ID: 1091096859

View in Genome Browser
Species Human (GRCh38)
Location 11:132831532-132831554
Sequence ATGTCTAAGTAGAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091096859 Original CRISPR ATGTCTAAGTAGAGGGAAAA TGG (reversed) Intronic
903920554 1:26797174-26797196 ATGGCAAAGCAGAGGGAAATGGG - Intronic
904172776 1:28603160-28603182 ATTACAAAGTACAGGGAAAAGGG + Exonic
905955354 1:41989569-41989591 ATAACTAAGGAAAGGGAAAAAGG + Intronic
906234553 1:44197324-44197346 ATCTTTAAGAAGATGGAAAATGG - Intergenic
907366627 1:53966201-53966223 GTGTTTATGGAGAGGGAAAAAGG + Intronic
907878190 1:58516129-58516151 ATGTTTAATGTGAGGGAAAAGGG - Intronic
909156455 1:72083802-72083824 CTATCCATGTAGAGGGAAAATGG - Intronic
913301372 1:117373389-117373411 ATGTCTGAGTAAAGGGAAGTGGG - Intronic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
916738411 1:167628341-167628363 AGGACTAGGTAGAGGGAGAAAGG + Intergenic
916987004 1:170202370-170202392 ATGTTAAAGTAGAGAGAAAAGGG - Intergenic
917154562 1:171982975-171982997 ATGTCTGAGGGGAGGGAAATAGG - Intronic
918651289 1:186966410-186966432 ATGTCTACGCTGGGGGAAAATGG + Intronic
919179790 1:194065801-194065823 ATGTCTAATTTGGGGGACAAAGG - Intergenic
919525760 1:198648254-198648276 ATGTTTATGTGGAGAGAAAAGGG + Intronic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
920180518 1:204129455-204129477 GTGTCTCAGCAGAGGGAATAAGG - Intergenic
921476105 1:215612424-215612446 ATGTTAAAGTAGATGGAAATAGG - Intronic
924173260 1:241363505-241363527 ATTTCTAATTAGAAGAAAAATGG - Intergenic
1064583278 10:16815316-16815338 ATGTCTTGGCAGAAGGAAAAGGG - Intronic
1064606150 10:17041767-17041789 ATGACTAACTAGAGGGAGAACGG - Intronic
1066421783 10:35270686-35270708 ATGTCTAAGAATTGCGAAAAGGG - Intronic
1066669765 10:37824450-37824472 ATTTCAAAGTAGAGAGAAATAGG + Intronic
1070752404 10:78972145-78972167 ATTTTAAAGTAGAGGAAAAAGGG + Intergenic
1073500349 10:103931531-103931553 AGGATTGAGTAGAGGGAAAATGG + Intergenic
1073649487 10:105343407-105343429 CTGTCTAGGTAGGGGGAAAAAGG - Intergenic
1074520047 10:114211785-114211807 ATCTCTAAGTTGAGGAAGAAAGG + Intronic
1074979327 10:118607013-118607035 GTGTCCAAGGAGAGGGATAAAGG - Intergenic
1078630361 11:12997618-12997640 ATGCGAAAGGAGAGGGAAAAAGG + Intergenic
1079506221 11:21155302-21155324 ATGTCTAAGGATTGGGTAAATGG + Intronic
1079955452 11:26857535-26857557 ATGGTAAAGTAGAGTGAAAAAGG + Intergenic
1080245022 11:30170007-30170029 GTTTCAAAGTAGAGGTAAAAAGG - Intergenic
1081838364 11:46176462-46176484 AACTCTAAGAAGAGAGAAAAGGG + Intergenic
1083628241 11:64082801-64082823 ATGTCTGAGCTGAGGGAAACAGG - Intronic
1086221453 11:84449486-84449508 ATGGCTAACTAGATAGAAAAGGG + Intronic
