ID: 1091097638

View in Genome Browser
Species Human (GRCh38)
Location 11:132839233-132839255
Sequence AACGGCCTTGGGAAATCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091097632_1091097638 5 Left 1091097632 11:132839205-132839227 CCTAGCAGAGTGGTAATGAGAAT 0: 1
1: 0
2: 1
3: 17
4: 201
Right 1091097638 11:132839233-132839255 AACGGCCTTGGGAAATCAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091097638 Original CRISPR AACGGCCTTGGGAAATCAGG TGG Intronic
900460334 1:2799611-2799633 AAGGGCCTTGGGAGGCCAGGAGG + Intronic
900591829 1:3463559-3463581 AAGGGCCTGGGGAAGCCAGGTGG + Exonic
902156986 1:14495687-14495709 AGTAGCCTCGGGAAATCAGGAGG + Intergenic
905933368 1:41805506-41805528 AATGGCCTTGGGCAAGCTGGGGG + Intronic
911470489 1:98312361-98312383 AAAGGACTTTGGAAATCGGGGGG + Intergenic
912501044 1:110121970-110121992 AACGGCCCCAGGAAATCAGGCGG - Intergenic
912590487 1:110814012-110814034 AACGGGCTTGGGACTTCAGTTGG + Intergenic
915111896 1:153569166-153569188 AACGGCCTGGGGAAAGGGGGTGG - Intergenic
917526481 1:175792638-175792660 GGTGTCCTTGGGAAATCAGGTGG + Intergenic
918972667 1:191439893-191439915 ATGGGGCTTGGGAAATCAAGTGG + Intergenic
922439891 1:225646335-225646357 AATGGCCTTATGAAATGAGGAGG + Intronic
1070160234 10:73862306-73862328 AAGTGCATTGGGAAATCGGGGGG - Intronic
1070195901 10:74156180-74156202 AAGGGCCTTAGGAAAACAAGGGG + Intronic
1072204782 10:93193664-93193686 CACGGCCGTGGGAAATTAGATGG - Intergenic
1073631876 10:105157365-105157387 AAGGGTCTTAGGAACTCAGGTGG + Intronic
1074285635 10:112095260-112095282 ACCCGCCTTGGGAAGTCAGGGGG - Intergenic
1074517814 10:114187260-114187282 AGAGGCCTTGGCAAAACAGGAGG + Intronic
1074969914 10:118527705-118527727 AAAGGACTTGGGCACTCAGGAGG - Intergenic
1075786499 10:125053547-125053569 AAGGCCCTTGGGAAATCAACAGG + Intronic
1081906191 11:46672025-46672047 AACGGCCTTGGGAGTCCAAGTGG - Intronic
1086139469 11:83479268-83479290 AAAGGCTTTGGAAAATCAGAGGG - Intronic
1088282624 11:108150952-108150974 AAAGGCCAAGGGAAACCAGGAGG - Intergenic
1088975883 11:114816144-114816166 TACAGCCTTGGGGATTCAGGAGG - Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089531512 11:119132843-119132865 AGCTGCCATGAGAAATCAGGAGG - Exonic
1091097638 11:132839233-132839255 AACGGCCTTGGGAAATCAGGTGG + Intronic
1091105287 11:132913581-132913603 GTCGGCCTTGTGAAATGAGGAGG - Intronic
1091565031 12:1641950-1641972 ATCAGCCATGGGACATCAGGTGG + Intronic
1094367323 12:29698024-29698046 AAAGGCCCTTGGAAATCAGGAGG + Intronic
1096509006 12:52116856-52116878 AACGGCCTATGGAACTCTGGGGG - Intergenic
1098385129 12:69910385-69910407 AACGGCATTGGGCAGTCGGGAGG + Intronic
1100021213 12:90071450-90071472 AACAGCTGTGGGAAAGCAGGAGG + Intergenic
1103762939 12:123264619-123264641 AACGTCCTTTCGAAATCAGACGG + Intronic
1111316439 13:86567186-86567208 GACTGCCTGGGGAAAGCAGGGGG + Intergenic
