ID: 1091098363

View in Genome Browser
Species Human (GRCh38)
Location 11:132845554-132845576
Sequence CAGATGTTCTCTGGGATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091098354_1091098363 18 Left 1091098354 11:132845513-132845535 CCTCCCAGTAGCTATGGGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1091098363 11:132845554-132845576 CAGATGTTCTCTGGGATCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 263
1091098356_1091098363 15 Left 1091098356 11:132845516-132845538 CCCAGTAGCTATGGGGAGGGATT 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1091098363 11:132845554-132845576 CAGATGTTCTCTGGGATCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 263
1091098357_1091098363 14 Left 1091098357 11:132845517-132845539 CCAGTAGCTATGGGGAGGGATTA 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1091098363 11:132845554-132845576 CAGATGTTCTCTGGGATCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091098363 Original CRISPR CAGATGTTCTCTGGGATCCC AGG Intronic
900546094 1:3230066-3230088 CTGCAGCTCTCTGGGATCCCTGG + Intronic
900922841 1:5684596-5684618 CTGAAGTTCTCTGGAATCTCAGG - Intergenic
902156549 1:14492259-14492281 CAGATGGCCTCAGGGCTCCCTGG + Intergenic
902465161 1:16613090-16613112 CGGGTGTTCTGTGGCATCCCAGG - Intronic
902982697 1:20137361-20137383 CAGAGGCTCTCAGGGGTCCCCGG + Intergenic
903133335 1:21293291-21293313 CAAATGCTGTCTGGGGTCCCTGG - Intronic
903155646 1:21440581-21440603 CGGGTGTTCTGTGGCATCCCAGG + Intronic
903539563 1:24089473-24089495 CAGATGTGCTGTGGGACCCTGGG - Intronic
903747481 1:25597715-25597737 TTGATGTTCTCTGGGATCTAGGG + Intergenic
904895929 1:33818229-33818251 CAGCTGGTGTCTGGGCTCCCTGG + Intronic
907589481 1:55652538-55652560 CATCTGTTCACTGGCATCCCAGG + Intergenic
908039306 1:60090849-60090871 CAGCTGTTCACATGGATCCCAGG - Intergenic
908946614 1:69505784-69505806 CAAATGTTCTCTTGCTTCCCTGG - Intergenic
910646226 1:89518306-89518328 GAGATATTTGCTGGGATCCCTGG - Intergenic
911942691 1:104068304-104068326 CAGATGCTGTCTGGGAGCCAGGG + Intergenic
912102646 1:106231217-106231239 GAGATGTTGTCTGGAATTCCTGG - Intergenic
913600300 1:120415513-120415535 CGGGTGTTCTGTGGCATCCCAGG + Intergenic
913994749 1:143642972-143642994 CGGGTGTTCTGTGGCATCCCAGG - Intergenic
914192656 1:145425091-145425113 CGGGTGTTCTGTGGCATCCCAGG - Intergenic
914361457 1:146939222-146939244 CGGGTGTTCTGTGGCATCCCAGG + Intronic
914491149 1:148151488-148151510 CAGGTGTTCTGTGGCATCCCAGG - Intronic
914590566 1:149103040-149103062 CGGGTGTTCTGTGGCATCCCAGG - Intronic
915928205 1:160040583-160040605 CAGATCTTCTCTGGGCTGCCTGG + Exonic