1087062076 11:93989012-93989034 ATGTTTAAGCAGAGGCCAAACGG + Intergenic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1091096859 11:132831532-132831554 ATGTCTAAGTAGAGGGAAAATGG - Intronic
1093349452 12:18079932-18079954 ACGTAAAAGTAGTGGGAAAACGG - Intergenic
1093634061 12:21443228-21443250 AATTCTAAGTGGAAGGAAAATGG - Intronic
1095202659 12:39402591-39402613 AATTCTAAGTAGAGGAGAAAGGG - Intronic
1095850778 12:46801954-46801976 ATATCTGAGTAGAGGAAAAAAGG - Intronic
1096417578 12:51426828-51426850 GGGTTTAAGTAGAGGGGAAAGGG + Intronic
1096884158 12:54699891-54699913 AGGTACAATTAGAGGGAAAAGGG + Intergenic
1097132239 12:56820626-56820648 ATGTCAAATTAGTGGGAATAAGG + Intergenic
1097506186 12:60474686-60474708 TTGTCTAAAAACAGGGAAAATGG + Intergenic
1098612004 12:72470341-72470363 GTGTCTATGTGGTGGGAAAAGGG - Intronic
1099281386 12:80652387-80652409 ATGTCTACTTAGTAGGAAAAGGG - Intronic
1099532494 12:83801453-83801475 GTGTCTAGTTAGAGGGAAGAAGG + Intergenic
1099943195 12:89214568-89214590 ATGTCTAAGCAGAAGTTAAATGG + Intergenic
1100688358 12:97011247-97011269 AAGTCTAAGTAGATTAAAAATGG + Intergenic
1101011144 12:100450850-100450872 AAGACAAAGGAGAGGGAAAACGG + Intergenic
1102057968 12:109910961-109910983 ATGTCTATGTAGAAAGGAAAGGG + Intronic
1102636580 12:114329793-114329815 ATGTCTCTGTAAATGGAAAATGG + Intergenic
1103690273 12:122767053-122767075 AGGTCCAGGTAAAGGGAAAAAGG - Intronic
1104448031 12:128848589-128848611 AGGTCTGAGTAGAGCGAAAAAGG + Intergenic
1106084945 13:26533415-26533437 ATTTCTTAATAGAAGGAAAATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106775477 13:33004325-33004347 ATGTTTAGGCAGAGGGATAAGGG + Intergenic
1107200389 13:37708833-37708855 ATGTATACGGAGAAGGAAAAAGG - Intronic
1107387819 13:39931553-39931575 ATGTCTAAGTACATGGATATAGG + Intergenic
1109374575 13:61474540-61474562 ATGTGTGAGAAGAGAGAAAAGGG + Intergenic
1109589253 13:64455846-64455868 GTGTCAAAGTATAGGGAAAATGG + Intergenic
1109691423 13:65895816-65895838 ATGTATAAGTAAATGGAAAAAGG - Intergenic
1109751679 13:66701004-66701026 ATATATAAGTAGGGAGAAAAAGG - Intronic
1109861641 13:68206867-68206889 ATTTCTAAGTCAATGGAAAAAGG - Intergenic
1110848266 13:80214666-80214688 AAGCCTAATTAGAGGGGAAATGG + Intergenic
1111033068 13:82632776-82632798 ATGAATAAGAAAAGGGAAAAAGG - Intergenic
1111062699 13:83044244-83044266 TAGTATAAGTAAAGGGAAAATGG + Intergenic
1112534995 13:100244724-100244746 TTGCCTAAGTAGAGAGAAATAGG + Intronic
1114426441 14:22627808-22627830 ATGTGTAAGGAAAGGGAAGAGGG - Intergenic
1114974765 14:28081718-28081740 ATGTTTAAGTAAAGAGAAATTGG + Intergenic
1115434437 14:33357165-33357187 ATGTGAAATTAGAGGGAAGATGG + Intronic
1117236846 14:53786951-53786973 ATGTTTAAGGAGAAAGAAAAAGG - Intergenic
