ID: 1091089388

View in Genome Browser
Species Human (GRCh38)
Location 11:132755959-132755981
Sequence TCCAGCTGCTAGGAAAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091089385_1091089388 22 Left 1091089385 11:132755914-132755936 CCACACAGCAAGTGGCTGACAGC 0: 1
1: 0
2: 1
3: 23
4: 188
Right 1091089388 11:132755959-132755981 TCCAGCTGCTAGGAAAATGCAGG 0: 1
1: 0
2: 2
3: 20
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091089388 Original CRISPR TCCAGCTGCTAGGAAAATGC AGG Intronic
900838121 1:5022285-5022307 CTCAGCTGATAGAAAAATGCAGG - Intergenic
905805940 1:40877758-40877780 TCCATCTGCTGGGAAACAGCAGG - Intergenic
906408640 1:45561921-45561943 TGGGGCTGCTAGGAAAATGCAGG - Intronic
907700200 1:56778877-56778899 TCCAGCATCTAGAAAAATGGCGG + Intronic
907839212 1:58140355-58140377 TCCATCTGCTTGGCAAGTGCTGG + Intronic
908745226 1:67370230-67370252 GCCAGATGCTGGGAAAAGGCTGG - Intronic
909112163 1:71493174-71493196 GACATCTGCTAGGAAATTGCAGG - Intronic
911472091 1:98331652-98331674 TCCAGCTGGTATGATAATACTGG + Intergenic
912945703 1:114082299-114082321 TCCAGCTGCAAGGAAAAGGAAGG + Intergenic
913166662 1:116193485-116193507 TTAAGCTGCTAGGAAAATATGGG + Intergenic
914388832 1:147199411-147199433 TCCAGGTGTTAGAAAAAAGCTGG + Intronic
914799313 1:150948832-150948854 TCCAGCTGCTCGGAAGGCGCAGG - Intronic
916895408 1:169157270-169157292 TCCAGCTGCTAACATATTGCAGG - Intronic
917183458 1:172324286-172324308 TCCAGCTGGTTTGAATATGCCGG - Intronic
917564416 1:176197297-176197319 GCCAGCTACTAGGAAGATGAGGG + Intronic
918411695 1:184265633-184265655 TCCAGCTGCTTGGAAAACTGAGG + Intergenic
918587984 1:186209750-186209772 ACCAGAAGCTAGGAAAAGGCAGG + Intergenic
921698483 1:218239867-218239889 TCCAGGTTTTAGGAAAATGTGGG - Intergenic
924229652 1:241952924-241952946 CCCAGCTACTAGGAAACTGAGGG + Intergenic
1064155164 10:12897852-12897874 CTCAGCTGGAAGGAAAATGCTGG + Exonic
1065191215 10:23210759-23210781 GCTATCTGCTAGGAAAGTGCAGG + Intronic
1065740731 10:28794795-28794817 TGCTGCTAATAGGAAAATGCAGG - Intergenic
1069542639 10:69306941-69306963 TCCAGTGACTAGGAAAGTGCAGG + Intronic
1069842501 10:71348546-71348568 TCCAGCTGCTAGGAGAGGGTGGG + Intronic
1074938178 10:118207595-118207617 TCCAGCTTCCAGGGAAGTGCTGG - Intergenic
1075012693 10:118888330-118888352 TCCAGCTCCTGGCACAATGCTGG + Intergenic
1075150680 10:119927450-119927472 TCGAGCTGCTAGGGATTTGCTGG + Intronic
1075784486 10:125039751-125039773 TCCAGCTGCAAGGAAGGTTCAGG - Intronic
1078292732 11:10029774-10029796 TCCAGCCGCTGGGACAAGGCAGG + Exonic
1080418360 11:32090454-32090476 TCCAGCTGCCAGGGGAACGCAGG - Intronic
1083413012 11:62506606-62506628 CCCTGCAGCTAGGAAAATGCAGG - Intronic
1086532572 11:87803189-87803211 ACCAGCAGCTAGGAAGAAGCAGG - Intergenic
1087019770 11:93590314-93590336 TCCATATGCAGGGAAAATGCTGG + Intergenic
1087159426 11:94934624-94934646 TCCAGCTGCTAAGAAAACCCAGG + Intergenic
1089806562 11:121095861-121095883 TCCAGTGGCCAGGAACATGCTGG - Intergenic