916688132 1:167166370-167166392 CAGCTGACCTCTGGGGTCCCCGG - Intergenic
918018678 1:180663762-180663784 GAGATGCTCTCTGGGAGCCAGGG + Intronic
919129871 1:193438307-193438329 GAGATGTTGTCTGGGAGCCTGGG + Intergenic
919327965 1:196133366-196133388 AAAGTGTTCTTTGGGATCCCTGG + Intergenic
920340171 1:205270710-205270732 CAGATGCTCTCTGGGTACCAGGG - Intronic
920707874 1:208267903-208267925 CAGATGTGCTATGGGTTCCTAGG + Intergenic
920758776 1:208761569-208761591 AAAACGTTCTCTGTGATCCCGGG + Intergenic
924938146 1:248789784-248789806 CAAATGTTCTCAGGACTCCCTGG - Intergenic
1064688542 10:17890321-17890343 CTGATGTTCTCTGAGCTTCCTGG + Intronic
1066612579 10:37265519-37265541 AATCTGTTCTCTGGGCTCCCAGG + Intronic
1067048255 10:42997920-42997942 CTGATGTGCCCTGGGGTCCCTGG - Intergenic
1067771594 10:49130585-49130607 AAGATGTTTACTGGCATCCCTGG - Intergenic
1069662296 10:70131830-70131852 CAGGTGTGATCTGAGATCCCGGG + Intronic
1069772044 10:70906245-70906267 CCACTGTCCTCTGGGATCCCAGG - Intergenic
1072438453 10:95434225-95434247 CAGAGGTTCTCTGTGAGACCAGG + Intronic
1072564774 10:96608315-96608337 GAGATGTCCTCAGGGATCACAGG - Intronic
1074972061 10:118547174-118547196 TAGTTCTTCTCTGGAATCCCTGG - Intergenic
1076145376 10:128114969-128114991 CAGATGTGCTCTGGGTTACCTGG - Exonic
1076310785 10:129506153-129506175 GGGATGTTCACTGGCATCCCTGG - Intronic
1077601774 11:3579740-3579762 CGAATTTTCTCTGAGATCCCGGG - Intergenic
1078351073 11:10594036-10594058 CAGAGATTCTCTGGCATCCATGG + Intronic
1078887877 11:15523518-15523540 CAAATGTTTTCTGGGTCCCCTGG - Intergenic
1079416271 11:20238996-20239018 CTGAAGTGCTCTGGGATCCCAGG - Intergenic
1081444805 11:43120237-43120259 CAAATGGTCTGTGTGATCCCAGG + Intergenic
1085415769 11:76318306-76318328 CAGATCTGCTCTGGGCTCCCAGG - Intergenic
1085815617 11:79734150-79734172 CAGCTCTTCTCAGGGCTCCCAGG + Intergenic
1088799121 11:113289492-113289514 CAAATGTTCACTGGAGTCCCTGG + Intergenic
1089117144 11:116104808-116104830 GAGAAGTTCTCTGGGTTGCCTGG + Intergenic
1091098363 11:132845554-132845576 CAGATGTTCTCTGGGATCCCAGG + Intronic
1092242086 12:6841364-6841386 CAGCTGTTTTCTGGGGCCCCAGG - Intronic
1092427916 12:8389109-8389131 CGAATTTTCTCTGAGATCCCGGG - Intergenic
1092429183 12:8396096-8396118 CGAATTTTCTCTGAGATCCCGGG - Intergenic
1092938740 12:13387649-13387671 CAGTTGTCCTCAGGGGTCCCAGG - Intergenic
1096718674 12:53505747-53505769 CAGTTGCTCCCTGGGCTCCCTGG + Exonic
1103061063 12:117858978-117859000 GAGTCGGTCTCTGGGATCCCAGG + Intronic
1104913557 12:132252017-132252039 CGGATCTTAACTGGGATCCCAGG + Intronic
1106182415 13:27380889-27380911 CAGAAGTGCTCAGGGATCCTGGG - Intergenic