1118001818 14:61530002-61530024 ATCACTAAGTAGAGACAAAAAGG - Intronic
1120153603 14:81065409-81065431 ATATCTAAGAAGATGGAAGATGG + Intronic
1120456318 14:84735546-84735568 ATGTCTCAGTATCAGGAAAAGGG + Intergenic
1121095537 14:91215768-91215790 AAGTCAAACTAGAAGGAAAATGG - Intronic
1121748067 14:96318387-96318409 ATGGCTAATTAGTGGAAAAATGG + Intronic
1125175053 15:36811522-36811544 ATGTCCATGTGGAGGGAAACTGG - Intergenic
1125382289 15:39099643-39099665 ATGTGTTAGGAGAGGGAAAGTGG - Intergenic
1125419142 15:39486789-39486811 AAGACTAAGTAGAAGGAATACGG - Intergenic
1125822751 15:42646940-42646962 AGGCCTGAGTAGAGGGAGAAAGG + Intronic
1126201640 15:45993216-45993238 ATGCCTGAGTTGAGCGAAAAGGG + Intergenic
1127001841 15:54517928-54517950 TTGTATAAATAGAGGTAAAAAGG + Intronic
1127032634 15:54880779-54880801 CTGTCTTAGTAGAGGTAAACCGG - Intergenic
1128351284 15:66891648-66891670 AGGTTTAAGCAAAGGGAAAAGGG - Intergenic
1128778261 15:70340538-70340560 ATGTGGAAGGAGAGGGAAAGTGG - Intergenic
1130281058 15:82520480-82520502 ATGTCTATGTTGAGGGAGTAAGG - Intergenic
1130594726 15:85241297-85241319 ATGTCTATGTTGAGGGAGTAAGG - Intergenic
1131191419 15:90319791-90319813 ATGGCTGACTATAGGGAAAAGGG + Intergenic
1134022282 16:10929556-10929578 AGGTCTAACAAGAAGGAAAAAGG + Exonic
1135556455 16:23440985-23441007 ATATATATGGAGAGGGAAAAAGG + Intronic
1137387483 16:48055145-48055167 CTGTTTACGAAGAGGGAAAACGG - Intergenic
1137682535 16:50362773-50362795 AGGTCTGAGGAGAGGGAGAAAGG + Intronic
1138403948 16:56773178-56773200 AAATCTAAGTAGGGGGAGAACGG + Intronic
1139726184 16:68900852-68900874 ATGTCTAGGAAGAAGGAAATAGG + Intronic
1140806477 16:78536705-78536727 ATGACTATGAAAAGGGAAAATGG + Intronic
1141469950 16:84231364-84231386 ATGTCTTAGTAGCAGGAAAGAGG + Intronic
1143546777 17:7601605-7601627 ATGCCTAAGTCCCGGGAAAAGGG + Intronic
1146548042 17:33756050-33756072 ATGTTCAATTACAGGGAAAACGG - Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1147318244 17:39631337-39631359 AGGTCCAAGAAGAGGGAAGAAGG + Intronic
1148284573 17:46375904-46375926 ATGTCTGAGTAGGAGGTAAATGG - Intergenic
1148306794 17:46593825-46593847 ATGTCTGAGTAGGAGGTAAATGG - Intronic
1149506672 17:57200199-57200221 ATCTCCAAGCAGATGGAAAATGG - Intergenic
1152481604 17:80557622-80557644 AAGTCTAAATATATGGAAAATGG + Intronic
1153021395 18:632852-632874 GTGTCTAAATATAGGAAAAAGGG + Intronic
1154120848 18:11651377-11651399 CTGTCTAAAAAGAGGGGAAATGG - Intergenic
1155069826 18:22305167-22305189 AAGTCTAAGAAGAGTTAAAAGGG + Intergenic
1156261802 18:35451457-35451479 AAGGATAAGGAGAGGGAAAAGGG + Intronic
1156804835 18:41165383-41165405 ATGTCTCAGGAGTGGCAAAAAGG + Intergenic
