ID: 1091095408

View in Genome Browser
Species Human (GRCh38)
Location 11:132816819-132816841
Sequence CAGTTGTACAAGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091095404_1091095408 -7 Left 1091095404 11:132816803-132816825 CCTTCTTTTTCAAAATCAGTTGT 0: 1
1: 0
2: 0
3: 38
4: 497
Right 1091095408 11:132816819-132816841 CAGTTGTACAAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 24
4: 263
1091095402_1091095408 5 Left 1091095402 11:132816791-132816813 CCACAGCCATATCCTTCTTTTTC 0: 1
1: 0
2: 0
3: 26
4: 479
Right 1091095408 11:132816819-132816841 CAGTTGTACAAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 24
4: 263
1091095403_1091095408 -1 Left 1091095403 11:132816797-132816819 CCATATCCTTCTTTTTCAAAATC 0: 1
1: 1
2: 4
3: 73
4: 722
Right 1091095408 11:132816819-132816841 CAGTTGTACAAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 24
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091095408 Original CRISPR CAGTTGTACAAGAGGGAGAA GGG Intronic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
902396203 1:16133599-16133621 CAGTTGTTCTGGAAGGAGAAGGG + Exonic
903285889 1:22276423-22276445 CATTTGTAGAGGAGGGAGACAGG - Intergenic
903535564 1:24064140-24064162 CAGTTGTCCAAAAAGGACAAGGG - Exonic
904969901 1:34411299-34411321 CAGTTGTACAATGGGAACAAGGG - Intergenic
906495228 1:46301006-46301028 CAGTGGTAGGGGAGGGAGAAGGG + Intronic
907688977 1:56644455-56644477 CAGCTGTACAAGAAGGAAATGGG - Intronic
908478040 1:64508096-64508118 CAGGAGGACAAGAGAGAGAAGGG + Intronic
908502838 1:64761369-64761391 CAGTTTCAAAAGAGGGAGAAGGG + Intronic
910236881 1:85046179-85046201 CTGTTGTACAAAGGGGAAAATGG + Intronic
910512441 1:88022031-88022053 CAGTTGTGCAAGAGTGAATAAGG - Intergenic
911044771 1:93619342-93619364 GAGGTGTCCAAGAGGGAGAATGG - Intronic
911387868 1:97199741-97199763 CAGATGTAAAGGAGGGAGAAGGG - Intronic
911658169 1:100468139-100468161 CAGGGGAACAAGAGGTAGAAAGG - Intronic
913018002 1:114758509-114758531 CAGATGCACAAGAGTGAGCAAGG + Intronic
913417594 1:118628938-118628960 CAGTGATACAAGAGGCAGTAGGG - Intergenic
913998688 1:143673900-143673922 CCATTGTATAGGAGGGAGAACGG + Intergenic
914201010 1:145485666-145485688 CCATTGTATAGGAGGGAGAAAGG + Intergenic
914480121 1:148058798-148058820 CCATTGTATAGGAGGGAGAAAGG + Intergenic
915068747 1:153247820-153247842 CAGGTGTCAATGAGGGAGAAGGG - Intergenic
915211480 1:154312898-154312920 CAGGAGTCCAACAGGGAGAAAGG - Intergenic
915431814 1:155872583-155872605 CAGAAGGACAAGGGGGAGAAAGG - Intronic
917876619 1:179292433-179292455 CAGTTGTAGAAGAGGCCAAACGG + Intergenic
918383797 1:183984760-183984782 CAGCTGGAGAAGAGGAAGAAGGG - Intronic
918432354 1:184475083-184475105 CAGCTGTAAAGGTGGGAGAAGGG - Intronic
920186018 1:204159969-204159991 CAGATATAAAGGAGGGAGAAGGG - Intronic
920583485 1:207135490-207135512 CATTTCTACAAGTGGGAGATAGG - Intronic
920738411 1:208556860-208556882 CAGTTATACAAGTGAGAGGAAGG + Intergenic
922060511 1:222086266-222086288 CACTTGTGCAAGAGGGAGTGGGG + Intergenic
922609176 1:226911698-226911720 CACTTGTAATAGAAGGAGAATGG - Intronic