1107648949 13:42525095-42525117 TAGATGTTCTCTGGTACCCCTGG + Intergenic
1108062982 13:46552079-46552101 CAGATGTTCTCTGTCGCCCCTGG + Intergenic
1108821724 13:54358831-54358853 CACATGTTCTCAGGGCTCCCTGG + Intergenic
1110916733 13:81030491-81030513 GAGATGCTCTCTGGGAGCCAGGG + Intergenic
1110996500 13:82116447-82116469 CAAAATTTCTCTGAGATCCCCGG - Intergenic
1117634727 14:57729822-57729844 CTGAAGTGCTCTGGGGTCCCAGG - Intronic
1117804271 14:59474245-59474267 CAGATATTCTCTGGGATATTTGG - Intronic
1118683670 14:68269396-68269418 CTGATCTACTCTGGGTTCCCAGG + Intronic
1118774660 14:68966312-68966334 CAGATGATCTCTGGGGTCTGCGG - Intronic
1121387974 14:93546897-93546919 CAGATTGTCTCTGAGATCCATGG - Intronic
1122262468 14:100531191-100531213 CAGGGGGTCACTGGGATCCCTGG + Intergenic
1125546090 15:40506570-40506592 CAGATATTCACTGGGTTCCCAGG - Intergenic
1125566160 15:40680018-40680040 GAGATGTTGTCTGGGAGCCAGGG + Intergenic
1125728299 15:41879338-41879360 CAGGTGTCCTCTGAGCTCCCTGG + Exonic
1126671994 15:51124772-51124794 CAGATATTCACTGGGAAGCCTGG - Intergenic
1128555843 15:68631144-68631166 CAGGTGTTCCCTGGGAGCACTGG - Intronic
1128881082 15:71243450-71243472 CAGAGGTTCTCTGCTATTCCAGG + Intronic
1129079719 15:73028232-73028254 CAGATGGGCTCTGAGTTCCCTGG - Intergenic
1129557745 15:76530661-76530683 CAGATGTTCTCTCATTTCCCTGG - Intronic
1130063001 15:80582990-80583012 CAGATGGTCCCTGGGCTTCCGGG - Intronic
1130316802 15:82803133-82803155 GAGAAGTACTCTGGGGTCCCAGG - Intronic
1130873863 15:87995166-87995188 CAGGTGCTCTCTGGGCTCCATGG - Intronic
1130961779 15:88664195-88664217 GAGATGCTCTCTGGGAGCCAGGG - Intergenic
1132148059 15:99440203-99440225 CAGATGATCTCCGTGGTCCCCGG - Intergenic
1136710664 16:32234220-32234242 GAGCTGTCCTCTGGGATTCCAGG - Intergenic
1136757247 16:32695191-32695213 GAGCTGTCCTCTGGGATTCCAGG + Intergenic
1136810861 16:33175184-33175206 GAGCTGTCCTCTGGGATTCCAGG - Intergenic
1136817337 16:33285264-33285286 GAGCTGTCCTCTGGGATTCCAGG - Intronic
1136823900 16:33341793-33341815 GAGCTGTCCTCTGGGATTCCAGG - Intergenic
1137012053 16:35331221-35331243 AGGATGTTCACTGGGATTCCAGG - Intergenic
1138019568 16:53466025-53466047 CAGATCTTCTCTGGGATGTTGGG + Intronic
1138574758 16:57900591-57900613 CAGATGTTTTCTGGGATCAGAGG + Intronic
1140023883 16:71265839-71265861 CAGATGTTCACTGCCATACCTGG - Intergenic
1141952696 16:87348854-87348876 CAGTTGTTCTGCGGGATCCAGGG - Intronic
1203059397 16_KI270728v1_random:955542-955564 GAGCTGTCCTCTGGGATTCCAGG + Intergenic
1143442451 17:6986014-6986036 CACCCCTTCTCTGGGATCCCCGG - Intronic
1146723064 17:35136880-35136902 CAGATGTGTGCTGGGAGCCCTGG - Intronic
