ID: 1091094305

View in Genome Browser
Species Human (GRCh38)
Location 11:132804445-132804467
Sequence ACTGCTTGTCTTGCTCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091094305 Original CRISPR ACTGCTTGTCTTGCTCAGTG GGG (reversed) Intronic
900280226 1:1862402-1862424 ACTGATTGTCTCACTCAGTGTGG - Intronic
900883608 1:5400284-5400306 ACTACTTGTCCTCTTCAGTGGGG - Intergenic
902823912 1:18959623-18959645 GCTGCGTGTCTTGCTCTTTGTGG + Intergenic
903365027 1:22801015-22801037 CCTGCTTGTCGTGCTCAGGTGGG + Intronic
903380483 1:22893299-22893321 AATGCATGACTTGCTCAGAGTGG - Intronic
904466291 1:30709744-30709766 ATTGCTGTTCTTGCTCACTGAGG - Intergenic
905501787 1:38445357-38445379 ACTGCGTGTCTCCCTCTGTGGGG - Intergenic
907983914 1:59511596-59511618 ATTGATTGTCTTGCTTTGTGTGG - Intronic
908452029 1:64265172-64265194 ACTGCTTGCTTTGCTAACTGAGG - Intronic
909486935 1:76184787-76184809 TCTGTTTGTCTGGGTCAGTGGGG + Intronic
909547048 1:76859671-76859693 TCGGCTTGTCTTCCTCAGTGAGG + Intergenic
910152159 1:84162820-84162842 ACTGCTTTTTTTCCTCATTGTGG + Intronic
910181169 1:84484960-84484982 ACTTCTGGTCTGGCTAAGTGCGG - Intronic
910508079 1:87972958-87972980 ACAGCTTGAGTTGCTCAGAGGGG + Intergenic
911395613 1:97304532-97304554 AATGCTTTTCTTGAACAGTGGGG + Intronic
912334735 1:108851609-108851631 ACTGCTTATCTCTTTCAGTGTGG - Intronic
919038070 1:192341867-192341889 ACTTTTTGTTTTGCTCAGGGGGG - Intronic
919069211 1:192732863-192732885 ACTGCTTATCTTAGTCAGTTTGG + Intergenic
923014195 1:230113208-230113230 GCTGCCTGACTTGCTCTGTGTGG + Intronic
923794752 1:237142915-237142937 AATGCATGTCTTTCCCAGTGGGG - Intronic
924034804 1:239925023-239925045 ACTGCTGGCCTTGGACAGTGAGG - Intergenic
924168591 1:241312390-241312412 ACTGATGGCCTTGCTCAGTGCGG - Intronic
1064816412 10:19270022-19270044 ACTGCTGGTTTTGCTGAGTGTGG + Intronic
1065874139 10:29982706-29982728 ATGGCCTGTCTTGCTCAATGAGG + Intergenic
1066388658 10:34961616-34961638 AATTCATGTCTTGCTGAGTGTGG + Intergenic
1074901459 10:117819500-117819522 CCTGCATGTCATTCTCAGTGGGG + Intergenic
1075667740 10:124243097-124243119 ACTGCTCTTCTGGGTCAGTGGGG - Intergenic
1081275764 11:41147483-41147505 ACTGCTTTTCTTCCTTAGTCTGG + Intronic
1088440130 11:109861143-109861165 ATTTCTTGTCTAGTTCAGTGTGG - Intergenic
1089574868 11:119434887-119434909 CCTGCTTGTCTAGCCCATTGTGG + Intergenic
1091094305 11:132804445-132804467 ACTGCTTGTCTTGCTCAGTGGGG - Intronic
1096956314 12:55529712-55529734 CCTACTTGGCTTTCTCAGTGGGG + Intergenic
1100168053 12:91940692-91940714 ACTGCTAGTTTTGTTCACTGTGG + Intergenic
1102745450 12:115245084-115245106 ACTGTTTGTCTTCCTATGTGAGG + Intergenic
1103481204 12:121250726-121250748 TCTGGCTGTCTTGCTCACTGCGG + Intronic
1104881255 12:132072154-132072176 CCTGCTTGTGTTGCCCAGGGTGG + Intronic
1107988635 13:45797728-45797750 ACTGCTTGCCCTTCACAGTGAGG - Intronic