1157052199 18:44179449-44179471 ATGTCTTCTTAGAGGAAAAATGG + Intergenic
1158027323 18:52915824-52915846 ATTTCTATGTTGAAGGAAAATGG + Intronic
1159269072 18:66125553-66125575 ATTTCTCAGTACAGGAAAAAAGG + Intergenic
1161227518 19:3153953-3153975 ATGTATGAGTAGATGGATAATGG + Intronic
1165972332 19:39642360-39642382 ATGACCAAGTGTAGGGAAAAGGG - Intergenic
1166400940 19:42479493-42479515 ATATTAAAGTAGAGGGATAAGGG - Intergenic
1166931322 19:46303412-46303434 ACGGCTCAGTTGAGGGAAAAGGG + Intronic
1167051980 19:47084982-47085004 ATGACTCATTAAAGGGAAAAAGG + Intronic
925534998 2:4906949-4906971 AAGTAAAAGTAGAGGTAAAATGG - Intergenic
928600433 2:32899017-32899039 ATGTGTTGGTAGAGGGACAAAGG - Intergenic
928806794 2:35167968-35167990 ATGTGGCAGTAGAGTGAAAATGG - Intergenic
929029664 2:37638427-37638449 TTGTATAAGTCCAGGGAAAATGG - Intergenic
930031764 2:47062481-47062503 ATGTCTAAATTGAGGGAGGAAGG - Intronic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
931752332 2:65341024-65341046 ATCTCTAAGGAGAGAGAAAGGGG + Intronic
935985207 2:108665966-108665988 GTGTGCAAGCAGAGGGAAAATGG - Intronic
936137642 2:109909610-109909632 GTGTGCAAGCAGAGGGAAAATGG - Intergenic
936207055 2:110461875-110461897 GTGTGCAAGCAGAGGGAAAATGG + Intronic
938122874 2:128645958-128645980 ATGAATGAGTAGAGGGAACAAGG - Intergenic
939338033 2:140856129-140856151 ATGTGTATGTAGAAGGAAAGTGG - Intronic
939366295 2:141236667-141236689 ATGTGTACGTTGAGGTAAAATGG + Intronic
941420997 2:165282558-165282580 TTGTTTAAGTAGCAGGAAAAAGG - Intronic
941517059 2:166493118-166493140 ATGGCAAAGTAGAAGGAAAGTGG - Intronic
943087407 2:183329263-183329285 ATGCCTGAGGAGAGGGAAACAGG - Intergenic
943296277 2:186144001-186144023 AACTCTAAATTGAGGGAAAATGG - Intergenic
945605382 2:211923595-211923617 AGGTTCAAGTAGAGGGGAAAAGG + Intronic
945946801 2:216002680-216002702 AGGTCTCAATAGAGGGAAGAAGG - Intronic
946617111 2:221522125-221522147 ATGTCTATATCAAGGGAAAATGG - Intronic
947004809 2:225498840-225498862 AAGTTTCATTAGAGGGAAAAGGG + Intronic
948884278 2:240875137-240875159 ATGTCCAGGTAGAAGGAGAAGGG - Exonic
1169524973 20:6414464-6414486 ATTTCTAAGAAAAGGGAAGAAGG + Intergenic
1170134097 20:13054106-13054128 ATCTCTAAGAAGAGAGAATATGG + Intronic
1170190841 20:13643386-13643408 ATGTTTAAATATAGAGAAAATGG - Intergenic
1172292089 20:33783981-33784003 ATGGAGAAGTGGAGGGAAAAGGG - Intronic
1173001454 20:39108806-39108828 ATGCCAAAGTCGAGGGACAAGGG - Intergenic
1173027065 20:39317864-39317886 ATGTATAAAGAGAGAGAAAATGG - Intergenic
1173397283 20:42691234-42691256 ATGACAAAGTAGAGAGAAAGGGG + Intronic
1177658795 21:24055664-24055686 AGGTTTCAGTGGAGGGAAAATGG - Intergenic
1177743049 21:25176983-25177005 ATGTTAAAGTATAGAGAAAAAGG + Intergenic