1147239462 17:39081013-39081035 CAGATGAGCCCTGGGATCCTGGG - Intronic
1147818685 17:43228738-43228760 CAGATGTTCCCTGGGAGCCTTGG - Intergenic
1147819089 17:43231262-43231284 CAGATGTTTCCTGGGAGCCTTGG + Intergenic
1147831968 17:43303440-43303462 CAGATGTTCCCTGGGAGCCTTGG - Intergenic
1147832371 17:43305967-43305989 CAGATGTTCCCTGGGAGCCTTGG + Intergenic
1148567330 17:48641464-48641486 CTGATGATCTCTGGGCTCCCGGG - Intergenic
1151269120 17:72979418-72979440 CAGATGTGCTCTCGGAGTCCAGG - Intronic
1151959365 17:77397425-77397447 CAGATGTGATTAGGGATCCCGGG - Intronic
1152513417 17:80805581-80805603 CAGATTTTCTGTGGGCTTCCCGG - Intronic
1152780923 17:82227152-82227174 CAGGTGCTCCCTGGGACCCCTGG + Intergenic
1153413692 18:4822636-4822658 CATATGTTCTCAGGACTCCCTGG - Intergenic
1155493958 18:26424813-26424835 CAGATGGTCTCTGGTAACCTTGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157230161 18:45908219-45908241 CAGGAGTTCTCTGGGAGCCGTGG - Intronic
1157943467 18:51954194-51954216 AAGAAGTACTCTGGGGTCCCAGG - Intergenic
1157977020 18:52339536-52339558 CAGGTGTTCTGTTGGCTCCCAGG - Intergenic
1162101356 19:8341048-8341070 CAGCTGTCTTCTGAGATCCCAGG - Intronic
1162391186 19:10391119-10391141 CAGATGCTCTCTGGGCTGCTGGG - Exonic
1162492464 19:11001575-11001597 CACATCCTCTCTGGGATCACTGG - Intronic
1163167736 19:15509224-15509246 AAGATGTTTTCTGGCCTCCCAGG + Intronic
1165444581 19:35849768-35849790 CTGATCTCCTCTGGGATCCAGGG + Intronic
1166920623 19:46226830-46226852 CTGATGTTCCCAGGGCTCCCGGG - Intergenic
1167721796 19:51184773-51184795 CAGACGTTCCCTGGCAGCCCTGG + Intergenic
1167953082 19:53043492-53043514 AAGTTGTTCTCTGTGATCTCAGG + Intergenic
925426515 2:3753126-3753148 CTGCTTTTCTCTGGGATACCAGG + Intronic
926869602 2:17399277-17399299 CAGATGTACTCTGAGTTCTCAGG + Intergenic
926923217 2:17960149-17960171 CAGATGGTTTCTGTCATCCCAGG - Intronic
927502074 2:23589584-23589606 GAGATCTTCTCTGGGGTCCTGGG - Intronic
927508621 2:23630396-23630418 CAGATGTGCTCTGGGATGGCAGG - Intronic
930407736 2:50982012-50982034 CAGATGTTCTTTTGGATTTCAGG - Intronic
930891862 2:56399523-56399545 CTGATGTTCTCTGAGTTACCTGG + Intergenic
931817374 2:65918121-65918143 CAGATGTTCTGTGGGAGCTTAGG - Intergenic
932503329 2:72204318-72204340 TTGAGGTTCTCTGGGGTCCCGGG + Intronic
932921079 2:75916250-75916272 GAGATGTTGTCTGGGAGCCAGGG + Intergenic
935811349 2:106800563-106800585 CAAATGGTATCTGGGACCCCTGG + Intergenic
935946554 2:108291658-108291680 CAGATGTTGGCTGCGATCCTGGG + Intronic
937042641 2:118834088-118834110 CAGGTATGCTCTGGGGTCCCGGG - Intergenic
937346885 2:121131750-121131772 CGGATGTTCCCTGGGAATCCGGG - Intergenic
