ID: 1091099935

View in Genome Browser
Species Human (GRCh38)
Location 11:132862609-132862631
Sequence CTGTGTCCTAGCTAGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091099935_1091099944 15 Left 1091099935 11:132862609-132862631 CCAGCATCCTAGCTAGGACACAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1091099944 11:132862647-132862669 GGTGGGCTGGGGAGATATTTCGG 0: 1
1: 0
2: 2
3: 33
4: 317
1091099935_1091099940 -2 Left 1091099935 11:132862609-132862631 CCAGCATCCTAGCTAGGACACAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1091099940 11:132862630-132862652 AGGCAGCTGAGAAAGATGGTGGG 0: 1
1: 0
2: 3
3: 21
4: 371
1091099935_1091099939 -3 Left 1091099935 11:132862609-132862631 CCAGCATCCTAGCTAGGACACAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1091099939 11:132862629-132862651 CAGGCAGCTGAGAAAGATGGTGG 0: 1
1: 0
2: 7
3: 39
4: 454
1091099935_1091099941 2 Left 1091099935 11:132862609-132862631 CCAGCATCCTAGCTAGGACACAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1091099941 11:132862634-132862656 AGCTGAGAAAGATGGTGGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 358
1091099935_1091099942 3 Left 1091099935 11:132862609-132862631 CCAGCATCCTAGCTAGGACACAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1091099942 11:132862635-132862657 GCTGAGAAAGATGGTGGGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 301
1091099935_1091099943 4 Left 1091099935 11:132862609-132862631 CCAGCATCCTAGCTAGGACACAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1091099943 11:132862636-132862658 CTGAGAAAGATGGTGGGCTGGGG 0: 1
1: 1
2: 4
3: 32
4: 372
1091099935_1091099945 21 Left 1091099935 11:132862609-132862631 CCAGCATCCTAGCTAGGACACAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1091099945 11:132862653-132862675 CTGGGGAGATATTTCGGACGTGG 0: 1
1: 0
2: 0
3: 6
4: 51
1091099935_1091099938 -6 Left 1091099935 11:132862609-132862631 CCAGCATCCTAGCTAGGACACAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1091099938 11:132862626-132862648 ACACAGGCAGCTGAGAAAGATGG 0: 1
1: 0
2: 3
3: 62
4: 752

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091099935 Original CRISPR CTGTGTCCTAGCTAGGATGC TGG (reversed) Intronic
900903613 1:5534969-5534991 CTCTGTCCCAGATAGGATGGAGG + Intergenic
901429392 1:9203710-9203732 CTGTGTCCCAAGCAGGATGCGGG - Intergenic
901429955 1:9207866-9207888 CTGTGTCTTTGCTAAGATGCTGG + Intergenic
901843956 1:11970827-11970849 CTGGGGCATAGCCAGGATGCGGG + Intronic
906280456 1:44549811-44549833 CTGTCTGCCAGCTAAGATGCTGG - Intronic
907661744 1:56399671-56399693 CTGTGTTCTAGTCAGTATGCTGG - Intergenic
907898353 1:58714519-58714541 CTGTGTGCTAGTTACTATGCTGG + Intergenic
914679693 1:149930400-149930422 CTGGGTCATAGCCAGGATTCTGG + Exonic
915117026 1:153607686-153607708 CTGTGTCCTGGGGAGGAAGCAGG + Exonic
915507004 1:156364148-156364170 CTGTGTACAAGCTAGGAAGAGGG - Intronic