1183997265 22:41644309-41644331 AAGTCTCAGTACATGGAAAAAGG - Intronic
1184251000 22:43260255-43260277 ATGACTATGTGGAGGGAACAAGG - Intronic
950983442 3:17333582-17333604 ATGCTTAAGCAGAGGGATAAGGG + Intronic
951489669 3:23255570-23255592 GAGTCAAAGTAGAGAGAAAAAGG + Intronic
951779149 3:26343484-26343506 ATGCATAAATAGAGGGTAAAAGG - Intergenic
951806492 3:26649928-26649950 CTGGATAAGTAGAGGGAAAGAGG - Intronic
951948632 3:28172599-28172621 ATGTCTAAGTAAAGGGCCAAGGG + Intergenic
951955003 3:28243799-28243821 GTGTCTGTGTAGGGGGAAAAGGG - Intronic
951958183 3:28281808-28281830 TTGGCTAAGTATAGGGAAACTGG + Intronic
953291701 3:41671005-41671027 ATGATTAAGTAAAGGAAAAAAGG + Intronic
953720591 3:45351393-45351415 TTTTCTAAGTAGATGGAAAGAGG + Intergenic
953909031 3:46882648-46882670 ATGTTTTCGTAGAGAGAAAAGGG + Intronic
954562680 3:51571266-51571288 TTGTCACAGTAGAGGGAACAAGG - Intronic
956240219 3:67121749-67121771 ATGCCAAATTAGAGGAAAAATGG + Intergenic
957149593 3:76468833-76468855 TTGTCTAGGTAGAGGGCGAATGG - Intronic
957389480 3:79545356-79545378 ATTTCTAAGTAAATGGAAAATGG - Intronic
957570711 3:81944921-81944943 ATGTCTATGCATTGGGAAAACGG + Intergenic
958040616 3:88221941-88221963 ATGACTGAGTAGAGTGAAATGGG - Intergenic
958927078 3:100170706-100170728 ATGCCAAAGTAGAGGTAGAAAGG + Intronic
959144091 3:102523339-102523361 ATGTCTAAGTGGTAAGAAAAGGG - Intergenic
959418554 3:106105809-106105831 ATATCTAAGGAGAAGGAAAAGGG - Intergenic
959983119 3:112540450-112540472 ATGTGTAAGAAGTTGGAAAAAGG - Intronic
960289957 3:115872064-115872086 AAATCTAAGAAGAGAGAAAAAGG - Intronic
960520737 3:118652066-118652088 TTGTCAAAGCAGAGGGAAAAGGG + Intergenic
961116470 3:124334227-124334249 AAGTTTAAGTTAAGGGAAAAGGG - Intronic
964632608 3:158828499-158828521 ATGTCTTAGAGTAGGGAAAATGG + Intronic
965106608 3:164363600-164363622 ATTTCTAAGAAGAGGTAAATTGG + Intergenic
965751372 3:171978106-171978128 ATGTCTACCTAGAGAGAAAGGGG + Intergenic
969922046 4:10549681-10549703 ATGAAAAATTAGAGGGAAAACGG + Intronic
970366342 4:15362277-15362299 TTGTCTATATAGAGGGAAAGAGG - Intronic
970534228 4:17012691-17012713 ATGTCTAAGAGGAGGTAAACAGG - Intergenic
970540278 4:17070998-17071020 ATCTCAGTGTAGAGGGAAAAAGG - Intergenic
970548015 4:17149208-17149230 CTGTATCAGTAGAGTGAAAATGG + Intergenic
970954051 4:21789963-21789985 ATGTATATGAAGATGGAAAATGG - Intronic
971110302 4:23577721-23577743 ATGTATAAATAGAGGGGAAAAGG - Intergenic
977407447 4:96617967-96617989 TTGTGTAAGTAGAGGAACAATGG + Intergenic
978312844 4:107404702-107404724 CTGTCTAGGAAGAGGAAAAATGG - Intergenic
979439083 4:120729785-120729807 AGGTATAAGTGAAGGGAAAATGG + Intronic
979881672 4:125967309-125967331 ATGTCACATTAGAAGGAAAAAGG - Intergenic