1091089388 11:132755959-132755981 TCCAGCTGCTAGGAAAATGCAGG + Intronic
1091179278 11:133588921-133588943 TCCAGATGCAAGGAAAGTGGAGG - Intergenic
1091790104 12:3267244-3267266 TCAAACTCCTTGGAAAATGCAGG - Intronic
1093661397 12:21761437-21761459 TTCAGCTGCTGGGAAACTGTCGG + Intergenic
1096633833 12:52946151-52946173 CCCAACTGCTAGGAAACTTCTGG - Intronic
1099133917 12:78869226-78869248 ACCAGCTGAAAGAAAAATGCTGG - Intronic
1101964421 12:109272735-109272757 TACTGCTGCTATGAAAATGGGGG + Intergenic
1106696963 13:32185044-32185066 TTCAGCTTCTAGGAGCATGCGGG - Exonic
1109758967 13:66800894-66800916 TCAAGCAGCTAGAAAAATGCTGG + Intronic
1111414210 13:87917697-87917719 TCCAGCTGCTGGTAATATGAAGG - Intergenic
1111544506 13:89713701-89713723 ACCATCTGCTGGGAACATGCTGG - Intergenic
1111732720 13:92097284-92097306 TGCTGCTTCTAGTAAAATGCAGG + Intronic
1113176334 13:107568395-107568417 TACAGCTGCTATGAACATTCAGG + Intronic
1120513090 14:85438896-85438918 CCCAGCTGCTAGAAATGTGCTGG + Intergenic
1122070206 14:99201076-99201098 TCCTGCTCTTAGGAAAATGCTGG - Intronic
1125794866 15:42396782-42396804 TCCATCTGGTGGGAAAATGGAGG - Exonic
1125831103 15:42717767-42717789 TTCAGCTGCCAGGCAACTGCTGG + Exonic
1127501048 15:59554485-59554507 TCCAGCTGTCAGGAAAGTTCAGG - Intergenic
1128675321 15:69604164-69604186 TCCACCTACTGGGAAGATGCAGG - Intergenic
1129955194 15:79630027-79630049 TCAATCTGCCAGGAACATGCAGG - Intergenic
1133557005 16:6915207-6915229 TCCAGCTGCTAGGAGAACAAGGG - Intronic
1134343625 16:13368595-13368617 TCCAGCTGATGGTAAAATGATGG + Intergenic
1134808460 16:17145978-17146000 TCCAGGTCCTAGGACAGTGCAGG + Intronic
1134819800 16:17237740-17237762 GCCATCTGCTGGCAAAATGCAGG + Intronic
1135331707 16:21565835-21565857 TTCTGCTGCTAAGCAAATGCTGG + Intergenic
1136004328 16:27318345-27318367 TCCACCTGATAGGATATTGCAGG - Intronic
1137572877 16:49578264-49578286 TCCAGCTGCTATGGATAGGCTGG - Intronic
1137899917 16:52256364-52256386 TCCAGAAGCAAAGAAAATGCTGG - Intergenic
1140267704 16:73434741-73434763 TCCAGTTGCTGGGACAATGGTGG + Intergenic
1142533897 17:599985-600007 GTCAGGTGCTGGGAAAATGCTGG - Intronic
1147556784 17:41484681-41484703 TCCAGCTCCAAGGACACTGCTGG + Intergenic
1148469830 17:47885959-47885981 ACCAGCTGCTTGAAAAAGGCAGG + Intergenic
1150579028 17:66455439-66455461 TGGAGCTGCCAGGAAAATGATGG + Intronic
1150934421 17:69619653-69619675 ATCACCTGCTAGGGAAATGCAGG + Intergenic
1152524444 17:80879461-80879483 TCCTGCTGCTAGGAAATGGCAGG - Intronic
1154008761 18:10558150-10558172 GCCAGGTGCTTGGAAAATTCTGG - Intergenic
1155334037 18:24746909-24746931 TCCAGGTGCTAGGAACATTGTGG + Intergenic
1156128044 18:33931969-33931991 TCCAGATGGTAAGAAACTGCTGG - Intronic
1156185060 18:34652871-34652893 TGCAGCTCCTAGGTTAATGCAGG - Intronic
1156399061 18:36724548-36724570 TCCAGCTTCTAGGAAGATGCAGG - Intronic
1160072067 18:75637492-75637514 TCAAGCAGTTAGGAAAACGCTGG - Intergenic
1160612224 18:80097300-80097322 TCCAGCTTCAAGGAATATGGGGG - Intergenic