1114628635 14:24145843-24145865 AAGGGCCTTTGGAAATCACTGGG + Intronic
1115514201 14:34168790-34168812 AACGGCCTTGTAAAATAAGTGGG - Intronic
1119318820 14:73717601-73717623 TAGGGCCTTGGGAATTTAGGGGG + Exonic
1121520660 14:94584089-94584111 AACCGCCTGGGGATACCAGGAGG + Intronic
1124637426 15:31373972-31373994 AACGGCCCTGGGACCTCAGAGGG + Exonic
1125709075 15:41769190-41769212 GAGAGTCTTGGGAAATCAGGAGG - Exonic
1127905200 15:63371278-63371300 AATTTCCTTTGGAAATCAGGGGG - Intronic
1128121144 15:65147490-65147512 AAAGGCCTTGAGAAATGAGAGGG + Intergenic
1128213590 15:65918671-65918693 GAGGGCCTTGTGAACTCAGGAGG - Intronic
1129826860 15:78640275-78640297 AAGGGCCCTTGGAATTCAGGTGG + Intronic
1132140017 15:99384672-99384694 AAAGGCATTGGGAAAGCAAGTGG - Intronic
1134107089 16:11492953-11492975 AAAGGCCTGGGGACATCTGGAGG + Intronic
1134350164 16:13430059-13430081 AAAGGCCATGTGAAATCAGAGGG + Intergenic
1134423001 16:14111987-14112009 AATGCCCTTGAGAGATCAGGGGG - Intronic
1137664918 16:50244577-50244599 GAAGGCCTTGGGGAAACAGGTGG + Intergenic
1138913722 16:61436360-61436382 AATGGCCTTGGGAATTTATGAGG + Intergenic
1143274123 17:5697278-5697300 AACAGCCTTGGGAAATAGGCAGG + Intergenic
1147669954 17:42171172-42171194 AAGGGGATTGGGAAATCAGTAGG + Intronic
1148144039 17:45349780-45349802 ATGGACCTTGGGAACTCAGGAGG + Intergenic
1148439744 17:47705795-47705817 AAAGGCCATGGGGCATCAGGAGG + Intronic
1156323845 18:36054635-36054657 ATTGGCCATGGGAAATCTGGAGG + Intronic
1160913688 19:1487059-1487081 CGCGGCCCTGGGAAACCAGGAGG + Exonic
1161294659 19:3513547-3513569 AATGTCCTTGGGACAGCAGGTGG - Intronic
1165755735 19:38291750-38291772 AAGGGCCTGGGGAATCCAGGTGG - Intronic
928048561 2:27964943-27964965 AACTGCTTTGGGAAATAATGAGG + Intronic
929241960 2:39663066-39663088 AACTGCCGTGGGGAGTCAGGTGG - Intergenic
929697007 2:44126276-44126298 AACAGCCTTGTGAAATCAATAGG + Intergenic
929927662 2:46229143-46229165 AACCGCCCTGGGAAATGAGCAGG + Intergenic
930327121 2:49933925-49933947 AGAGGCCTTGTGAATTCAGGTGG + Intronic
931229290 2:60360477-60360499 AAAGCCCTGTGGAAATCAGGAGG + Intergenic
931997590 2:67854025-67854047 CAAGGCCTTGGGATACCAGGTGG - Intergenic
932215134 2:69961557-69961579 CCCGGCCTTGGGCAAGCAGGAGG + Exonic
936497058 2:113031543-113031565 AACGGCCTTTGAAAATCTCGGGG - Intronic
939081821 2:137671795-137671817 AACGTCCTTGGAAAATTAGAGGG - Intronic
1169704717 20:8489629-8489651 AACTGCCTCCAGAAATCAGGAGG + Intronic
1172446202 20:34994702-34994724 AAGGGCCATGGGAACCCAGGTGG + Intronic
1173685637 20:44921577-44921599 CACGGCCTGGGGAAAGGAGGAGG - Exonic
1174704372 20:52640541-52640563 AATGGACTTTGGAACTCAGGGGG - Intergenic
1176388149 21:6149947-6149969 GACAGACTTGGGAAACCAGGAGG - Intergenic
1177301328 21:19249285-19249307 AACGACTTTGGGTACTCAGGAGG - Intergenic
1178389822 21:32189103-32189125 AGCGGCCATGGAAAAGCAGGCGG + Intergenic
1179270677 21:39848169-39848191 AAGGCCCCTGGGAAACCAGGAGG - Intergenic