937902246 2:127029481-127029503 AAGATGTACTCTGGGCTCCTTGG + Intergenic
940492295 2:154378194-154378216 AAGAGGTTCACTGGGATCGCAGG + Intronic
940947645 2:159636571-159636593 CTGAAGTGCTCTGGGGTCCCAGG + Intergenic
941830188 2:169948822-169948844 AAGATGTTTTCTGAGAGCCCTGG + Intronic
946075552 2:217070643-217070665 CTGAGGTTGTCTGGCATCCCTGG - Intergenic
946446111 2:219741075-219741097 CAGATGTTTTCTAAGCTCCCAGG - Intergenic
947023481 2:225710393-225710415 GAGATGTTTTCTAGGTTCCCTGG - Intergenic
947766330 2:232640210-232640232 CAGAGGTTCTGTGGTACCCCTGG + Intronic
948360064 2:237413520-237413542 GAGATGTTCTCTGAGCTCTCTGG - Intronic
949057685 2:241937365-241937387 CTCATGTTCTCAGGGAGCCCAGG + Intergenic
1171495371 20:25551173-25551195 CACATGTTTTCTGGGAGCACAGG + Intronic
1172711147 20:36924588-36924610 CAGCTGTTATGTGGGATGCCAGG - Intronic
1172970935 20:38872645-38872667 CAGTGGTTCTCAGTGATCCCTGG - Intronic
1173828378 20:46062198-46062220 AGGATGTTCTCTGCGCTCCCAGG - Exonic
1174080358 20:47967107-47967129 AAGATGTTGCCTGGGAGCCCTGG - Intergenic
1174137237 20:48388171-48388193 AAGATGTTGCCTGGGCTCCCTGG + Intergenic
1174838956 20:53883858-53883880 CAGAAGTGCACTGGGATGCCGGG + Intergenic
1175037368 20:56012675-56012697 CAGATGTTCACTGAGTGCCCTGG - Intergenic
1175040474 20:56045211-56045233 CAAATGCTCTCTGGGACCTCAGG + Intergenic
1177212795 21:18091232-18091254 CTGAAGTGCTCTGGGATCCCAGG + Intronic
1180077702 21:45471520-45471542 CAGATGGTGCCTGGGACCCCCGG + Intronic
1180763281 22:18224706-18224728 CAGATGTGCTCTGGCCTCCAAGG - Intergenic
1180772366 22:18399841-18399863 CAGATGTGCTCTGGCCTCCAAGG + Intergenic
1180803744 22:18649457-18649479 CAGATGTGCTCTGGCCTCCAAGG + Intergenic
1180807020 22:18719992-18720014 CAGATGTGCTCTGGCCTCCAAGG - Intergenic
1181217975 22:21345802-21345824 CAGATGTGCTCTGGCCTCCAAGG - Intergenic
1181488606 22:23247367-23247389 CTGATGATCTCTGTGCTCCCTGG + Intronic
1183341346 22:37283592-37283614 CAGTGGTTCTCTGGGTTCCCTGG - Intronic
1183776492 22:39969543-39969565 CTGTCCTTCTCTGGGATCCCTGG + Intronic
1184561192 22:45263799-45263821 CAGCCTTGCTCTGGGATCCCAGG - Intergenic
1185078212 22:48694663-48694685 CTGATGTTCTCTGTGTCCCCGGG + Intronic
1185401619 22:50621465-50621487 CACAGGTTCTCTGGTGTCCCTGG + Intergenic
1203234205 22_KI270731v1_random:140829-140851 CAGATGTGCTCTGGCCTCCAAGG + Intergenic
952987576 3:38799938-38799960 GAAAGGGTCTCTGGGATCCCTGG + Intergenic
953534660 3:43768629-43768651 CAGATGGGTTGTGGGATCCCAGG + Intergenic
954139621 3:48598210-48598232 GTCAGGTTCTCTGGGATCCCAGG - Intergenic
954197421 3:49004970-49004992 CAGATGGTCTCTGGGTACACAGG - Exonic