1161369924 19:3905357-3905379 TCCACCAGGTAGGAAAATGGGGG + Intronic
1161421169 19:4176663-4176685 ACCAGCAGCCAGGAAAAGGCAGG + Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166919280 19:46217888-46217910 TACAGCTGATTGGAAAATGCTGG + Intergenic
1168682368 19:58325390-58325412 TCCAGCTGCTAGCAGTCTGCAGG + Intergenic
925703243 2:6659715-6659737 TGACGCTGCCAGGAAAATGCTGG - Intergenic
925789452 2:7469183-7469205 TCCAGGTGCCAGAAAATTGCAGG - Intergenic
926707883 2:15849495-15849517 CCCAGCTGCTAGGAAGGTCCTGG - Intergenic
929239755 2:39642186-39642208 TCCACCTCCTGGGAAAATGCTGG - Intergenic
930199776 2:48541787-48541809 TCCTGCTACTAAGAGAATGCGGG + Intronic
931257208 2:60584125-60584147 CCCCACTGCTAGGGAAATGCTGG - Intergenic
931668673 2:64627623-64627645 TCCAGTTCCAAGGACAATGCGGG + Intergenic
932134742 2:69218474-69218496 TCAAACTGCTTGGAAAATGCAGG + Intronic
932803554 2:74764163-74764185 TCAGGCTGCCAGGAAAATGAGGG + Intergenic
932803588 2:74764325-74764347 TCAGGCTGCCAGGAAAATGAGGG + Intergenic
936077239 2:109409375-109409397 TCCAGCTGCTCTGATACTGCAGG - Intronic
940111106 2:150154969-150154991 TCCAGCAGCTAGGAGGAGGCAGG + Intergenic
942415570 2:175755459-175755481 TCTAGCTGAAAGGAAAGTGCAGG - Intergenic
945446314 2:209942112-209942134 TCCAGCTCCTATGAAAATCTAGG - Intronic
946651516 2:221896743-221896765 TCAAGCTGCTGGGAAATTGTGGG + Intergenic
946730192 2:222702004-222702026 TCCAGGTGCTAGGCAAATGCAGG + Intronic
947105464 2:226663722-226663744 CCCAGCTGCCAGGAAGCTGCAGG - Intergenic
947299263 2:228669942-228669964 TCCAGCTGTTGGTAGAATGCAGG - Intergenic
948067507 2:235092194-235092216 GCCACCTTCTAGGCAAATGCCGG - Intergenic
1170102364 20:12716384-12716406 ACCAGAAGCTAGGAAAATGCAGG + Intergenic
1172855074 20:37995451-37995473 TCTAGAAGCTAGGAAGATGCAGG + Intronic
1173026367 20:39310962-39310984 TCCTGCTGCTCGGAAAGTCCTGG + Intergenic
1173726956 20:45304940-45304962 CCCAGGTGCTAGGCACATGCCGG - Intronic
1178101925 21:29278979-29279001 TCCCACTGCTAGGGAAATGAGGG + Intronic
1178112428 21:29381979-29382001 TCCAGCTGTCAGGAACATGTCGG - Intronic
1178702570 21:34845750-34845772 TGCAGCTGCTGAGAAAATGAAGG - Intronic
1181891179 22:26064998-26065020 TCAAGCTGGTAGGAAAAAGCTGG - Intergenic
1182063102 22:27411865-27411887 CCCAGCTACTTGGAAAATGGAGG + Intergenic
1183699888 22:39445328-39445350 TCCAGCTCCTAGGAGGATTCAGG - Intergenic
950028785 3:9838238-9838260 CTCAGCTGCTTGGAAAATGTGGG - Intronic
950682209 3:14593117-14593139 CCCAGCGGCTGGGAAAATCCAGG - Intergenic
959427992 3:106217282-106217304 TACAGCTGCTATGAACATCCAGG + Intergenic
959860148 3:111207241-111207263 TCCATCTGCCAGGGAAATTCTGG + Intronic
960525565 3:118705800-118705822 GCCAGCTGTTAGGAAGATGCTGG + Intergenic
961341711 3:126227559-126227581 GGGAGCTGCTAGGAAAATCCTGG + Intergenic
961796199 3:129410865-129410887 TCCAGCTGTGATGAAAATGCAGG + Intronic
962179419 3:133190063-133190085 TTCATCTGCCAGGAAAAGGCTGG + Intronic