1179735323 21:43388301-43388323 GACAGACTTGGGAAACCAGGAGG + Intergenic
1182113290 22:27739632-27739654 AACGGCATTAGGAGATCACGTGG + Intergenic
950371404 3:12533941-12533963 AGCAGCCTTGTGAATTCAGGAGG + Intronic
951814780 3:26741918-26741940 AAGGGTCTTTGGAAAGCAGGAGG + Intergenic
953401184 3:42619025-42619047 AAAGGCCTTGGGAAAACAACTGG + Exonic
953416759 3:42725610-42725632 CAGGGCCTTGGGAAATGGGGAGG + Intronic
958571972 3:95895478-95895500 AACTGCCTTGGAAAATTATGTGG + Intergenic
961169175 3:124784205-124784227 ATCAGCATTGAGAAATCAGGTGG - Intronic
962949508 3:140204984-140205006 AAGGGAGTTGGGGAATCAGGAGG + Intronic
963610277 3:147458261-147458283 AGCTGCCCTGGGAAATCAGAGGG - Intronic
963751047 3:149180353-149180375 AAGAGCCTTGGCAAAGCAGGAGG - Intronic
964726313 3:159817835-159817857 AACGGCCTTGGGAATAAAGTAGG + Intronic
968273665 3:197423772-197423794 AAGAGCCTTAGCAAATCAGGGGG - Intergenic
973243926 4:47989809-47989831 AATGGACTTGGGGAATCAGGGGG - Intronic
975280977 4:72561934-72561956 AACTTCTTTGGAAAATCAGGAGG + Intronic
975616291 4:76251212-76251234 AAGGGCCTCTGGAAATCAGCTGG + Intronic
985306578 4:188548653-188548675 AACTGACTGGGAAAATCAGGAGG + Intergenic
986125344 5:4878908-4878930 AAGGTCCTTGGGAGACCAGGCGG + Intergenic
988643585 5:33068913-33068935 GACAGCCTTGGGAAATGGGGTGG + Intergenic
998471525 5:142387367-142387389 CAAAGCCTTGGGAAAACAGGTGG + Intergenic
1003886457 6:10525528-10525550 AAGGGCATTGGGAAAGCTGGAGG + Intronic
1004608133 6:17213097-17213119 AAGGGCCTTGGGAAAAGAGAAGG - Intergenic
1008361691 6:50626519-50626541 ATGGGCTTTGGGGAATCAGGGGG + Intergenic
1025066641 7:55862266-55862288 AACTCCCTTTGGAAATCAAGAGG + Intronic
1026375935 7:69750962-69750984 AAGGGCATTGGAAAATAAGGAGG + Intronic
1027978704 7:85188836-85188858 AAGTGCTTTGGGAAAACAGGAGG - Intergenic
1034278656 7:149836562-149836584 CAAGTCCTTGAGAAATCAGGAGG - Intergenic
1041876673 8:62695624-62695646 ACAAGCCTTGGGAAAGCAGGAGG + Intronic
1045989273 8:108286599-108286621 AACTGCCATGGCAAATCAGTGGG - Intronic
1047120763 8:121901986-121902008 AACAGCCTTGGGAAAACACCAGG + Intergenic
1047163539 8:122409605-122409627 AGAGGCCTGGTGAAATCAGGTGG + Intergenic
1048537980 8:135315468-135315490 AACGGGAGTGGGAAATTAGGTGG - Intergenic
1049064236 8:140300410-140300432 AAAAGCCATTGGAAATCAGGTGG + Intronic
1049303151 8:141882452-141882474 AACGGTCTTGGCAAAGCACGGGG + Intergenic
1051264720 9:15299484-15299506 AACGGACTTGGTGCATCAGGAGG + Intronic
1052394754 9:27925553-27925575 AACTTCTTTGGGAAATAAGGAGG + Intergenic
1052549828 9:29933690-29933712 AGTGGACTTGGGAACTCAGGGGG - Intergenic
1056508793 9:87283116-87283138 AAAGGCCATGGAAAATCGGGGGG + Intergenic
1059944969 9:119400128-119400150 TACGGCTTTGGCAAACCAGGTGG + Intergenic
1061676009 9:132216038-132216060 ACCAGCCTTGGGGAATCAGTCGG - Intronic
1187438022 X:19290350-19290372 ACCAGCCTAGGGAAATTAGGGGG - Intergenic