923096111 1:230776473-230776495 CAGTTGAGCAAGAGGGATCATGG - Intronic
923149780 1:231222452-231222474 CATTTTTACAAGAGGGAATAGGG + Intergenic
924086624 1:240458310-240458332 CAATTATGCAAGAGGAAGAATGG - Intronic
924416588 1:243861974-243861996 CAGATTTACAAGGGGGAGAAAGG + Intergenic
1063145559 10:3291987-3292009 CAGCTGCAAAAGAGGAAGAATGG + Intergenic
1063838905 10:10047956-10047978 AAGTAGTAAAAGAGGCAGAAAGG - Intergenic
1067306472 10:45069383-45069405 CAGTTGTAGGAGGTGGAGAAAGG - Intergenic
1068042262 10:51840073-51840095 CAGATGGACATTAGGGAGAAAGG - Intronic
1068402665 10:56550601-56550623 TAGTTCTACAACAGGGAGAGAGG - Intergenic
1069091463 10:64204470-64204492 CACTTGGACAAGAGAGGGAAAGG + Intergenic
1069652897 10:70063981-70064003 TAGTAGTAAAGGAGGGAGAAAGG - Intronic
1070442280 10:76458530-76458552 CAGTGGTACCTGAGGGTGAATGG + Intronic
1070712595 10:78693648-78693670 CAGATAGACAAGAGGAAGAAGGG - Intergenic
1070760194 10:79019454-79019476 CAGGTGTCCAAGAGGGAAAGGGG - Intergenic
1070845505 10:79519707-79519729 CAAATGTACAAGAAGGATAAAGG + Intergenic
1070928288 10:80240607-80240629 CAAATGTACAAGAAGGATAAAGG - Intergenic
1075079735 10:119375332-119375354 CAGGTGAAGAAGAGGGAAAAAGG - Intronic
1076037572 10:127213614-127213636 CATTTGTAGAAGAGGGATTAGGG + Intronic
1076102035 10:127790310-127790332 AAGTTGTATGAGAGGGAGGAGGG - Intergenic
1076512442 10:131022299-131022321 CAGCTGTGCAAATGGGAGAAGGG - Intergenic
1078728735 11:13956707-13956729 CAGAAATACAAGAGGGAGAGAGG + Intergenic
1080559697 11:33451788-33451810 GACTTGTTCAAGGGGGAGAAAGG - Intergenic
1081637899 11:44733012-44733034 CAGATGGGGAAGAGGGAGAAGGG + Intronic
1082814645 11:57499871-57499893 AAGTTGCACAGCAGGGAGAAGGG + Intronic
1083097711 11:60268547-60268569 CAGTAGTCCAAGAGAGAGGATGG - Intergenic
1083489284 11:63003324-63003346 CAGTTGGAAGTGAGGGAGAATGG + Intronic
1084617579 11:70246644-70246666 AAGTTTTGCAAGAGGGAGTAAGG - Intergenic
1085956309 11:81400432-81400454 CAGTTGTGCAAGGGGGACAGGGG - Intergenic
1087720071 11:101653112-101653134 GAGCTGTCCAAGAGGGAGCACGG - Intronic
1088002501 11:104899337-104899359 CAGGTGTTCAAGAGGAAGAAGGG - Intergenic
1091095408 11:132816819-132816841 CAGTTGTACAAGAGGGAGAAGGG + Intronic
1095277493 12:40305097-40305119 CAGATTTACAACAGAGAGAATGG - Intronic
1096009692 12:48202451-48202473 ATGGTGTACAGGAGGGAGAAAGG + Exonic
1096587136 12:52630064-52630086 CACTTGAACAAGAGGGAAAAGGG - Intergenic
1097917551 12:65036742-65036764 CAGTTTTAAAAGATGAAGAAGGG - Intergenic
1098249077 12:68550061-68550083 GAGTTATCCATGAGGGAGAAGGG - Intergenic
1101104948 12:101431425-101431447 CAGTTGTAAAACAAGGAGACTGG - Intergenic
1101106756 12:101448133-101448155 GAGTTGTAGAAGAGGGATGATGG - Intergenic
1101434628 12:104654334-104654356 CAGTTGTATAAGAAGGTGTAGGG + Intronic
1101660350 12:106759761-106759783 CAGTTAGGAAAGAGGGAGAAGGG - Intronic
1102230011 12:111256066-111256088 CAGATGTACCAGAGGGGGAGGGG - Intronic
1102785472 12:115600691-115600713 CACTTGTAAAACAGGGATAATGG + Intergenic