954376006 3:50194428-50194450 CACCTGCTCTCTGGGCTCCCGGG - Intronic
955974754 3:64469199-64469221 CAAAGATGCTCTGGGATCCCCGG + Intergenic
957035142 3:75287505-75287527 CATTTGGTCTCTTGGATCCCTGG + Intergenic
957825274 3:85433918-85433940 AAGATATTCTTTTGGATCCCTGG + Intronic
958632220 3:96699387-96699409 GAGATGCTATCTGGGATCCACGG + Intergenic
959033099 3:101325899-101325921 CAGATGTTCTCTAAGATTACTGG - Exonic
961670580 3:128525859-128525881 CAGAGGGTCTCTGGGATCCTAGG + Intergenic
963012596 3:140786880-140786902 CAGATGTTCTCACTGATACCTGG + Intergenic
963863949 3:150340363-150340385 CAGAACTGCTCTGGGTTCCCAGG - Intergenic
967513352 3:190338199-190338221 CATATCTTCTCTGGGACCTCTGG - Intronic
969119992 4:4901062-4901084 CAGGTGCTCAATGGGATCCCTGG - Intergenic
969255522 4:5999196-5999218 CTGATGTGCTCTGGGAGCCATGG - Intergenic
969533782 4:7743534-7743556 CAGACGCTCACTGGGATGCCAGG - Intergenic
969567963 4:7991430-7991452 CAGCTGTTCTCTGACAGCCCTGG - Intronic
969635334 4:8365862-8365884 CAAAAGTTCTCTGGGCTACCTGG + Intergenic
970853273 4:20626832-20626854 CAGCTGTTCTCTGACCTCCCTGG - Intergenic
971808585 4:31394011-31394033 AGGATTTTCTCTGGGATGCCAGG + Intergenic
972217958 4:36918045-36918067 CAGATGTTGTCTGACCTCCCTGG + Intergenic
975601258 4:76101769-76101791 CAGATGTCCTCAAGGATACCGGG + Intronic
976722120 4:88178921-88178943 CAGATGTCATCTGGGAGCCAGGG - Intronic
983493178 4:168412550-168412572 GAGATGTTGTTTGGGATCCAGGG - Intronic
985169681 4:187135714-187135736 CAGATTTGTTCTGGGATGCCAGG + Intergenic
985913317 5:2899256-2899278 CAGATGCTCTCAGGCCTCCCTGG + Intergenic
987249602 5:16085343-16085365 CTGATGTTTTTTGGGATCGCAGG - Intronic
992942433 5:81775271-81775293 CCGCTGATCTGTGGGATCCCTGG + Intergenic
993557606 5:89360650-89360672 CAGATGTCCAGTGGCATCCCTGG + Intergenic
994147019 5:96406600-96406622 CAGTTTATCTCTAGGATCCCTGG - Intronic
996555246 5:124771643-124771665 CAAAAGCTCACTGGGATCCCAGG - Intergenic
997151993 5:131506963-131506985 CAGATGTTTTCTAGGATACGGGG + Intronic
997260734 5:132463967-132463989 TAGATGTTCTCTGGGACCTGAGG - Exonic
999153442 5:149441873-149441895 CAGCTGTTGTTTGGGAGCCCCGG + Intergenic
1000718781 5:164680136-164680158 CAAATGTTCTTAGGGATTCCTGG - Intergenic
1000790129 5:165595960-165595982 CAGATGTTCCCTGGGATTGTAGG - Intergenic
1001697477 5:173682699-173682721 CAGAAGATCTCTGTGATCACAGG + Intergenic
1002787395 6:413476-413498 CAGATTTTATCTGAGATACCTGG + Intergenic
1002795042 6:465366-465388 GAGATGTTGCCTGGGATTCCTGG - Intergenic
1002954187 6:1845993-1846015 CATATGATCCCTGGGATACCAGG + Intronic