980104604 4:128575807-128575829 GTGTCTAGGGAGAGAGAAAATGG - Intergenic
980198813 4:129626967-129626989 ATGGGTAGGTAGAGGGAGAATGG + Intergenic
981181425 4:141750422-141750444 AAGTCGAAGGAGAGGGAAAAGGG + Intergenic
981756485 4:148145865-148145887 GTTTCTCAGTAGAAGGAAAAGGG + Intronic
983272802 4:165582969-165582991 ATGTCTAATTACTGGGTAAAAGG - Intergenic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984264974 4:177487543-177487565 ATGTGTCATTTGAGGGAAAAGGG - Intergenic
984448643 4:179870503-179870525 ATGAAAAAGTAGAGAGAAAAAGG - Intergenic
986605328 5:9517294-9517316 ATGTCTTTGCAGAAGGAAAAGGG + Intronic
987500421 5:18701514-18701536 ATGTTCAAGTAGAGGTGAAAGGG + Intergenic
989476146 5:41875400-41875422 ATGTTTAAATTGAGGGAGAATGG - Intergenic
990001005 5:50892595-50892617 AGGGCTAAGTAGGGGGGAAATGG + Intergenic
990013255 5:51025969-51025991 AAGTGGAAGTAGAGTGAAAAAGG + Intergenic
990513781 5:56513682-56513704 ATGGGTAAGAAGAGGAAAAATGG + Intronic
991098417 5:62764232-62764254 ATGTTGAAGTAGAAGGAAACAGG + Intergenic
991491767 5:67190767-67190789 ATGAATACCTAGAGGGAAAAGGG - Intronic
993518504 5:88867819-88867841 ATGTCGATGCAGATGGAAAAAGG + Intronic
994864711 5:105252814-105252836 ATGTCTGAGTGGAGGTGAAATGG + Intergenic
995312360 5:110728635-110728657 ATGACTAATTAAAGGGAGAAAGG - Intronic
995521136 5:113006804-113006826 ATGTCTAAGTTTAGGAATAATGG + Intronic
996619291 5:125480452-125480474 ATGTGTAAAAAGAGAGAAAAGGG - Intergenic
996973384 5:129399898-129399920 ATTTTTAAATAGAGGCAAAAAGG + Intergenic
998757762 5:145399564-145399586 ATATCTATATAGAGGGTAAATGG - Intergenic
1000051123 5:157563678-157563700 ATGGCTAAGTAGATGGGGAATGG + Intronic
1000371212 5:160538379-160538401 ATGAGTACGTAGAAGGAAAATGG - Intergenic
1000933939 5:167285399-167285421 ATATTTTAGTAGAGGGAAAAGGG - Intronic
1004668279 6:17769963-17769985 ATGAAGAAATAGAGGGAAAATGG + Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004928684 6:20440860-20440882 ATGATCAAGGAGAGGGAAAAGGG + Intronic
1005672456 6:28120821-28120843 ATGTCACAGTCAAGGGAAAAAGG + Intergenic
1009046325 6:58240964-58240986 ACATCTAAGTAGGGGGAAAAGGG + Intergenic
1009222139 6:60995281-60995303 ACATCCAAGTAGGGGGAAAATGG + Intergenic
1010549199 6:77200625-77200647 ATTTCTAGGCAGAGGCAAAATGG - Intergenic
1011252425 6:85386032-85386054 AAGTTAAAGTAAAGGGAAAAAGG + Intergenic
1011313849 6:86009801-86009823 GATTCTGAGTAGAGGGAAAAAGG + Intergenic
1011401424 6:86966186-86966208 ATTACTAAGAAGAGGGAAGAAGG + Intronic
1011514169 6:88134447-88134469 ATGTCCAAGTGGAGGAAAATAGG - Intergenic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1013276898 6:108594180-108594202 AATTTTAAGTAGAAGGAAAAGGG + Intronic