1102792264 12:115657516-115657538 CAGTTGTTCAGGAGGGGTAAGGG + Intergenic
1102928591 12:116845511-116845533 CAGCTGGTCAAGATGGAGAAAGG + Intronic
1103389107 12:120557598-120557620 CAGCTGATGAAGAGGGAGAAAGG + Exonic
1103772127 12:123335605-123335627 TAGTTGTACAAGAGACAGGATGG - Intronic
1107183460 13:37489286-37489308 GAATTGTACAAGAAGGAAAAAGG + Intergenic
1109393908 13:61728900-61728922 CAGTTATTCAAGGGGTAGAATGG - Intergenic
1111108868 13:83681339-83681361 CAGTTGGACAATGGGGAGATGGG + Intergenic
1111132906 13:83999586-83999608 CTGGGGTACATGAGGGAGAAAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112341310 13:98555205-98555227 CAGTTATACATGAGGGGAAAAGG - Intronic
1113579564 13:111419450-111419472 CAGTCCAACAAGAGAGAGAAGGG + Intergenic
1113701242 13:112390172-112390194 CAGTGGTGCAAGAGGGCTAACGG + Intronic
1114180681 14:20365067-20365089 CTGTTGTACAAATGGGGGAAAGG + Intergenic
1114600814 14:23954116-23954138 CAGTTGTGCCAGAGGTAGCAGGG - Intronic
1114605040 14:23989268-23989290 CAGTTGTGCCAGAGGCAGCAGGG - Intronic
1114610494 14:24036828-24036850 CAGTTGTGCCAGAGGCAGCAGGG - Intergenic
1115030008 14:28784050-28784072 CAGTTGGAGAATAGGGAAAAGGG + Intronic
1115097487 14:29654803-29654825 CAGTTGTGCAAGTAGCAGAATGG - Intronic
1115346218 14:32345847-32345869 ATATTGTATAAGAGGGAGAAAGG + Intronic
1115629803 14:35232971-35232993 CTGTTGTAAAAGAGGAAGGAGGG - Intronic
1115727652 14:36234838-36234860 CAGTCTTAGAAGAGGGAGAGAGG - Intergenic
1117351023 14:54882155-54882177 CAGTGGTTCAAGATGTAGAATGG + Intronic
1118456000 14:65946153-65946175 CAGGTGTCCAGGACGGAGAAAGG + Intergenic
1119782802 14:77289057-77289079 CAGGTGAACAAGCAGGAGAAAGG + Intronic
1120488700 14:85148852-85148874 CAGTTAAGCAAGAGGAAGAAAGG - Intergenic
1121453526 14:94024304-94024326 CACCTGGACAACAGGGAGAAGGG + Intergenic
1121488704 14:94342478-94342500 CTCATGTGCAAGAGGGAGAAGGG - Intergenic
1125734837 15:41917617-41917639 CAGTTGTACCTGCTGGAGAAAGG + Intronic
1126192796 15:45896280-45896302 CAGAGGTACAAGAGGGAAAGCGG - Intergenic
1128160786 15:65421915-65421937 GAGTTGTCCAAGCTGGAGAAAGG - Intronic
1128731810 15:70026377-70026399 TAGTTGTAGAGCAGGGAGAATGG - Intergenic
1129235963 15:74223947-74223969 CAGTTGTCAAAGGAGGAGAAGGG - Intergenic
1130513271 15:84606509-84606531 CAGCTGTAAAATAGGGAGACAGG - Intronic
1131723298 15:95195319-95195341 CAGTTGTTAAAGAAGGAGAAGGG + Intergenic
1132367628 15:101269045-101269067 CAGTTGTGCCAGAGGAAGACTGG + Intergenic
1135138885 16:19905044-19905066 CAAGAGTACAAGAGGGAGGAAGG + Intergenic
1135638874 16:24102596-24102618 CAGTTGGCCAAGAGGCAGACAGG - Intronic
1136471065 16:30480583-30480605 CAGTGTTACATGAGGGAGCAAGG + Intronic
1137286230 16:47017912-47017934 CAGTTGTCCAGCAGGGAGAGAGG - Intergenic
1138400785 16:56741658-56741680 CAGTTGTACATTTGGAAGAAAGG + Intronic
1140841594 16:78844551-78844573 TAGGTGTACAAAAGGGAAAATGG + Intronic
1141206358 16:81935847-81935869 CAGTTATAGAAGAGGGAGAATGG - Intronic
1144010207 17:11140750-11140772 AAGAGGTACAAGAAGGAGAAAGG - Intergenic
