2:181644307-181644329 GATCCCTTCATCATTTCTTCAGG + Intronic
943012426 2:182466558-182466580 GTTTCCATCCTCACCTCTCCAGG - Intronic
943476668 2:188365973-188365995 GTTCCCATCATCATTTTATCTGG - Intronic
943542248 2:189231159-189231181 TTTCCCATCCTCCTAGCTCCTGG - Intergenic
943610760 2:190031115-190031137 GTACCCATCCTCCTGTCACCTGG - Intronic
944199551 2:197091293-197091315 GTTCCCATGCTCATTTGCTCAGG + Intronic
945538170 2:211046878-211046900 GCTCCCATCATCATTTAACCAGG - Intergenic
945656608 2:212631974-212631996 GATCCCATCATCATTGCTCAAGG - Intergenic
946561525 2:220919215-220919237 CTTCTCATCCTCTTTTCTCAAGG + Intergenic
947431627 2:230033619-230033641 GGTCCCATTCTCAATTCTCTAGG + Intergenic
947447955 2:230179233-230179255 GATCACATCCTCACTTCTCAGGG - Intronic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1172393929 20:34585697-34585719 CTTCCCATCCTGATCTCTCTAGG - Intronic
1172572347 20:35980505-35980527 GATCTCATCCTCTGTTCTCCAGG - Exonic
1172783593 20:37451597-37451619 TTTTTCCTCCTCATTTCTCCTGG + Intergenic
1178807427 21:35851168-35851190 GTTCCCACCCTCAATCCTCAGGG - Intronic
1180581796 22:16845343-16845365 CTTCTCATGCTCATTTTTCCTGG + Intergenic
1180825279 22:18857095-18857117 GTCCCCATCCATATTTCTCAAGG - Intronic
1181467562 22:23118388-23118410 GTGCCCATCCTGCTCTCTCCAGG - Intronic
1181554409 22:23659813-23659835 GTACCCGTCCTCATTTTTTCAGG - Intergenic
1182572362 22:31248786-31248808 GTTCCCCTCTCCATCTCTCCTGG + Intronic
1183581918 22:38731403-38731425 ATTCCCCTCCACATGTCTCCAGG - Exonic
1183784825 22:40023302-40023324 GGCCCCATCCCCATTCCTCCTGG + Intronic
1184750404 22:46482816-46482838 GTTCCCCTCCCCTGTTCTCCAGG - Intronic
1185379732 22:50502905-50502927 AATCCCATCCTCATGCCTCCTGG + Intergenic
1203215205 22_KI270731v1_random:2391-2413 GTCCCCATCCATATTTCTCAAGG + Intergenic
1203275428 22_KI270734v1_random:82998-83020 GTCCCCATCCATATTTCTCAAGG - Intergenic
951664803 3:25110842-25110864 TATCTCATCCTCATTTCTCAGGG + Intergenic
952661983 3:35862755-35862777 CTACTCATCCTCATTTCTTCAGG - Intergenic
952877023 3:37954656-37954678 CTCCAAATCCTCATTTCTCCAGG - Intronic
954409435 3:50364046-50364068 GTTTCCATCCTCAATGTTCCAGG + Intronic
954672073 3:52296576-52296598 CTTCCCACCTTCCTTTCTCCAGG + Intergenic
955389455 3:58510075-58510097 GTTCCCATTCTTCTTCCTCCTGG + Intronic
957480627 3:80788846-80788868 GTTCACATCATCAGTTCTTCTGG + Intergenic
958987098 3:100793965-100793987 TTACCCATCCTTGTTTCTCCAGG + Intronic
960253503 3:115484934-115484956 GTTCCCATCTTCAGTCTTCCAGG - Intergenic
960325670 3:116292731-116292753 GTTCCCAGCCTCATTTGCCATGG + Intronic