923451801 1:234125123-234125145 CTGTGTCCTAGATATGAGGCGGG - Intronic
924314746 1:242784284-242784306 CTGTTTCCTGGCCAGGATGCTGG + Intergenic
1065500951 10:26381887-26381909 CTGTGTCCTAGCAAGGCAGAAGG - Intergenic
1067764280 10:49073419-49073441 CTGTGTCCTAGCTGAGAAGGTGG - Intronic
1070175520 10:73966230-73966252 CTGTGCCCCAGCAAGGGTGCAGG - Intergenic
1071190129 10:83089870-83089892 GTGTCTCCTAGTTAGGATACAGG - Intergenic
1078026490 11:7700546-7700568 CTGTTTCCTCACAAGGATGCTGG + Intronic
1081589536 11:44411629-44411651 CTGTTTCCTAGCTGTGATCCTGG - Intergenic
1081979887 11:47259712-47259734 CAGTTTCCCAGCTAGGACGCTGG + Intronic
1083203150 11:61132130-61132152 CTGGGTCCAAGCTGGGCTGCCGG + Exonic
1084009968 11:66342204-66342226 CTGTGTCTTTGCTTGGAGGCTGG + Exonic
1084390062 11:68869507-68869529 CTGGGTCCTAGTTGGGATCCTGG - Intergenic
1085002903 11:73057251-73057273 CTGTGTCCTAGGTACTATGCCGG - Intronic
1088795150 11:113261282-113261304 CTGTGGCCTGCCTATGATGCAGG + Intronic
1091099935 11:132862609-132862631 CTGTGTCCTAGCTAGGATGCTGG - Intronic
1091279508 11:134374018-134374040 CTGTGTCCTGGTTAAGAGGCGGG + Intronic
1098556565 12:71825515-71825537 CTGTGTCCCTGTTAAGATGCTGG - Intergenic
1100333163 12:93604779-93604801 CTGTATCCCAGCTACGATGGGGG - Intergenic
1102470554 12:113157668-113157690 CTGTGTCAGGGCTAGGAGGCAGG - Exonic
1106933478 13:34692535-34692557 CTGTGTCCTCACAAGGAGGCAGG + Intergenic
1107440822 13:40425853-40425875 TCGTGTCCTAACTAGGAGGCAGG - Intergenic
1113355161 13:109572326-109572348 CTGTGTCCTTGCTAGGTGGGAGG + Intergenic
1123703306 15:22931984-22932006 CTGTGGCACAGCTAGGCTGCAGG - Intronic
1125747385 15:42006195-42006217 CTCTGTCCTAGCAAGGAGGTAGG + Intronic
1126696293 15:51328897-51328919 CTGGCTTCAAGCTAGGATGCTGG + Intronic
1127159286 15:56164533-56164555 CAGTGTCCCAGATAGGATCCTGG + Intronic
1128028453 15:64459828-64459850 CTGTGCACTAGATAGTATGCTGG + Intergenic
1130130536 15:81137829-81137851 TTGTGTGCTAGCTATGGTGCAGG + Intronic
1132311691 15:100862145-100862167 CTCAGTCCTAGGTAGGATGAGGG - Intergenic
1133577149 16:7103412-7103434 CTGCTTCCTAGCTAGTATGTAGG - Intronic
1135839069 16:25856981-25857003 CTGTGTCCTACTTCGGATGCTGG - Intronic
1137374419 16:47940547-47940569 CTGTCTCCTGGCTGGGATGGAGG - Intergenic
1139729440 16:68930414-68930436 AAGTGTCCTAGCTAGGAGGCAGG - Intronic
1140128916 16:72140800-72140822 CTGAGTCATAGTTAGGATGGAGG - Intronic
1141180150 16:81747006-81747028 CTGTGTCCTGGCTAGCAAGGTGG - Intronic
1141693185 16:85607804-85607826 CTGTGTCCCTGCTAGGAGACAGG + Intergenic
1147254496 17:39174072-39174094 CTCTGGCCCAGCTGGGATGCTGG + Exonic
1152693718 17:81733654-81733676 CTGTGTCCCCACTAGGAAGCCGG + Intergenic
1155970985 18:32083567-32083589 CTCTGTCCTGGCGAGGAAGCCGG + Intergenic
1160892158 19:1384720-1384742 ATGTTTCCTAGCTATGGTGCAGG - Intronic
1161017753 19:1991639-1991661 CTGGGTCCTTTCCAGGATGCCGG + Intronic