1144218486 17:13078967-13078989 CTGTTTTTCAAGAGGAAGAAAGG - Intergenic
1146106248 17:30039847-30039869 CAGTTGTAGGAGGTGGAGAAGGG - Intronic
1146170860 17:30632022-30632044 CAAATGTACAAGATGGAGATAGG + Intergenic
1146344311 17:32048028-32048050 CAAATGTACAAGATGGAGATAGG + Intronic
1148249580 17:46064502-46064524 CAGTTTTGGTAGAGGGAGAAAGG - Intronic
1148541582 17:48484934-48484956 CAGTTGTTCAAGATGAAAAAAGG - Intergenic
1149538047 17:57447631-57447653 CAGTTGTCAAAGAGGGAAAAGGG - Intronic
1150541104 17:66100119-66100141 GAGTTGTACAAGAGAGAGGCTGG + Intronic
1151012944 17:70522176-70522198 CAGTTATAGACGATGGAGAAGGG + Intergenic
1151025045 17:70668670-70668692 TAGTTGGACAGGAGGGAGCAAGG + Intergenic
1151283196 17:73091883-73091905 CAGGTTTAAAAGGGGGAGAAAGG - Intronic
1151588882 17:75030146-75030168 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
1152266256 17:79296746-79296768 GAGTAGTAAAAGAAGGAGAAAGG - Intronic
1155525264 18:26709717-26709739 CACTTGTAGAACAGGGAGACTGG + Intergenic
1156787434 18:40932375-40932397 TAGTAATACAGGAGGGAGAATGG + Intergenic
1156863512 18:41864978-41865000 CAGTTGTACAATTTGGAGACTGG - Intergenic
1157211954 18:45750574-45750596 CAGGACTGCAAGAGGGAGAAAGG + Intronic
1157464751 18:47933270-47933292 CAATTGAGGAAGAGGGAGAAGGG + Intergenic
1160721808 19:600846-600868 CGGTTGTACAACAGCAAGAATGG - Intronic
1162240850 19:9352973-9352995 CAGTGGTCCAAGATAGAGAAGGG + Intronic
1164237068 19:23346521-23346543 CAGTTAAACAAGAGAGAAAAAGG - Intronic
1165123037 19:33574799-33574821 CATTTATAAAAGAGAGAGAAAGG - Intergenic
1165175773 19:33928847-33928869 CAGGTGTACAAGGGGGAGCATGG + Intergenic
1166349031 19:42185609-42185631 CAGGGGGACAAGAGTGAGAAGGG - Intronic
926427519 2:12752856-12752878 CAGTTGTACACTAGGGAAACAGG - Intergenic
926763958 2:16306023-16306045 CAGAAGGACAAGAGGAAGAAGGG - Intergenic
928248881 2:29657181-29657203 AAGGTGGACAAGAGTGAGAAGGG + Intronic
928579574 2:32693576-32693598 GAGTTGTAAAACAGTGAGAAAGG + Intronic
928673661 2:33628524-33628546 TTGTTGTAGCAGAGGGAGAATGG - Intergenic
930409195 2:51002044-51002066 CAGTTGTACAAAAGTATGAATGG - Intronic
930640295 2:53847553-53847575 CATTATTTCAAGAGGGAGAATGG + Intergenic
932740919 2:74290696-74290718 CAGGTGCACTAGAGAGAGAAAGG + Intronic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933168231 2:79097550-79097572 CAGTTAAACAAGAGAGAAAAAGG + Intergenic
934969765 2:98753799-98753821 CAGGTGGACTACAGGGAGAAAGG - Intergenic
939496811 2:142935237-142935259 CAGTTAAACAAGAGAGAAAAAGG + Intronic
939958137 2:148543707-148543729 CAGCTAGACAGGAGGGAGAAAGG - Intergenic
942970457 2:181951849-181951871 CAGTTGCAGAAGAGGGAGTAAGG - Intergenic
943596830 2:189868350-189868372 CAGTTGTACTATATGGAGAATGG + Intronic
945768032 2:214004292-214004314 GAATTGTAGAATAGGGAGAAGGG + Intronic
946424509 2:219586018-219586040 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
946451187 2:219781238-219781260 CAGTTGTACCATAGGTAAAATGG + Intergenic
947663947 2:231891246-231891268 CAGATGGACAAGAGGGAGCCAGG + Intergenic
1169282669 20:4280451-4280473 CATTTGTACAGAAGGGTGAAGGG - Intergenic
1169543821 20:6630456-6630478 TAGTAGGACAAGAGGGATAAAGG + Intergenic
1173581744 20:44151909-44151931 CAGGTGGAAAAGAGAGAGAAAGG - Intronic
1177844115 21:26268475-26268497 CAGTGATACAGGAGGGAGATAGG - Intergenic
1177967009 21:27740259-27740281 CAGTGGTAAGAGGGGGAGAAGGG + Intergenic
1178436779 21:32567099-32567121 CTGTGGTACAAGGGGGAGAGAGG + Intergenic
1179297353 21:40075167-40075189 CAGTTGTCCAAAACGAAGAAGGG - Exonic
1179403502 21:41106649-41106671 CTGTCTTACAAGAGAGAGAAAGG + Intergenic
1181950602 22:26550931-26550953 GAGTGGTTCAAGAGGGAAAAAGG + Intronic
1182797144 22:32999286-32999308 CAGGTGTACAAGATAGGGAAGGG + Intronic
1183950221 22:41348595-41348617 AAGGGGAACAAGAGGGAGAAAGG - Intronic
949720363 3:6982284-6982306 GAGGACTACAAGAGGGAGAAGGG + Intronic
949954298 3:9255072-9255094 CAGTTGTACAACATTGTGAATGG + Intronic
950606581 3:14086794-14086816 CAGATGCACAAGCAGGAGAATGG - Intergenic
951506009 3:23445627-23445649 CAGTTGGTCATGAAGGAGAAAGG + Intronic
951739957 3:25910755-25910777 CAGTTCTACTCTAGGGAGAAAGG + Intergenic
952914818 3:38227747-38227769 AACTTGTACAAGTGGAAGAAGGG - Intronic
953435162 3:42872068-42872090 CAGTGCTACAAGAGGGTGAGGGG - Intronic
954373877 3:50184243-50184265 CAGCTGTGCAGGAGGGAGACGGG + Intronic
955953260 3:64263269-64263291 CACTTGTACCCGAAGGAGAAAGG + Intronic
957761435 3:84562634-84562656 CAAGTAAACAAGAGGGAGAACGG - Intergenic
958532398 3:95350187-95350209 CAGTTGAGCAAGAGGCAGAACGG + Intergenic
958885494 3:99721611-99721633 CAGTTGTAATAGAAGAAGAATGG + Intronic
960525527 3:118705472-118705494 CAAATGGACAAGAGGAAGAAGGG + Intergenic
961162138 3:124736772-124736794 CAGTTGTTCAAGAAGCGGAAAGG + Intronic
963362303 3:144289934-144289956 CAGTGGTCCAAGGGGGAGAATGG + Intergenic
964744583 3:160000513-160000535 CAGTTTAGCAAGAGAGAGAAGGG - Intergenic
966123972 3:176553686-176553708 CAGATGAAGAGGAGGGAGAAGGG - Intergenic
967273459 3:187750262-187750284 CAGGTGTACAAGAGGGCGGTGGG - Intergenic
967512379 3:190326559-190326581 GGGTTGGCCAAGAGGGAGAATGG + Intronic
968470599 4:780784-780806 CAGTTGTAGGAGAGGAATAATGG - Intergenic
969147589 4:5137594-5137616 CATTTGTAAAATAGGGAAAATGG - Intronic
969707390 4:8819227-8819249 CTGTAGCCCAAGAGGGAGAAGGG + Intergenic
970224521 4:13843866-13843888 TAGTTGGAGAAGAGAGAGAAGGG - Intergenic
971218070 4:24680487-24680509 CTGCTGAAAAAGAGGGAGAAGGG + Intergenic
972295047 4:37729454-37729476 CAGGAGGTCAAGAGGGAGAATGG + Intergenic
972710747 4:41592074-41592096 CAGTGCTATCAGAGGGAGAAGGG - Intronic
973581611 4:52349550-52349572 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
974403934 4:61441052-61441074 CAGTTTGACAAGAGTAAGAAAGG - Intronic
974557886 4:63475440-63475462 CAGTGATGCAGGAGGGAGAAAGG - Intergenic
974941624 4:68476318-68476340 CAGAAGTAGAAGAGGGTGAATGG + Exonic
974958708 4:68673815-68673837 CAGTTAAACAAGAGAGAAAAAGG - Intergenic
975974138 4:80075660-80075682 CAGTTGGCAAAGAGTGAGAAGGG - Intronic
978306509 4:107334315-107334337 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
978371788 4:108036497-108036519 CACTTGTTCAAGAGGGAGGGTGG + Intergenic
978915290 4:114118860-114118882 CTATTGTACAACAGGGTGAATGG - Intergenic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
981477022 4:145197350-145197372 CAGAGGCACAAGAGGGAGATTGG + Intergenic
981871394 4:149491051-149491073 CAGTTCCACAAGATGGTGAATGG - Intergenic
982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG + Intergenic
982509217 4:156260161-156260183 AAGTTATACAAGAGGAAGGAAGG + Intergenic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
984830410 4:183967457-183967479 GAGTGGTGCAAGAGGAAGAAAGG + Intronic
986343933 5:6817083-6817105 TAGATGTACAAGAGGGAGAAGGG - Intergenic
987704393 5:21444679-21444701 AAGTTGTACTAGAGGGGAAAGGG - Intergenic
987803084 5:22723202-22723224 CAGAGGTACAAAAGGTAGAAAGG + Intronic
988102860 5:26704736-26704758 CAGTGGGACAAGAGGGAGAGGGG + Intergenic
989585873 5:43073570-43073592 CAGTTAAACAAGAGAGAAAAAGG + Intronic
990221511 5:53595727-53595749 GATTTGTGCAAGAGGGATAAGGG - Intronic
991464131 5:66892308-66892330 CAGTAATACAAAAGGGAGGAGGG - Intronic
992778520 5:80108143-80108165 CAGTAGGGCAAGAGGGAGAGAGG + Intergenic
994636003 5:102344876-102344898 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
996009442 5:118465765-118465787 AAGTTCTACAAGAGGGAGAGAGG + Intergenic
998190087 5:140016171-140016193 CACTTGTAGGAGAGGCAGAAGGG + Intronic
1000278148 5:159757730-159757752 CAGTTTTCCTAGAGTGAGAAGGG - Intergenic
1004345620 6:14846560-14846582 CAGGTGCTCAAGAGGGAGCAGGG + Intergenic
1006513543 6:34534074-34534096 CAGGTGTGCAGGAGGGAGGAGGG - Exonic
1007361170 6:41357005-41357027 AAGTTGCACAAGAGGCTGAAAGG - Intergenic
1008590329 6:52987356-52987378 CAGTTGTACAAGTTGCAGGATGG - Exonic
1008627364 6:53330899-53330921 CAGTGGGACAAGATGTAGAAGGG - Intronic
1008757759 6:54818018-54818040 AAGGTGAACAAGAGGGGGAAAGG - Intergenic
1008932213 6:56953560-56953582 CTGTTGTACAAGAGGGGAAAAGG - Intronic
1011755038 6:90489882-90489904 CAATTTCACAAGAGGCAGAAAGG - Intergenic
1013000880 6:106020943-106020965 CAGGTAGACAAGAGGGGGAAAGG - Intergenic
1015447030 6:133317979-133318001 CACTTGTATAAGAGGGTGGATGG - Intronic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1017574551 6:155787584-155787606 CAGATGGACAGGAGGGAGACAGG + Intergenic
1020384484 7:7583265-7583287 CCCTTGTACAAGAAGGGGAATGG + Exonic
1022592273 7:31675822-31675844 CACTTGTAAAAGAGAAAGAAAGG + Intergenic
1023119984 7:36899407-36899429 CAGGTGAAGAAGAGGGAGAAGGG + Intronic
1023168405 7:37365822-37365844 CGACAGTACAAGAGGGAGAATGG - Intronic
1023718907 7:43072987-43073009 CAGAGGTACATGAGGGAGAGAGG + Intergenic
1024297875 7:47860802-47860824 GAGATGCACAAGAGGGACAATGG + Intronic
1025603144 7:63018053-63018075 CAGTTGTACCAGAAACAGAAAGG - Intergenic
1026584275 7:71643502-71643524 CATTTTTACAAAAGGGAAAAAGG + Intronic
1026646855 7:72178335-72178357 CACTTGTGCAAGAGGTCGAATGG + Intronic
1027453165 7:78356210-78356232 CAGTTCTATGTGAGGGAGAATGG + Intronic
1027947702 7:84770274-84770296 CAGTGGTACAATGGGAAGAAAGG - Intergenic
1029660182 7:101955242-101955264 CAATGGTCCAACAGGGAGAAGGG - Intronic
1030698040 7:112607681-112607703 TAGGTGTATAAGAGGAAGAATGG - Intergenic
1030836942 7:114299590-114299612 CAGTTGATCAAGAGGTAGAAAGG - Intronic
1030861674 7:114639440-114639462 CAGTTGTATTAGAAGGAGACTGG + Intronic
1031186839 7:118492527-118492549 CAGTTGGAAGAGAGGCAGAAAGG - Intergenic
1031622928 7:123957430-123957452 AGGTTGTACAAGAGGAAGCAAGG + Intronic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1034316060 7:150134381-150134403 CAGTGGTGAAAGAGAGAGAAGGG - Intergenic
1034401201 7:150862755-150862777 AAATTTTACAAGAGGGAGGAAGG + Intergenic
1034790828 7:153966400-153966422 CAGTGGTGAAAGAGAGAGAAGGG + Intronic
1035496021 7:159326881-159326903 CAGATGGACAGGAGGGAGCAAGG - Intergenic
1038434429 8:27525296-27525318 CAGTCTTACAAGAGCCAGAAAGG - Intronic
1042031518 8:64481058-64481080 CAGTTATACAAGTGGGATGAGGG + Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1045520380 8:102897970-102897992 TAGCTAGACAAGAGGGAGAAGGG + Intronic
1045897350 8:107235498-107235520 GAGTAGGACAAGAAGGAGAAGGG + Intergenic
1046058440 8:109107081-109107103 CAGTTGTATAATAAAGAGAATGG + Intronic
1046191958 8:110807692-110807714 CATCTGTAAAAGAGGGGGAAAGG + Intergenic
1048893297 8:138966659-138966681 CAGTTTTTAAAGGGGGAGAAGGG + Intergenic
1048986017 8:139735443-139735465 CAGAGGTAGAGGAGGGAGAAGGG - Intronic
1050648070 9:7743657-7743679 AACTTGTAAATGAGGGAGAAAGG - Intergenic
1055589912 9:77801580-77801602 CAGTTGAATAATAGAGAGAAAGG + Intronic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1056497255 9:87170506-87170528 CTGTTGGTCAAGAGGCAGAAAGG + Intergenic
1058176434 9:101740552-101740574 AAGGTGGACAAGAAGGAGAAAGG - Intergenic
1060924439 9:127446226-127446248 CTGTTCTCCATGAGGGAGAAGGG - Intergenic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1062046686 9:134427627-134427649 CAGTTGTGAAATGGGGAGAATGG + Intronic
1185805743 X:3055453-3055475 GACTTGAACAAGAGGGATAAGGG - Intronic
1188006369 X:25018133-25018155 CAGCTGCACAAGGGGGAGGAGGG - Intergenic
1188838720 X:34989249-34989271 CAGATGGACTAGAGGGAGAAAGG + Intergenic
1189865594 X:45323814-45323836 CACTTGTAGAAGAGTGGGAAGGG - Intergenic
1190572359 X:51796748-51796770 CAGATGTACAATAAGGAGAGAGG - Intergenic
1191895362 X:65987031-65987053 CTGTTATAGAAGAGGGAGAAGGG + Intergenic
1194862782 X:99024372-99024394 CAATTGTAGAAGTGGGAGATGGG - Intergenic
1195247956 X:103013513-103013535 CAGATGTAGAAGAGGGAGTCAGG - Intergenic
1195574737 X:106437233-106437255 CAGTTGAAGAAAAGGGAAAAAGG - Intergenic
1195842895 X:109193394-109193416 GAGTTGAACAAGTGGAAGAAAGG + Intergenic
1195997463 X:110745511-110745533 CAGATGTAGAAGAGGGAGGTGGG - Intronic
1196882230 X:120208776-120208798 CAGATGGACAAGAGGGAGCCAGG + Intergenic
1197278181 X:124504490-124504512 CAGGTTTCCAAGAGGGAAAATGG - Intronic
1198030256 X:132747645-132747667 CATTTGTACAAGGGGGAGGGAGG + Intronic
1201760689 Y:17534621-17534643 CAGTTGTACAAAAAGTAAAAAGG - Intergenic
1201840863 Y:18371369-18371391 CAGTTGTACAAAAAGTAAAAAGG + Intergenic