1004502883 6:16224837-16224859 CAGTCTTTCTCTGGGGTCCCAGG + Intergenic
1006986671 6:38180152-38180174 CTGAGGATTTCTGGGATCCCAGG - Intronic
1007699547 6:43758749-43758771 CAGACATTCTCTGGAAGCCCAGG - Intergenic
1009744907 6:67799485-67799507 GAGATGTTGTCTGGGAGCCAGGG - Intergenic
1012665613 6:101964684-101964706 CAGAATTTCCCTGGGATGCCAGG - Intronic
1013422469 6:109978963-109978985 CCGATTTGCTCTGGGGTCCCAGG + Intronic
1017335792 6:153258369-153258391 TTGATATTCTCTGGGATTCCTGG + Intergenic
1018898830 6:168040683-168040705 CAAAAGTCCACTGGGATCCCAGG + Intronic
1018924345 6:168195879-168195901 CAGATGTGATCTGGGCTCGCGGG - Intergenic
1018958259 6:168427835-168427857 GAGAGGTTCCCTGGGCTCCCTGG - Intergenic
1019429180 7:990908-990930 CAGCTGTTGTCAGGGCTCCCGGG + Intergenic
1019720655 7:2568605-2568627 CAGAGGTGCGCTGGGCTCCCAGG + Intronic
1020097404 7:5376701-5376723 CAGATGTTCTCTCTGAACCCCGG + Intronic
1022388988 7:29927404-29927426 CAGCTGTGGCCTGGGATCCCAGG + Intronic
1022758882 7:33326108-33326130 GAGATGCTCTCTGGGAGCCAGGG + Intronic
1023557668 7:41439956-41439978 AACATGTTCCCTGGAATCCCTGG + Intergenic
1023991193 7:45129893-45129915 CAGAGGGTCTTTGGGACCCCTGG - Intergenic
1024331091 7:48156114-48156136 CAGCTGTTCTTTGACATCCCTGG - Intergenic
1025738148 7:64173224-64173246 CAGATGCTCCCTGGAATCTCTGG - Intronic
1028308826 7:89303007-89303029 GAGATTTTCTCTGAGATCCTGGG + Intronic
1029324358 7:99793251-99793273 GTGATGTTATCTGGGGTCCCCGG - Intergenic
1033306267 7:140228001-140228023 CAGATGTGCCCTGGGAGACCAGG - Intergenic
1033480427 7:141734908-141734930 CAGATATTCTCTGGGATGTTTGG - Intergenic
1033491511 7:141847980-141848002 CAGATATTCTCTGGGATATTTGG - Intergenic
1033502426 7:141965456-141965478 CAGATGATATCTGGGAGCCAGGG + Intronic
1033541023 7:142356255-142356277 CAGAGATTCTCTGGGAGCTCTGG - Intergenic
1034691463 7:153017641-153017663 CAGTTGTTCTGCGGGCTCCCAGG - Intergenic
1035357617 7:158286058-158286080 CACATGTTCTCCAGGCTCCCTGG + Intronic
1035970066 8:4238153-4238175 AAGATGTCCTTTGGGATTCCAGG - Intronic
1036223647 8:6940869-6940891 CAGCAGCTCTCTGGGATGCCAGG + Intergenic
1036718739 8:11152318-11152340 CAGATGTTTTCTGGAATCAGAGG - Intronic
1037295702 8:17397597-17397619 GAGATGTTGTCTGGGAGCCAAGG - Intronic
1038245021 8:25847338-25847360 CAGCTGGTGTCTGAGATCCCAGG + Intronic
1038911321 8:31967896-31967918 GAGATGTTCTCTGGGAGGGCTGG - Intronic
1040545765 8:48396915-48396937 CGGATGTGCTCTGGGACCCAGGG - Intergenic
1041442227 8:57909598-57909620 CTGGTGTTCTCTGAGCTCCCCGG - Intergenic
1044539788 8:93395539-93395561 TATATGTCCTCTGGGCTCCCTGG + Intergenic
1047190831 8:122677708-122677730 CAGGCATTCTCTGGGGTCCCTGG + Intergenic