960338899 3:116451153-116451175 GTTCCCATCACCACATCTCCAGG - Intronic
963566012 3:146932164-146932186 GTTCAAATCCTTATTGCTCCAGG - Intergenic
963615773 3:147535778-147535800 GATCTCTTCCTCATTTCACCAGG - Intergenic
964483861 3:157167278-157167300 TCTCCCATCCTTATTTGTCCTGG + Intergenic
968488605 4:877407-877429 GATCCCATTCTCAAGTCTCCTGG + Intronic
969045182 4:4331456-4331478 GTTCCCATCCTCCTGTCAACCGG - Intergenic
969225466 4:5794920-5794942 GTTCCCATCCTTATATCTATAGG + Intronic
969236266 4:5867064-5867086 CTGCCCATACTCATTTCTCGGGG - Intronic
974687194 4:65245392-65245414 TTTCCCCTCCTCATATCTCCAGG - Intergenic
975110461 4:70617748-70617770 GTTCCATTCCACATTTCTCATGG + Intergenic
978379537 4:108112358-108112380 GTTCTGATCCTGGTTTCTCCAGG + Intronic
979815043 4:125090156-125090178 GTTCTCATCCTCAATTTTCTAGG + Intergenic
979848244 4:125544360-125544382 GTTATCAGCCTCATTTGTCCTGG - Intergenic
980455188 4:133030650-133030672 GTTTCTTTCCTCATTTCTCTAGG - Intergenic
981195495 4:141915503-141915525 GGTCTCATCCTCATTTTACCCGG - Intergenic
981630731 4:146815509-146815531 TCTCCAATCCTGATTTCTCCTGG - Intronic
982158244 4:152541318-152541340 GTACCCATCCTCATATGGCCAGG - Intergenic
985267979 4:188167646-188167668 GTGCCCATCCTCTCTCCTCCTGG - Intergenic
985707640 5:1410646-1410668 GTTGCCCTCCTCATTCCTCATGG + Intronic
985715795 5:1460336-1460358 GGTCCCACCTTCATTTCTCCTGG + Intronic
985804572 5:2032766-2032788 GATCCCACCCTCATTTATTCAGG + Intergenic
985975118 5:3413659-3413681 GTTACTATCCTCTTTTGTCCAGG - Intergenic
986395133 5:7321746-7321768 GTTCTGACCCTCATTTCTCAAGG + Intergenic
986573846 5:9192300-9192322 GTTACCCTGCTCATTTCTCAGGG + Intronic
987168490 5:15226214-15226236 ATTCCCATTCTCCTTTCCCCCGG + Intergenic
987711166 5:21501856-21501878 GTACCCGTCCTCATTTTTTCAGG + Intergenic
988748981 5:34175770-34175792 GTACCCGTCCTCATTTTTTCAGG - Intergenic
990322440 5:54643112-54643134 ATTCCCAACCTCGTTTCTCGTGG + Intergenic
991651903 5:68864120-68864142 GTTCTCACTCTCATTTCTGCAGG + Intergenic
991761509 5:69920897-69920919 GTACCCGTCCTCATTTTTTCAGG + Intergenic
991785820 5:70197203-70197225 GTACCCGTCCTCATTTTTTCAGG - Intergenic
991840737 5:70795946-70795968 GTACCCGTCCTCATTTTTTCAGG + Intergenic
991878265 5:71197594-71197616 GTACCCGTCCTCATTTTTTCAGG - Intergenic
993569400 5:89518407-89518429 GCTACCATCCTCATTACTTCAGG - Intergenic
995334507 5:110983922-110983944 GTTGACATCCCAATTTCTCCAGG + Intergenic
995565471 5:113429585-113429607 TTTCTCAACCTCTTTTCTCCAGG + Intronic
996513086 5:124339443-124339465 GTTCTCATCTTCATCTGTCCAGG - Intergenic