1163799651 19:19356781-19356803 CTGGGGCCTGGCTAGGGTGCGGG - Exonic
924991215 2:314714-314736 TTCTGTCCTCGCTAGGATGGAGG - Intergenic
926222420 2:10944896-10944918 CTCTCTCATAGCTGGGATGCTGG - Intergenic
928211376 2:29326402-29326424 CTGTGTCCCAGCTGGGAAGTAGG + Intronic
932334238 2:70920803-70920825 CTCTGTCCCAGCCAGGATTCTGG - Intronic
937120037 2:119434682-119434704 CTGGGTCCTAGCTGAGATGAAGG - Intronic
937252593 2:120534009-120534031 CAGTTTCCCAGCTATGATGCAGG + Intergenic
938964926 2:136379906-136379928 CTGTGCCCTTGGTAGGAGGCAGG - Intergenic
942314028 2:174682356-174682378 CTCTGTCCTAGCTGGGGTGTAGG + Intronic
948122730 2:235543177-235543199 CTCTTTCCTGGCTGGGATGCAGG + Intronic
948459882 2:238123920-238123942 CTGCCTCCCAGCAAGGATGCTGG - Intronic
948940855 2:241195613-241195635 CTGCGTCCCGGCTGGGATGCTGG + Intronic
1171369274 20:24650637-24650659 CGCTGTCCTAGCTGGGAGGCTGG - Intronic
1173313490 20:41921665-41921687 CAGTGTGGTAGCAAGGATGCAGG + Intergenic
1175637019 20:60593200-60593222 CTGTTTGCAAGCTGGGATGCTGG - Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176382822 21:6121527-6121549 CAGTGTCCGTGCCAGGATGCAGG - Exonic
1179522009 21:41951918-41951940 CTGTGTCCTTTGTAGGAGGCAGG - Intronic
1179740647 21:43416712-43416734 CAGTGTCCGTGCCAGGATGCAGG + Exonic
1180260510 21:46665512-46665534 GTGTGTCCTGGCCTGGATGCTGG - Intergenic
1181390162 22:22574491-22574513 GTGTGTCCTCAGTAGGATGCAGG + Intergenic
1181466845 22:23114980-23115002 CTGTGTCCCAGGGATGATGCTGG + Intronic
1181603856 22:23967971-23967993 CTGTGTCCCAGCCAGGTTCCAGG + Intronic
1181604657 22:23973336-23973358 CTGTGTCCCAGCCAGGTTCCAGG - Intronic
1181942360 22:26488230-26488252 CTGGTTTCTAGCTACGATGCAGG - Exonic
1183598622 22:38827070-38827092 CTGTGCTCCACCTAGGATGCTGG + Intronic
1183680274 22:39324482-39324504 CTGTTTCATAGCTATGATGTAGG - Intergenic
949787502 3:7758130-7758152 CTGTGTCCTAGTTACTATGGAGG + Intergenic
953482275 3:43261898-43261920 GTGTGTCCTCCCTAGCATGCTGG - Intergenic
954876245 3:53804875-53804897 CTGTGTCCAAGGGAGGAGGCGGG + Intronic
959884641 3:111485353-111485375 CTCTGTCCTTGTTAGAATGCAGG - Intronic
961450606 3:127000701-127000723 CTGTGTCCTAGCCAGAGTTCAGG - Intronic
962002752 3:131316432-131316454 CTGTGTCATGCCTAGGATGATGG - Intronic
963789894 3:149573166-149573188 GTGTGGCCTAACCAGGATGCAGG - Intronic
969366698 4:6699307-6699329 CTCTGTCATAGCTGGGGTGCAGG + Intergenic
969897882 4:10322100-10322122 GTGTGTACTGGCTTGGATGCAGG + Intergenic
971221048 4:24706281-24706303 CTGTGTCCCAGCTATGAGGGAGG - Intergenic
971305945 4:25481784-25481806 CTGTGTCCTAGCTTGAGCGCTGG + Intergenic
971965165 4:33544776-33544798 CTGTCTCCTTGCTTGGCTGCCGG + Intergenic
973204094 4:47540771-47540793 CAGCATCCTAGCTAGGATCCTGG - Intronic
976085543 4:81403747-81403769 CAGTTTCCTTCCTAGGATGCTGG - Intergenic
977141123 4:93373658-93373680 CTCTGTATTAGCAAGGATGCTGG - Intronic
978081295 4:104595223-104595245 CAGAGTCCTAGCTGGGAAGCTGG + Intergenic