1047191001 8:122679082-122679104 CAGGCATTCTCTGGGGTCCCTGG + Intergenic
1048272102 8:133037739-133037761 CAGAGCTTCTCTGGGATGCTGGG - Exonic
1049220040 8:141424955-141424977 CAGCTGTGCCCTGGGAGCCCTGG + Intronic
1049364023 8:142227708-142227730 CAGATGTTGTTTCGCATCCCTGG - Intronic
1049855104 8:144856820-144856842 CAGACTTGCTCTGGGATCCTGGG - Intergenic
1050059121 9:1687229-1687251 CAGATGTCCTCTGGGGTTCCAGG - Intergenic
1050316092 9:4402014-4402036 GAGATGTTGTCTGGGAGCCAGGG - Intergenic
1051691380 9:19716509-19716531 CAGATCTCCCCTGGGATCACAGG - Intronic
1052398770 9:27974288-27974310 CAGATCTTTTCTGCAATCCCAGG - Intronic
1053577943 9:39371868-39371890 CAATTGTGCTGTGGGATCCCAGG + Intergenic
1053842469 9:42199927-42199949 CAATTGTGCTGTGGGATCCCAGG + Intergenic
1054099527 9:60930653-60930675 CAATTGTGCTGTGGGATCCCAGG + Intergenic
1054120924 9:61206277-61206299 CAATTGTGCTGTGGGATCCCAGG + Intergenic
1054586814 9:66976230-66976252 CAATTGTGCTGTGGGATCCCAGG - Intergenic
1055234758 9:74107474-74107496 TAGATGTTATCTGGCAACCCTGG + Intergenic
1057700444 9:97360138-97360160 GAGCTGTTGTCTGGGCTCCCAGG + Intronic
1057724374 9:97557652-97557674 AAGATGTTCTCCTGCATCCCAGG - Intronic
1058370878 9:104266086-104266108 CAGATATTCTCTGGGATGCTGGG - Intergenic
1060084048 9:120680656-120680678 GAGATGTTGTCTGGGAGCCAGGG + Intronic
1062564426 9:137157637-137157659 CAGATGTTCACTTGGGTCTCTGG - Intronic
1062610147 9:137369893-137369915 CAGAAGCTCTCTGGGCACCCGGG + Intronic
1185633409 X:1534538-1534560 CAGGTGGACACTGGGATCCCTGG + Intronic
1186034207 X:5403258-5403280 CAGATCTTCTCTGGTCTCCGGGG - Intergenic
1186659027 X:11649260-11649282 CAGCTGGTGTCTGGGATGCCTGG - Intronic
1192165630 X:68826160-68826182 CAGATGTTCTCCTGCATCTCTGG + Intergenic
1192400315 X:70827759-70827781 AAGATGCTCTCTGGGAGCCAGGG - Intronic
1192592152 X:72369248-72369270 CAGAGCTTCTGTGGGAGCCCTGG - Intronic
1193005053 X:76606985-76607007 GAGATGTTTTCTGGGAGCCAGGG - Intergenic
1194403615 X:93467818-93467840 CAGGGGTTCTCAGGGATCCAAGG - Intergenic
1195199427 X:102533312-102533334 GAGATGCTGTCTGGGATCCAGGG - Intergenic
1195342128 X:103916521-103916543 AAGATGTTCTCTGAGGTCCTGGG - Intergenic
1196119987 X:112039539-112039561 CAGATGCTCTCTGGGAGCTTGGG + Intronic
1197458047 X:126702138-126702160 GAGATGCTCTCTGGGAGCCACGG - Intergenic
1197785181 X:130191244-130191266 CAGATGTGCTGAGAGATCCCTGG + Intergenic
1200236816 X:154471770-154471792 GTGATGCTCTCTGGGATCACAGG + Intronic
1201514080 Y:14798130-14798152 CAGATGTTCTGTGCTATCACTGG + Intronic
1201630820 Y:16070583-16070605 CAGAGGCTCTCTTGGAACCCAGG + Intergenic