1108124609 13:47228387-47228409 ATTTCTTGTCCTGCTCAATGTGG + Intergenic
1109077698 13:57858734-57858756 ACTCCTTGTCATTCTCTGTGAGG + Intergenic
1109704780 13:66076196-66076218 ACTGCTACTCTTGCTTAGAGAGG - Intergenic
1118259735 14:64235760-64235782 CCTGCATGCGTTGCTCAGTGAGG - Intronic
1119459143 14:74783904-74783926 ACTGCGTAACTTGCTCAGTCAGG + Intronic
1123504371 15:20924928-20924950 ACAGCTATTCTTGCTTAGTGTGG + Intergenic
1123561617 15:21498629-21498651 ACAGCTATTCTTGCTTAGTGTGG + Intergenic
1123597861 15:21935910-21935932 ACAGCTATTCTTGCTTAGTGTGG + Intergenic
1128944870 15:71813330-71813352 ACAGCTTCTCTGGCTCAGTCTGG - Intronic
1129792544 15:78350927-78350949 ACTACTTGCCTTGCCCTGTGTGG - Intergenic
1130647397 15:85741138-85741160 GCTGCTTCTCCTGCTCAATGAGG - Exonic
1202969962 15_KI270727v1_random:225754-225776 ACAGCTATTCTTGCTTAGTGTGG + Intergenic
1133235126 16:4384151-4384173 CCAGCTTGTCCTGCTCACTGGGG - Intronic
1134910269 16:18019463-18019485 AGTGCTTGTCTTTCTGGGTGAGG + Intergenic
1138848054 16:60591407-60591429 ACTGCTGGCTTTGCTCAGAGAGG + Intergenic
1139761807 16:69189951-69189973 ACTGCTTGTCTTGTACAAAGTGG - Intronic
1139877669 16:70159329-70159351 ACTGCTTGTCTTGCTAGGAGAGG + Exonic
1140175728 16:72657833-72657855 ACTGCTAGGCTTGCTTGGTGGGG - Intergenic
1144045600 17:11452021-11452043 ACTGCTTGACAAGGTCAGTGGGG + Intronic
1145027868 17:19482387-19482409 TCTGCTTGCCTGGCACAGTGAGG - Intergenic
1145217945 17:21066312-21066334 ACTGAAAGTCTTGCTCTGTGAGG + Intergenic
1145284504 17:21495369-21495391 GCTGCTTGTCCTGCTTAGTTTGG + Intergenic
1145911874 17:28547845-28547867 CCTCCTTTTCTTGCTCAGGGTGG - Exonic
1146243685 17:31257311-31257333 ACAGCTATTCTTGCTTAGTGCGG - Intronic
1148100938 17:45090931-45090953 TCTGCTTGTCCTGCTCTGTGGGG - Intronic
1148580158 17:48738190-48738212 ACTGCTGGTCTAGCTCTGTGAGG + Intergenic
1150954614 17:69843479-69843501 ACTGTTTGTTTTGTTCAGTAGGG - Intergenic
1151484343 17:74389213-74389235 AATGGTTGTTCTGCTCAGTGGGG + Intergenic
1153323319 18:3793980-3794002 ACTGCCTGTTTTGTTCACTGTGG + Intronic
1156465960 18:37347981-37348003 CCTGCTTGTGTTTCTCAGGGTGG - Intronic
1157674438 18:49558646-49558668 ACCGCATGTCTTGGTCAGTTTGG - Intergenic
1159726893 18:71972007-71972029 ACTCCTTCTCTTGCTGTGTGAGG - Intergenic
1161439637 19:4283467-4283489 CCTACTTATCCTGCTCAGTGTGG + Intronic
1164653666 19:29904085-29904107 TCTGTTTGTCTTGATCAGTCTGG + Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166322047 19:42024594-42024616 CTTGCCTGTCTGGCTCAGTGAGG + Intronic
932713965 2:74088149-74088171 ACTGTTTGTCCTGCACAGTTAGG + Intronic
935128233 2:100242515-100242537 ACAGCTGTTCTTGCTCTGTGGGG - Intergenic
935707161 2:105866867-105866889 AGTGCTTGGGATGCTCAGTGTGG + Intronic
940347476 2:152642601-152642623 GCTCCTGGTCTTGCTCAGGGTGG - Intronic
940445182 2:153769257-153769279 ACTACTTGACTGGCTCAGAGAGG - Intergenic