997451894 5:133990299-133990321 GTTGCCAGCCTCATTTCTTCAGG - Intronic
998376217 5:141692540-141692562 GTTCCCTTCCTGAATTCCCCAGG + Intergenic
998523196 5:142818841-142818863 GGTCCCCTCCACATTACTCCAGG - Intronic
1002776590 6:333169-333191 GTCTCTGTCCTCATTTCTCCTGG - Intronic
1003149981 6:3540326-3540348 CTTCCCCTCCCCATTTCTGCTGG + Intergenic
1003607622 6:7578265-7578287 TATCCCATTCTCATCTCTCCAGG - Intronic
1003848453 6:10197996-10198018 CTTCTCTACCTCATTTCTCCTGG + Intronic
1004546476 6:16603245-16603267 GTTACCATTCTCCTTTCCCCTGG + Intronic
1004681224 6:17896662-17896684 GTTCCCAGCCTTATTTTTGCTGG - Intronic
1005128127 6:22472121-22472143 GTTTGCATCCTCATTTGTCCTGG + Intergenic
1005546522 6:26878648-26878670 GTACCCGTCCTCATTTTTTCAGG - Intergenic
1008250788 6:49237589-49237611 GTTTCCATCTTTATTTCTCTGGG + Intergenic
1009017278 6:57919732-57919754 GTACCCGTCCTCATTTTTTCAGG - Intergenic
1010836074 6:80588666-80588688 TTTCCCCTGCTCATATCTCCTGG + Intergenic
1011764860 6:90610153-90610175 GATCCAAACCTCATTTCTACAGG + Intergenic
1012492300 6:99795580-99795602 CTTCCCATACTTGTTTCTCCTGG + Intergenic
1012888964 6:104877485-104877507 CTTCCCACCCTCAATGCTCCTGG - Intergenic
1014778637 6:125538340-125538362 GTGGCCATCCTCATTTCCGCTGG + Intergenic
1015084800 6:129277634-129277656 GATCCCATACTAAATTCTCCTGG + Intronic
1015718358 6:136214930-136214952 CTTCCCACCCCCAGTTCTCCAGG - Intergenic
1016828183 6:148407236-148407258 TTTCCCCTCCTCACATCTCCTGG + Intronic
1018419692 6:163630939-163630961 GCCCCCATCCTCCTCTCTCCGGG + Intergenic
1018419736 6:163631051-163631073 GTCCCCATCCTCCTCTCCCCTGG + Intergenic
1019436650 7:1025656-1025678 GTTACCAGCCCCATTCCTCCTGG - Intronic
1021154013 7:17186912-17186934 ATCCCCATCCTGATATCTCCTGG + Intergenic
1022368496 7:29748511-29748533 GTTTCTATCCTCACTTCTCCAGG + Intergenic
1024592011 7:50895256-50895278 GTTCCCACCCTCATTTCTTATGG + Intergenic
1025926462 7:65964271-65964293 GTACCCGTCCTCATTTTTTCAGG - Intronic
1026036220 7:66832352-66832374 GTTACGGTCCTCATTTCTGCAGG + Intergenic
1026377031 7:69762154-69762176 GTTCCTGTCCTGATTTCTCTGGG + Intronic
1026680855 7:72465539-72465561 TTTCCACTGCTCATTTCTCCTGG - Intergenic
1028382718 7:90216339-90216361 GATCCCCTCCCCAGTTCTCCAGG - Intronic
1029902583 7:104057649-104057671 ATTTCCATCATCATTTCTTCAGG - Intergenic
1031142248 7:117956284-117956306 GTTCCTATCCTGAATTCTCTAGG - Intergenic
1031268632 7:119615559-119615581 GTTACCATCCTCCTTCCTCAAGG + Intergenic
1033157888 7:138972032-138972054 GCTCCCATCCTCTTTTCTCCAGG - Intronic
1035557553 8:578138-578160 GTTCCTAGCCACATGTCTCCCGG - Intergenic