962563131 3:136629224-136629246 TCCTGCTGCTAGGACACTGTTGG - Intronic
966602902 3:181793367-181793389 CCCAGGTGCTACGAAAATACCGG - Intergenic
969035381 4:4249195-4249217 TGCAGCTGCTCAGAAAATGTTGG - Intergenic
969428863 4:7141283-7141305 TCCAGCTTGAAGGAAAAGGCTGG + Intergenic
969477968 4:7432012-7432034 GCCAGCTGCAAGGACACTGCAGG + Intronic
970378864 4:15484977-15484999 GTCAGCTGATTGGAAAATGCCGG - Intronic
970768240 4:19577423-19577445 GCCATCTGGTAGGAATATGCTGG - Intergenic
973784806 4:54324711-54324733 TCCAGCTGTTAGCAGAATTCCGG - Intergenic
975251830 4:72189060-72189082 TCCAGCTCCTTGGATAAAGCAGG + Intergenic
977265836 4:94852903-94852925 TCCAGCTACAAGAAAAATTCTGG + Intronic
978296838 4:107215273-107215295 TCAAGCTGCTAGGAAGAAGTGGG + Intronic
981392983 4:144214136-144214158 TCCAGGTGTTAGAAAAATGGTGG + Intergenic
981847587 4:149187242-149187264 ACCAGCAGCTAGGAAGAGGCAGG - Intergenic
982107592 4:152024296-152024318 TCCAGCAGCTAGGAAGAAGATGG - Intergenic
983039048 4:162902662-162902684 TCCAGCTCCAAGGAAAATCTTGG + Intergenic
985590280 5:761003-761025 AGCAGCTGCCAGGAAAAGGCAGG + Intronic
986790486 5:11154799-11154821 ACCAGCAGCTAGGAAGAGGCAGG - Intronic
986899727 5:12416782-12416804 TCCACCTTCTATTAAAATGCTGG - Intergenic
988382920 5:30522295-30522317 TCCTGCTGCTAGTTAAATGAAGG + Intergenic
988699750 5:33661677-33661699 TGCATCTGCTGGCAAAATGCAGG - Intronic
989131969 5:38115629-38115651 TCAAGGTGCCAGGAAACTGCTGG + Intergenic
990179973 5:53149872-53149894 TCCAGCTGATAGGAAAATAAAGG - Intergenic
990897763 5:60717345-60717367 CCCACCTGCTAGGAAATTGGAGG + Intergenic
990930697 5:61087703-61087725 TAAAGCTGCTGGGAAAATTCCGG - Intronic
993797067 5:92281121-92281143 TGCAACTGCTACAAAAATGCGGG - Intergenic
995006466 5:107202058-107202080 TTCATCTCCTAGGACAATGCTGG - Intergenic
996247288 5:121280423-121280445 TCCACCTGACAGGAACATGCAGG - Intergenic
996394097 5:122995249-122995271 TCCAGCAGCTTTGAAAATGCTGG + Intronic
998400714 5:141847501-141847523 TCCAGATACAAGGAAACTGCAGG - Intergenic
999495682 5:152094536-152094558 TCTAGGTGCTTGGAAAATGCTGG - Intergenic
999969340 5:156843571-156843593 TACAGCTGCTAAGAAAAAGGGGG + Intergenic
1000030093 5:157394068-157394090 TTCAGCTTCTAGGACAATGAAGG - Intronic
1000485231 5:161833490-161833512 TCCAGCAGTTATGAAACTGCAGG - Intergenic
1001179046 5:169501440-169501462 TCCAGTGGCTAGGCAACTGCAGG + Intergenic
1003749194 6:9037674-9037696 TCCAGATGGAAGGGAAATGCTGG - Intergenic
1004467168 6:15896940-15896962 TTCAGCTGCAAAGGAAATGCAGG + Intergenic
1004515751 6:16321144-16321166 GTTAGCTGCTTGGAAAATGCAGG - Intronic
1008411556 6:51186372-51186394 TCCATATGATAGGAAAATTCAGG - Intergenic
1010625257 6:78131019-78131041 TGGAGCAGCCAGGAAAATGCTGG + Intergenic
1012018862 6:93890266-93890288 TCCAGGTGGTTTGAAAATGCTGG + Intergenic
1015294044 6:131570080-131570102 TCCAGCAGCTAGGAAGAGGTAGG + Intergenic
1015592735 6:134838042-134838064 TACAGATGCTGGGAAAATTCAGG + Intergenic