942771235 2:179523820-179523842 ACTTATTGTGTTGCTCAGTCTGG + Intronic
943237644 2:185343162-185343184 AGTGCTTTTCTTTCCCAGTGTGG + Intergenic
943924869 2:193762035-193762057 ACTGCTTGTCTTAATCCTTGGGG - Intergenic
944840673 2:203620940-203620962 GCTGCTAGCCTTGCTCACTGTGG + Intergenic
1169803486 20:9535416-9535438 ACTGATTTTCCTGCACAGTGTGG + Intergenic
1170533209 20:17315200-17315222 ACTGCCTGACTCTCTCAGTGTGG + Intronic
1172202936 20:33139578-33139600 TCTGGTTGTCTTGGTCAGTCTGG + Intergenic
1176030983 20:63011516-63011538 CCAGATTGTCTTCCTCAGTGGGG - Intergenic
1177870439 21:26566347-26566369 GATGATTGCCTTGCTCAGTGTGG - Exonic
1179489749 21:41733720-41733742 AATGCTTGTTTAGCTCATTGTGG + Intergenic
1183069498 22:35386443-35386465 GCTGCTTGTTTTGCCCAGTGGGG + Intronic
1183313602 22:37124978-37125000 ACTGTGTGTCATGCCCAGTGTGG - Intergenic
1183705261 22:39471839-39471861 TTTGCTTGTCTTGCTCAGGGTGG - Intronic
1184791542 22:46703364-46703386 ACTGCTTGTCTTGCTGGCTGGGG - Intronic
951731154 3:25811799-25811821 AATGCTTGTAATGCTCAGTGAGG + Intergenic
951822771 3:26831580-26831602 CCTGCTTCTCTTCCTCACTGAGG - Intergenic
958809543 3:98844732-98844754 ACTGCTGGTGTTACTGAGTGAGG - Intronic
959911037 3:111763945-111763967 ACTGCTTGTCTTCGTCTGTTCGG - Intronic
960395947 3:117137790-117137812 CCTGCTTTTCTTTGTCAGTGTGG + Intronic
961348157 3:126278354-126278376 ACTGCCCGTCCTGCTCCGTGAGG + Intergenic
961466333 3:127084186-127084208 ACTGCTTGTCTTGGTGAGGCTGG + Intergenic
962117055 3:132521631-132521653 AATGCTTGACCTGCTCACTGTGG - Intronic
964203412 3:154143897-154143919 ACTGCATCTCTTGCTCATTTGGG + Intronic
967977720 3:195044740-195044762 AGGGCTTGTCCTGCTCACTGCGG - Intergenic
970618795 4:17795896-17795918 ACTGCTTGTCTTTTTCGGTCAGG + Intergenic
972682900 4:41324256-41324278 AGTGATTGACTTGCTGAGTGTGG + Intergenic
973742898 4:53935395-53935417 GCTGATTGACTGGCTCAGTGTGG + Intronic
975121356 4:70731855-70731877 ACTGCTTTTCAGGCTAAGTGCGG - Intronic
975743407 4:77452693-77452715 ACTACCTGTGTTGCTGAGTGTGG - Intergenic
979406616 4:120319415-120319437 ACTACTCATTTTGCTCAGTGGGG + Intergenic
982275543 4:153633805-153633827 AATGCTGGTCTTGCTCTGAGTGG + Intronic
982348893 4:154392850-154392872 GCTGCTTCTCTTGATCAGTTAGG + Intronic
983850808 4:172578310-172578332 ACTGCATGTCTAAATCAGTGTGG - Intronic
984213280 4:176877003-176877025 TCTCCTTGTCTTCCTAAGTGGGG + Intergenic
989768573 5:45115693-45115715 CCTGCTGCTCTTGCTCAGTGAGG + Intergenic
992556780 5:77911678-77911700 ACTGCCTGTCTTCTTCATTGTGG + Intergenic
997466516 5:134091541-134091563 TGTGCTTTTCTTGCTCATTGTGG - Intergenic
999294617 5:150450856-150450878 ACCGCTTGCCTAGCTCTGTGAGG - Intergenic
999356997 5:150944699-150944721 AGAGCTTGTCTTACTCAGTTTGG - Intergenic
1000013514 5:157256660-157256682 ACTCCCTGTCTTGCTGAATGAGG - Intergenic