1035573764 8:690992-691014 GGTCCCATCCTTGCTTCTCCTGG + Intronic
1036382482 8:8246142-8246164 TTTCCCATCCTCTCTTCTCCTGG + Intergenic
1036408857 8:8479745-8479767 GTTACCATCCTCATTTTACAGGG + Intergenic
1037539386 8:19856493-19856515 ATTCCCACCCCCATTTCACCAGG - Intergenic
1040632128 8:49226602-49226624 GTTCTCTTCCTCTTTTTTCCAGG - Intergenic
1043318042 8:78945444-78945466 GTATCCATCATCATTTATCCAGG + Intergenic
1047141705 8:122148108-122148130 GTTCTCATCAGCATTTCTCTTGG + Intergenic
1048235287 8:132683752-132683774 GTACCCAGCATCTTTTCTCCTGG + Intergenic
1049471406 8:142776568-142776590 GTTCCCCTCCTCTCTGCTCCTGG + Intronic
1049886735 9:32222-32244 ATTTCCATCCTCCTCTCTCCAGG - Intergenic
1052448989 9:28602049-28602071 ACTCCCTTGCTCATTTCTCCAGG - Intronic
1053434544 9:38066731-38066753 ATTCCCTTCCTCCTCTCTCCTGG + Intronic
1056745152 9:89295288-89295310 GTTCCTATCCTCATTTTTTTTGG + Intergenic
1057392587 9:94652131-94652153 GTTCCCCTCCTGACTTCTCAGGG + Intergenic
1057926133 9:99151980-99152002 TCCCCCATCCCCATTTCTCCTGG - Exonic
1058077991 9:100669898-100669920 GTCCCCGTCCTCAATTTTCCTGG - Intergenic
1059360092 9:113735407-113735429 ATTTCCTTCCTCATTTCTCCAGG + Intergenic
1060917253 9:127398522-127398544 GTTCCTGTCCTGATTTCTCTTGG + Intronic
1061600204 9:131664221-131664243 CTTCCCTACCCCATTTCTCCAGG + Intronic
1186160470 X:6771993-6772015 GTTTCCATCCACATTTCACTTGG - Intergenic
1186677263 X:11831801-11831823 TTCCCCATCCTTATTTCTCTTGG - Intergenic
1188608322 X:32062016-32062038 TTTCTCATGCTGATTTCTCCAGG + Intronic
1188945061 X:36290540-36290562 GTTCTCATGCTCCGTTCTCCTGG + Intronic
1189367215 X:40398028-40398050 GCTCCAATCCTCTTCTCTCCTGG + Intergenic
1191786758 X:64924616-64924638 TTTCACATCCTCAGTTCTCAGGG - Intronic
1191937690 X:66442813-66442835 GTTCCCTTCCTCACTACTCTGGG + Intergenic
1192217961 X:69177145-69177167 CTTCCCATCATCTTTTCCCCAGG + Intergenic
1193130122 X:77910852-77910874 CTTCCCGTCGTCCTTTCTCCTGG + Intronic
1193729948 X:85090781-85090803 GTTCCCTTTCTCAATCCTCCAGG + Intronic
1195674475 X:107497407-107497429 GGCCCCCTCCCCATTTCTCCTGG + Intergenic
1198145495 X:133852331-133852353 ATTCCCATCCTCCTTTCTGGAGG - Intronic
1198466730 X:136910173-136910195 CTCCCCCTCCTCCTTTCTCCTGG + Intergenic
1198805830 X:140493447-140493469 CTTCCCATGCTCATTGCTACTGG + Intergenic
1199689084 X:150293481-150293503 ATTCACATGCTAATTTCTCCTGG + Intergenic
1199717278 X:150515659-150515681 GACCCTATCCTCATTCCTCCTGG + Intergenic
1200389446 X:155929482-155929504 GTCCCCATACTCATGTCTTCTGG + Intronic
1201726111 Y:17153812-17153834 CTTCCCCTCCTCCTTTCTCTCGG - Intergenic