1016392150 6:143585321-143585343 TCCAGCTACCAGGAAGAGGCTGG + Intronic
1017061364 6:150488086-150488108 CCCAGAAGCTAGGAAAAGGCAGG - Intergenic
1017331457 6:153202680-153202702 TCCAGCTTCTAGCAGAAAGCAGG - Intergenic
1018127510 6:160695942-160695964 CTCAGCTGATAGAAAAATGCAGG - Intergenic
1018149009 6:160921083-160921105 CTCAGCTGATAGAAAAATGCAGG + Intergenic
1018349449 6:162941540-162941562 TCCTCCTGCCAGGAAAATGCAGG - Intronic
1019345103 7:525851-525873 TGCAGCTGCCAGGAACCTGCTGG - Intergenic
1019655002 7:2187582-2187604 TCCAGCTGCTCGGAAAGTTGAGG - Intronic
1020247967 7:6445048-6445070 TACAGCTGCTTGGAAAAGTCTGG + Intronic
1021137154 7:16979321-16979343 TCCAGCTGCCTGGAAGATGGAGG - Intergenic
1021261380 7:18461515-18461537 TACAGCTGCTAACAAAATGAGGG - Intronic
1023086147 7:36571652-36571674 TCCCTCTGCAAGGAAAAAGCTGG - Intronic
1023670927 7:42575761-42575783 GCCAGCTGCTGAGAAAATACAGG + Intergenic
1026302993 7:69115210-69115232 TCAAGCACCTAGCAAAATGCTGG - Intergenic
1026399532 7:69995596-69995618 TCCTGCTGCTGGGATACTGCTGG - Intronic
1028235152 7:88352236-88352258 TCTAGATGTTATGAAAATGCAGG + Intergenic
1029565057 7:101331228-101331250 TCCAGCTACTTGGAAGATGGAGG + Intergenic
1030222897 7:107116215-107116237 TCTAGGTGCTAGGAAAATAGAGG + Intronic
1030608506 7:111664035-111664057 ATCAACTGCTGGGAAAATGCTGG - Intergenic
1034487134 7:151373076-151373098 TCCTGCTGTGGGGAAAATGCAGG + Intronic
1036588619 8:10147756-10147778 CACAGATGCTAGGAGAATGCAGG - Intronic
1037757061 8:21717743-21717765 TCCAGATCCTAGGAACTTGCAGG + Intronic
1038850291 8:31268985-31269007 CCCAGCAGCTGGGAAAATGAGGG - Intergenic
1039756915 8:40533368-40533390 TCCAGCTGAAAGGAAGCTGCTGG + Intronic
1040982218 8:53255471-53255493 TCAAGCTGATGAGAAAATGCTGG + Intergenic
1041830413 8:62147289-62147311 CCCAGATGCTAGGAAAGCGCAGG + Intergenic
1042049736 8:64690549-64690571 TGGACCTGCTAAGAAAATGCTGG + Intronic
1045325948 8:101117925-101117947 CCCATCTGCCAGGGAAATGCTGG - Intergenic
1047818462 8:128491430-128491452 TCCAGCATAAAGGAAAATGCAGG - Intergenic
1049793405 8:144483940-144483962 TCCAACTTCTAGGAATGTGCTGG + Intronic
1050220082 9:3377684-3377706 TCCAAATTCTAGGAAAATACTGG - Intronic
1051598635 9:18850188-18850210 TCCTGCTGCCAGGAAAGGGCAGG - Intronic
1052614226 9:30817533-30817555 GCCAGCTGCTAGGAAAAGATGGG - Intergenic
1057870736 9:98715071-98715093 TGCAGCTGCTAGCAAAATGTGGG - Intergenic
1060739944 9:126091432-126091454 TTAAGCTGGTGGGAAAATGCAGG + Intergenic
1060814470 9:126627368-126627390 TCCAGCTGGCAGGAAGAAGCAGG - Intronic
1061320741 9:129827416-129827438 TCCAGCTGACAGAAAAATCCAGG - Exonic
1186140657 X:6568375-6568397 TATAGATGCTAGTAAAATGCAGG + Intergenic
1187710176 X:22045446-22045468 TCCAGCTGCCATGCAATTGCTGG - Intronic
1189140439 X:38599685-38599707 TCCTGCTGCCAAGAAAATGTAGG - Intronic
1192487868 X:71546073-71546095 TCCATCTACTAGGAATATGCTGG - Intronic
1193789450 X:85800605-85800627 TGCAGCTACTACAAAAATGCTGG + Intergenic