978343345 4:107739998-107740020 CTGTGGGCTGGCTAGGACGCTGG + Intergenic
979303449 4:119114339-119114361 CTGTCTTCTAGCTAGGGTCCTGG + Intergenic
983384070 4:167035680-167035702 ATGTTTCCTAGCCAGGATTCGGG - Intronic
986620270 5:9665546-9665568 GTGTGTCCTAGAGAGGAAGCAGG - Intronic
987401975 5:17487161-17487183 CTGTGTCTTAGCTTGTGTGCTGG + Intergenic
995127503 5:108593120-108593142 CAGTCTCCTAGTTATGATGCAGG - Intergenic
999250194 5:150177962-150177984 CTCTGTCCTGGCAAGGCTGCCGG - Intronic
999510675 5:152248113-152248135 CTGTGTCCCAACAAGGCTGCAGG + Intergenic
999585890 5:153089167-153089189 CTGTCTCTTGGCTAGGATGTGGG + Intergenic
1001564474 5:172690565-172690587 CTGTGCCCCAGCTGTGATGCTGG + Exonic
1007117916 6:39356859-39356881 CTTCGTCCTAGCCAGGATCCAGG - Intronic
1007494026 6:42246862-42246884 CTGTTTCCCAGCGATGATGCTGG - Intronic
1007717944 6:43868122-43868144 CTGTGGTCTAGCAAGGTTGCTGG + Intergenic
1012773051 6:103465333-103465355 CTGTTTGTTATCTAGGATGCAGG + Intergenic
1022629014 7:32067732-32067754 CCATGAGCTAGCTAGGATGCAGG - Intronic
1023632483 7:42178120-42178142 CTGTGTCCCAGCTGAGATGTCGG + Intronic
1027441992 7:78229383-78229405 CTGTGTCCTAACAACCATGCTGG + Intronic
1031407348 7:121402598-121402620 CTGTGACCTAGATAGGAAGCTGG + Intergenic
1035595447 8:853989-854011 CTGTGTCCTTGCTAGGTAGGAGG - Intergenic
1035719316 8:1779742-1779764 CTGTGTCCTAGCATGGAGGAGGG + Intronic
1038063434 8:23937340-23937362 CTGTTCCCTGGCTAGGATGGTGG + Intergenic
1040038216 8:42891885-42891907 CTGTGTCCTAGGGAGGGTGATGG - Intronic
1040573530 8:48630257-48630279 CGGTATCCTAGATGGGATGCTGG - Intergenic
1043388725 8:79770732-79770754 CTGTGTCCTAGCTACTCTGGGGG + Intergenic
1045198299 8:99952372-99952394 CTGGGTCATAGTTACGATGCTGG - Intergenic
1045988829 8:108282268-108282290 CTGTCTCCTAGCTAGACTGTAGG + Intronic
1048878375 8:138854287-138854309 CTGTGGCCTACTTAGGATCCAGG - Intronic
1050037524 9:1452994-1453016 CTGTGTCCTGGTTATGATGGTGG + Intergenic
1051201647 9:14633384-14633406 CTTTCCTCTAGCTAGGATGCAGG - Intronic
1051949701 9:22616755-22616777 CTGTGACCTCCCTAGGATGTGGG + Intergenic
1058162549 9:101585555-101585577 CTGTGTCATGGCAAGGATGGAGG - Intronic
1059536375 9:115084740-115084762 CTGGGTCTTAGCTCAGATGCAGG + Intronic
1060270224 9:122134971-122134993 CTGTGTCCAGGCTTGGAAGCTGG + Intergenic
1203490245 Un_GL000224v1:97866-97888 CTGGGTCCTAGTTAGGATCTAGG - Intergenic
1203502868 Un_KI270741v1:39749-39771 CTGGGTCCTAGTTAGGATCTAGG - Intergenic
1195041836 X:101021714-101021736 GTGTCTCCTAGCTGAGATGCTGG - Intronic
1195388310 X:104334559-104334581 GTGTGTCTGAGCTAGGATGCTGG + Intergenic
1195556145 X:106227233-106227255 CTGTGTTCAAGCTAAGAAGCTGG - Intergenic
1199005948 X:142695738-142695760 CTGTGTCCTTGAGAGGAGGCTGG + Intergenic
1199312959 X:146343176-146343198 CTGTGACTTAGTTAGGATGGTGG + Intergenic
1199500521 X:148501295-148501317 CTGACTCCTAGGTCGGATGCCGG + Intronic