1013798667 6:113914350-113914372 ATGTTTAAGAAGATAGAAAATGG - Intergenic
1013801768 6:113954165-113954187 ATGTCAAAATAAGGGGAAAATGG + Intronic
1013904681 6:115200738-115200760 ATTTATAAGAACAGGGAAAAGGG + Intergenic
1014002475 6:116380259-116380281 ATGTCTAGGTGGAGGGAAGAGGG + Intronic
1015053076 6:128865419-128865441 ATGTATCAATTGAGGGAAAAAGG - Intergenic
1015485628 6:133766797-133766819 GAGTGTAAGAAGAGGGAAAAAGG + Intergenic
1016471574 6:144380365-144380387 ATCTCTGGGCAGAGGGAAAATGG + Intronic
1017795264 6:157838531-157838553 ATGGCTAAATGGAGGGAAACAGG - Intronic
1018335448 6:162783144-162783166 ATGAATATGTAGAGGGTAAAAGG + Intronic
1018359235 6:163049607-163049629 ATGCCTCAGTAGAGAAAAAATGG + Intronic
1018925782 6:168206088-168206110 ATGTGTCAGGAGAGGAAAAATGG + Intergenic
1020053946 7:5103891-5103913 ATGTATAAGAATGGGGAAAATGG + Intergenic
1020904359 7:14046728-14046750 ATCTCTAAGTAGAGATTAAAAGG - Intergenic
1022815212 7:33906308-33906330 ATTTCTAAGAGAAGGGAAAAGGG + Intronic
1022853676 7:34293981-34294003 ACTGATAAGTAGAGGGAAAATGG - Intergenic
1023662279 7:42482070-42482092 ATGTGTAAGTTGAAGGAAACAGG - Intergenic
1023729069 7:43173260-43173282 ATGGCTAAGCAGAGGAAGAATGG + Intronic
1025286012 7:57661772-57661794 ATGTATATGTATATGGAAAAGGG - Intergenic
1027468407 7:78543207-78543229 ATGTGAATGTAGAGAGAAAAAGG + Intronic
1027474882 7:78616784-78616806 ATCTCTAAGTAGGGGTAGAAGGG + Intronic
1027565134 7:79782158-79782180 ATGTCTAAGTGCGGGGGAAAAGG - Intergenic
1027804638 7:82801581-82801603 ATTTCTAAACAGAGGGAAGATGG - Exonic
1029796004 7:102895302-102895324 ATGTCCAGGCAGAGGGCAAAAGG + Intronic
1030847250 7:114435348-114435370 AATTCTAGGTAGAAGGAAAAGGG + Intronic
1032054209 7:128671897-128671919 AAGTCTAAGGATAGGAAAAAGGG - Intergenic
1033269503 7:139918112-139918134 ATGGCTTAGAAGAGGGAAAATGG - Intronic
1033792921 7:144813978-144814000 AAGGCTGAGAAGAGGGAAAAGGG + Intronic
1036520428 8:9486532-9486554 AGGTGTATGTAGAGGAAAAAAGG + Intergenic
1036741283 8:11363956-11363978 TTGTGAAAGTAGAGTGAAAAAGG - Intergenic
1036806911 8:11841371-11841393 ATGGCTCAGTAGATGGAAGAAGG - Intergenic
1037863148 8:22420677-22420699 TTGTCTAAGTAGAGCATAAATGG - Exonic
1038247106 8:25868902-25868924 ATGTATAAGTGGAGAGAAAGAGG - Intronic
1039224764 8:35376527-35376549 ATGTCTATTTAGAGCGAGAATGG + Intronic
1039460909 8:37743434-37743456 ATGTGCAAGAAGAGAGAAAAAGG + Intronic
1039711070 8:40056613-40056635 ATGTCTAAGTTGAGACATAAAGG + Intergenic
1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG + Intronic
1041564916 8:59265805-59265827 TTCTCTTATTAGAGGGAAAAAGG - Intergenic
1043970870 8:86527141-86527163 ATCTCAAAGTGGAGGGCAAAGGG + Intronic
1044803572 8:95981681-95981703 AACTATAAGTAGGGGGAAAAAGG - Intergenic