1000294409 5:159900709-159900731 CCAGCTGGGCTTGCTCAGTGGGG - Intergenic
1001922121 5:175609076-175609098 ACTGCTTTACCTGCTCTGTGTGG + Intergenic
1005080667 6:21953539-21953561 GCTGCTTGTCTTACACAGTTGGG - Intergenic
1008461886 6:51785072-51785094 ACTGAATGTCTTGTTCACTGTGG + Intronic
1010185013 6:73134124-73134146 ACTGCTTATCTTCCTTAGAGAGG + Intronic
1018563682 6:165128933-165128955 CCTGCTTGTCTTCTTCAGGGAGG - Intergenic
1018765516 6:166929731-166929753 GCTGCTGGTCTTGCTTAGTGAGG + Exonic
1018877703 6:167839977-167839999 AGTGCTCCTCTTGCTCAGCGCGG - Intronic
1019060504 6:169254471-169254493 TCTGCTTCATTTGCTCAGTGAGG + Intergenic
1019267512 7:126659-126681 ACTGCTTCTGTTGGTCAGAGTGG - Intergenic
1019279934 7:194433-194455 TCTGCTTGTTTTGATCTGTGTGG - Intronic
1022406291 7:30093371-30093393 GTTGCTTGTCTTGCTCAAGGTGG + Intronic
1024307313 7:47939682-47939704 CCTGCTTAACTTGCGCAGTGTGG - Intronic
1025106675 7:56176222-56176244 GCTACTGGCCTTGCTCAGTGAGG - Intergenic
1026708042 7:72712279-72712301 ACTGCTTGTATGGCTCTGAGAGG - Intronic
1027666764 7:81049626-81049648 ACTGCTAGTTTTACTCAGTCAGG + Intergenic
1030716303 7:112811734-112811756 ACTGATTTTCTTGCTCAATATGG + Intergenic
1031656195 7:124359381-124359403 TGTGCTTGTCTTGCTCAGTTTGG + Intergenic
1032319129 7:130868697-130868719 ACAGCTTTCCTTGGTCAGTGAGG - Intergenic
1034705950 7:153144631-153144653 ACTGCTATGCTCGCTCAGTGTGG - Intergenic
1040276826 8:46018128-46018150 AGTGCATGTCTTGCCCATTGGGG - Intergenic
1040277674 8:46022236-46022258 GCTGCATGTCTTGCAAAGTGAGG - Intergenic
1043672635 8:82906769-82906791 ACTTCTTATCTTACTCTGTGAGG + Intergenic
1044830766 8:96245557-96245579 ACTGCTTCTGTTGCCCAGTGTGG - Intronic
1045155193 8:99460771-99460793 ACTGATAGTGTTGCTGAGTGTGG + Intronic
1049358396 8:142199964-142199986 ACAGCCTGTCCTGCTGAGTGGGG + Intergenic
1049624485 8:143613895-143613917 ACTGCTGTCCTTGTTCAGTGGGG + Intronic
1050461674 9:5882692-5882714 AACCCTTGTCTTCCTCAGTGTGG + Intronic
1050946900 9:11534269-11534291 ACGGCTGGTCTGGCTCAGTCAGG - Intergenic
1054793262 9:69275528-69275550 ACTCCTTGTCATACTCACTGTGG - Intergenic
1056033901 9:82583879-82583901 AATTCATGTCTTGGTCAGTGGGG + Intergenic
1056933061 9:90894383-90894405 ACTGCTCGAATTGATCAGTGTGG - Intronic
1060407495 9:123380029-123380051 ACTGCTGCACATGCTCAGTGAGG - Exonic
1061709812 9:132479977-132479999 TCTGCTTCTCCTGCTCAGGGAGG - Intronic
1189585820 X:42460866-42460888 ACTGTCTGTCTTGCTCAGTGTGG - Intergenic
1192248506 X:69392126-69392148 GCTGCTGGTCTGCCTCAGTGAGG + Intergenic
1197738262 X:129869410-129869432 ACTGATTGCCTTCCTCAGTGTGG - Intergenic
1197978893 X:132194990-132195012 CCTGGTTGTCTTCCCCAGTGTGG + Intergenic
1199320326 X:146430516-146430538 TCTCCTTTTCTTGCTCACTGCGG + Intergenic
1200416892 Y:2921438-2921460 TTGGCCTGTCTTGCTCAGTGGGG + Intronic
1201892519 Y:18958215-18958237 ACTGCTTGTCTTGCTAATTTGGG - Intergenic