1045133801 8:99189849-99189871 AAGTCTAAGTAGAATGAAAAAGG - Intronic
1045944259 8:107777621-107777643 ATGGGGAAGTTGAGGGAAAATGG - Intergenic
1046701720 8:117408153-117408175 ATATATAAGTGGAAGGAAAAAGG + Intergenic
1046851624 8:118980686-118980708 ATTTCTAAGTATATGGAAAATGG - Intergenic
1046885217 8:119359597-119359619 ATGGAAAAGAAGAGGGAAAATGG - Intergenic
1047192054 8:122687139-122687161 GCGTTTAAGTAGAGGGAAGAAGG - Intergenic
1047474600 8:125214534-125214556 AATTCTAAGCAGAGGCAAAAGGG - Intronic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1048396360 8:134017912-134017934 ATGCCTGAGCAGTGGGAAAAAGG - Intergenic
1050958791 9:11700457-11700479 AAATCTAAGTAGAAGGAAAGTGG + Intergenic
1054863970 9:69981006-69981028 ATCTCTCATTAAAGGGAAAAGGG + Intergenic
1055146521 9:72941902-72941924 ATGCCTAAATAAAGGGAAAAGGG + Intronic
1055214517 9:73842066-73842088 ATGTCTAATTAAAGGCAAAATGG + Intergenic
1055300039 9:74873203-74873225 ATGTCTAAGTTGGCGGAGAAAGG - Intronic
1055541126 9:77306444-77306466 GTGTGTAAAGAGAGGGAAAAGGG + Intronic
1057543223 9:95995880-95995902 AGGTCTAAGGAGAGGGATAGAGG - Intronic
1058140399 9:101351898-101351920 ATGGATAAGGAGAGGGGAAATGG + Intergenic
1186134733 X:6507116-6507138 AAGTCTATGAAGAGGGAAATGGG + Intergenic
1186276078 X:7939408-7939430 ATGTCTAAGTAAAGAAAAAATGG + Intergenic
1186350431 X:8733428-8733450 GTGTATAAGAATAGGGAAAAGGG - Intergenic
1186474597 X:9847525-9847547 AACTCTAATCAGAGGGAAAAGGG + Intronic
1186568489 X:10689768-10689790 ATGTGTAAGGAGAAGGAAATTGG - Intronic
1187775862 X:22756334-22756356 ATGTATATATAGAGAGAAAAGGG - Intergenic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188364596 X:29299594-29299616 ATGTCTAATTAGATTAAAAAAGG + Intronic
1188512368 X:30950140-30950162 AGGTCTAGGAAGAGGGCAAATGG - Intronic
1188569128 X:31561047-31561069 GTGTCTAAGAACAGGGCAAAGGG - Intronic
1188799739 X:34513842-34513864 TTGTCTAATTTGAGGTAAAATGG + Intergenic
1188985271 X:36763363-36763385 ATGTCTTAGTAGAAGAAAAATGG - Intergenic
1189654396 X:43226842-43226864 GGGTGTAAGTAGAGGGAAATTGG + Intergenic
1190713214 X:53083881-53083903 GTGTCTAGGTATAGAGAAAAAGG + Intronic
1191954960 X:66634231-66634253 ATGTCCAAGAAAAGGGAGAAAGG + Intronic
1194787846 X:98108369-98108391 ATGTGTAAGTCTAAGGAAAAGGG + Intergenic
1195469808 X:105219253-105219275 ATGTCTGAGAAGGAGGAAAAAGG + Exonic
1195642379 X:107190752-107190774 ATGCCTAAGTAGCAGGAATAAGG + Intronic
1196207566 X:112958121-112958143 ATCCCAAAGTACAGGGAAAATGG + Intergenic
1196805676 X:119583402-119583424 ATGTTTAAGGAGAGGGTAGAAGG - Exonic
1199571048 X:149267675-149267697 ACTTCTAAGTGGAGGTAAAAGGG + Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic