ID: 1091100171

View in Genome Browser
Species Human (GRCh38)
Location 11:132864586-132864608
Sequence TACAATTTATAGATGACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091100171_1091100173 1 Left 1091100171 11:132864586-132864608 CCATTGGTCATCTATAAATTGTA 0: 1
1: 0
2: 0
3: 19
4: 236
Right 1091100173 11:132864610-132864632 GATCTAATAGAATTGCAAGTAGG 0: 1
1: 0
2: 1
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091100171 Original CRISPR TACAATTTATAGATGACCAA TGG (reversed) Intronic
904335866 1:29797582-29797604 TACAATTTCTAGAGGTCCAGTGG + Intergenic
905827844 1:41040081-41040103 TCCATTTTATAGATGGGCAAAGG - Intronic
906083941 1:43113921-43113943 TCCAATTTAAAAATGAGCAAAGG - Intergenic
907532825 1:55118720-55118742 TCCAATTTAAAAATGAGCAAAGG + Intronic
909616239 1:77612111-77612133 TCCAATTTAAAAATGAGCAAAGG + Intronic
911258670 1:95661855-95661877 TACAATTTAAAAATGGGCAAAGG - Intergenic
911352658 1:96773366-96773388 TACAAAAAAAAGATGACCAAAGG - Intronic
911999122 1:104808023-104808045 GAGAAATTATAGATGACCATGGG + Intergenic
912662545 1:111545445-111545467 TCCAATTTAAAAATGAGCAAAGG - Intronic
915017496 1:152748151-152748173 TACAATTTAAAAATGGGCAATGG - Intronic
915187468 1:154119139-154119161 TACAGTTTATGGATGTCCAGGGG - Intronic
917904230 1:179573729-179573751 TACATTTTATAAATGAAGAAAGG + Intronic
918155245 1:181838856-181838878 TAAAATTTATAGATTTCCAAAGG + Intergenic
919699147 1:200613244-200613266 AACAATTTATAGATTCCCAAAGG + Intronic
923059033 1:230453382-230453404 TAAAATTTATAGGTGGCCATTGG - Intergenic
923436652 1:233973616-233973638 TACAATTTATAACCGACAAAAGG + Intronic
1063798124 10:9536477-9536499 AAAAATTTAAAAATGACCAAAGG + Intergenic
1064641331 10:17418533-17418555 TTCAGTTGATAGATGACAAAAGG + Intronic
1066400516 10:35071882-35071904 TACAAATTATTTATGATCAAGGG + Intronic
1066536079 10:36393685-36393707 CACAATTTAAAAATGGCCAAAGG + Intergenic
1066547732 10:36519132-36519154 TGAAAGTTATAGATGAGCAATGG + Intergenic
1069925459 10:71847343-71847365 CACAATATTTAGTTGACCAAAGG - Intronic
1069979087 10:72239821-72239843 TACAATTTGCAGAGGCCCAAGGG + Intergenic
1071885871 10:89950527-89950549 TATAATGTATAGATGAGCCAAGG + Intergenic
1073316682 10:102586224-102586246 TTCAATTTAAAAATGAGCAAAGG - Intronic
1075469354 10:122676520-122676542 TACAATTTGTTTATGACCAGTGG - Intergenic
1080003332 11:27376573-27376595 TTCATTTTATAGATGAGAAAAGG - Intronic
1080509675 11:32956444-32956466 TACATTTTATAGATGAAAAAGGG - Intronic
1080629490 11:34060679-34060701 TGCAATCTATAGATGATCCATGG + Intronic
1081370472 11:42294586-42294608 TGCAATTTAAAAATGAGCAAAGG - Intergenic
1085074938 11:73582685-73582707 TACAAATTAAAACTGACCAAAGG + Intronic
1085973095 11:81617604-81617626 TACAATTTAAAAATGGGCAAAGG + Intergenic
1086188208 11:84045301-84045323 TATAATTGATAGATGAGGAAAGG + Intronic
1086586050 11:88452765-88452787 TAACATTTTTAGATGACAAAGGG + Intergenic
1086598626 11:88605710-88605732 TAAAATCTATAGAGGCCCAAAGG + Intronic
1088786981 11:113190991-113191013 CACAATTTATGGATCATCAAAGG + Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1088906603 11:114159855-114159877 CCCATTTTACAGATGACCAAGGG + Intronic
1089588598 11:119525598-119525620 TACAATTTATAGGAGGCCAATGG - Intergenic
1090362065 11:126180259-126180281 TCCAATTTAAAGATGAGCAAAGG + Intergenic
1090414614 11:126532144-126532166 CACATTTTATAGATGAACCAAGG + Intronic
1090609075 11:128453964-128453986 TACAATTTATAGACAAATAAAGG - Intergenic
1090981878 11:131729810-131729832 TTCAATTGATAGATGATAAATGG - Intronic
1091068224 11:132537732-132537754 TCCAATTTAAAAATGAACAAAGG + Intronic
1091100171 11:132864586-132864608 TACAATTTATAGATGACCAATGG - Intronic
1091988063 12:4929665-4929687 TTGATTTTATAGATGACGAAGGG + Intronic
1093645671 12:21583252-21583274 TAAAATTTATAGGGGTCCAATGG + Intronic
1098075002 12:66719811-66719833 TACAATTTATAGACGGACAAAGG + Intronic
1099383861 12:81989907-81989929 TGCAATTGATAGATAACTAAAGG + Intergenic
1099699920 12:86070566-86070588 TACAAATTTCAGATCACCAAGGG - Intronic
1106648623 13:31664855-31664877 TCCAATTTACAGATAACCAAAGG - Intergenic
1108010394 13:46001548-46001570 TACCATTTAGGGATAACCAAGGG + Intronic
1109574360 13:64233479-64233501 GAAAATTTACAAATGACCAACGG - Intergenic
1109598233 13:64586275-64586297 TGAAATTTATGGATGACTAAAGG + Intergenic
1109662085 13:65474219-65474241 TACATTTTAAAAATGAGCAAAGG + Intergenic
1110521433 13:76483668-76483690 TACATTTTTAAGATGACAAATGG - Intergenic
1110550954 13:76811117-76811139 TGCATTTTACAGATGACAAAGGG + Intergenic
1110874971 13:80497675-80497697 TACAATTTTTAGATTTACAATGG + Intergenic
1111103841 13:83620815-83620837 TAATATTTATAGGTGAACAATGG + Intergenic
1111855701 13:93634371-93634393 TAAAATTTAGAAATGGCCAAGGG + Intronic
1112970008 13:105249948-105249970 TATAGTTTATCAATGACCAAAGG - Intergenic
1114300161 14:21368758-21368780 CACAATTCATAGAGGACTAATGG - Intronic
1114311265 14:21469720-21469742 TATAATTTATAGGTTACAAATGG + Intronic
1115443813 14:33466457-33466479 TACAATTGCTAGATGAACAACGG - Intronic
1116595577 14:46840008-46840030 TACAATTTATTGGTTACCATGGG - Intronic
1116694890 14:48160948-48160970 TTCAATTCATAGATGACTAAAGG - Intergenic
1118529939 14:66692647-66692669 TACCATTTTTATATGACCATTGG + Intronic
1119367696 14:74108707-74108729 TACAATTTACAAATAAGCAAAGG - Intronic
1120379483 14:83756758-83756780 TAAAATTTATAGGTGAGTAAAGG + Intergenic
1121424495 14:93839475-93839497 CACAAATTATAGATGAAAAATGG + Intergenic
1124851927 15:33348134-33348156 TAGAATTTATAGATAAGCAAAGG - Intronic
1125108656 15:36004773-36004795 TACCATTAATAGATATCCAAAGG - Intergenic
1125415273 15:39445896-39445918 TTCATTTTATAGATGAGGAAAGG - Intergenic
1128210156 15:65892991-65893013 TACAATGTAGTGATTACCAAAGG - Intergenic
1130377747 15:83344983-83345005 TAGAATTTATGCATGAACAAAGG - Intergenic
1131964104 15:97820280-97820302 TACAATTACTTGATCACCAATGG + Intergenic
1132108379 15:99083319-99083341 TACAATTTAAAAATGAGCTAAGG + Intergenic
1133879476 16:9766833-9766855 TTCAAATTCTAGATGATCAAGGG + Intronic
1135427917 16:22355532-22355554 TAAAATTTATAGGAGACCACTGG + Intronic
1135681353 16:24460038-24460060 TCCAATTTATAGATCCCCATAGG - Intergenic
1135872895 16:26168471-26168493 TCCAGTTTAAAGATGAGCAATGG - Intergenic
1136671293 16:31860941-31860963 TACAATTTATAAAACACAAAAGG + Intergenic
1137905387 16:52316578-52316600 TACAAATAAAAAATGACCAAAGG + Intergenic
1139160110 16:64494774-64494796 TACAATTTATAAATGAGTGAAGG - Intergenic
1141181997 16:81760084-81760106 TACAACTGATAGATGAGCAGTGG - Intronic
1141821092 16:86446418-86446440 TACAATTGATTGGAGACCAAAGG - Intergenic
1142985548 17:3693086-3693108 TCCAATTTAAAAATGAGCAAAGG + Intronic
1146092107 17:29889744-29889766 TCCAATTTAAAAATGAGCAAAGG + Intronic
1147312410 17:39603260-39603282 TACAATTTTAAGATGAAAAAGGG + Intergenic
1150832132 17:68532620-68532642 TAGAAAGTATAGATGGCCAAAGG + Exonic
1153212586 18:2784071-2784093 TAAGTTTTTTAGATGACCAAAGG - Intronic
1153461434 18:5338053-5338075 TACAATTTTTTAATGACCACAGG - Intergenic
1153897947 18:9585506-9585528 TACAATTGATAAATGACAACAGG - Intronic
1155032728 18:21998351-21998373 CACATTTTATAAATGATCAATGG - Intergenic
1155623187 18:27804997-27805019 TAAAGTTTGCAGATGACCAAAGG - Intergenic
1157300863 18:46478027-46478049 GATCATTTATAGATGAGCAAGGG - Intronic
1157992027 18:52508820-52508842 CACAATTTACAGATGAAAAAAGG + Intronic
1158491864 18:57917185-57917207 AACAATTTAAAAATGAGCAAGGG - Intergenic
1159207031 18:65266147-65266169 TAAAATTTATAGATTAAGAAAGG + Intergenic
1159432403 18:68370242-68370264 TAGAATTTAGAAATGAGCAAAGG + Intergenic
1159474375 18:68900999-68901021 TGTAATTTATAGATGATCCATGG - Intronic
1159543909 18:69815312-69815334 TACAATATAAAGGTGAACAAAGG - Intronic
1163865281 19:19768446-19768468 TACAATTTATAAAACACAAAAGG - Intergenic
1167986267 19:53319417-53319439 TAAAATTTATAGAAGTCTAATGG - Intergenic
925436635 2:3843772-3843794 TTCAATTTTTAAATGACTAATGG + Intronic
927447674 2:23179383-23179405 TCCAATTTAAAAATGAGCAAGGG + Intergenic
927791839 2:26016252-26016274 TACAATTTATTGGAGACCATTGG + Intergenic
928052978 2:28020229-28020251 TAAAATGTATAAATGACAAATGG + Intronic
929170194 2:38924729-38924751 TACAAATTATATTTGACCAGAGG - Intronic
930777942 2:55193462-55193484 CACAATTTACAAATGAGCAAAGG + Intronic
933076563 2:77934988-77935010 TAATATTTTTAGATGCCCAAAGG - Intergenic
933208061 2:79532449-79532471 TACAATTTAAAGATGAGTATAGG + Intronic
935993612 2:108744587-108744609 TTCAACATATAGATGACAAAGGG + Intronic
937817965 2:126274689-126274711 TACACTTTATACATGGCCCATGG - Intergenic
939313030 2:140509444-140509466 TACTATTTTTACATGACCCAAGG + Intronic
940346434 2:152633761-152633783 TATAATTTCTACCTGACCAATGG + Intronic
940495789 2:154426478-154426500 TACAATTTGCAGATGACCGAAGG - Intronic
941570675 2:167165913-167165935 TACAAAATCTAGATGACCTAGGG - Intronic
943021458 2:182579334-182579356 CCCACTTTATAGATGAGCAAAGG - Intergenic
943294674 2:186121701-186121723 TCCAATTAATAAATGTCCAAAGG - Intergenic
943517658 2:188907674-188907696 TAAAATTTATGGAGGTCCAATGG - Intergenic
944758576 2:202789784-202789806 TAAAATGTATAGAAGACCATTGG + Intronic
947880363 2:233504043-233504065 GACTATTTTTATATGACCAAAGG + Intronic
948258731 2:236587277-236587299 TACAATTTAAAGCTTCCCAAGGG - Intergenic
1169598752 20:7231891-7231913 TACATTTTATTGATTACAAATGG - Intergenic
1169602003 20:7272132-7272154 TACCTTTTATTGCTGACCAAAGG - Intergenic
1169974387 20:11307055-11307077 TACAATTTATAGGTGCCCTGAGG + Intergenic
1173084960 20:39907128-39907150 TCCAATTTAGAGATGATAAATGG - Intergenic
1173395577 20:42676691-42676713 TACATTTTATATATGCACAAAGG - Intronic
1177314808 21:19445048-19445070 TAGAATTTATAGATTATCACAGG + Intergenic
1180887229 22:19255216-19255238 TAGAATTAATAGATGACTACAGG + Intronic
1184420122 22:44375288-44375310 TGCAATATTTAGATCACCAATGG - Intergenic
1185356823 22:50378062-50378084 TAAAATTTATAGCTAGCCAAAGG + Intronic
949616119 3:5755658-5755680 TGCCATTTGTGGATGACCAAAGG - Intergenic
949966517 3:9361404-9361426 CACAATTTATAAATGTGCAAAGG - Intronic
950186519 3:10948859-10948881 TCCAATTTGCAGATGAGCAAAGG - Intergenic
950994026 3:17475054-17475076 CACAATTGAAAAATGACCAAAGG - Intronic
953813821 3:46136779-46136801 CCCAATTTAAAGATGAACAAAGG - Intergenic
954503165 3:51040813-51040835 TGCATTTTATGGATGAGCAAAGG - Intronic
954842047 3:53520440-53520462 TTCAATTTAAAAATGAGCAAAGG - Intronic
954932059 3:54292491-54292513 CACAATTTAAAAATGAACAAAGG + Intronic
955616152 3:60808909-60808931 TAAAATTTATAGAAGTCCATTGG - Intronic
956935848 3:74101159-74101181 TTCAATTTATAAATAAACAAAGG - Intergenic
957430442 3:80098627-80098649 CACAATATATAAATGAACAAGGG + Intergenic
957530637 3:81436922-81436944 TAAAATGTATATATAACCAATGG + Intergenic
961809218 3:129512393-129512415 TACACTTTAGAGATGCCCGAGGG - Exonic
961998671 3:131272269-131272291 TATAATTTATAAATGATCATTGG + Intronic
963444926 3:145393118-145393140 TACAATTTTTATATTCCCAATGG - Intergenic
963747391 3:149138648-149138670 TACTATTTATAGACGACAAAAGG + Intronic
964883438 3:161450805-161450827 TAAAATTTATACAGGACCATTGG - Intergenic
965635925 3:170780542-170780564 TACAGTTTTTGGGTGACCAAAGG + Intronic
965784232 3:172319253-172319275 TACAATTTACAAATGAACCAAGG - Intronic
967620372 3:191626637-191626659 TACTATTAATAGCTGTCCAAAGG - Intergenic
967621384 3:191638880-191638902 TGCAATTTACAGATCTCCAATGG - Intergenic
967769308 3:193316642-193316664 TCCAATTTAAAAATGAACAAAGG - Intronic
970738638 4:19205210-19205232 TTCATTTTATAGATGATCACAGG - Intergenic
971632460 4:29011410-29011432 TATAATTTATATATGTCAAAAGG - Intergenic
972874486 4:43341761-43341783 TACAATTTGTAGAAGACCATTGG + Intergenic
973106597 4:46346131-46346153 TTCAATTGATGGATGACAAATGG - Intronic
973125175 4:46573895-46573917 TAAAATTTCCAGAAGACCAAAGG - Intergenic
974378728 4:61109851-61109873 TTCATTTTATTGATGACTAAAGG + Intergenic
974945156 4:68517805-68517827 TACAATTTCTAAATTACCATAGG + Intergenic
975864396 4:78711872-78711894 TAAAATTTATAGAAGGCCATTGG + Intergenic
976218683 4:82738754-82738776 TCCAAGTTATAGATGCCAAATGG + Intronic
977440966 4:97066944-97066966 CACAATTTCTAAAAGACCAAAGG + Intergenic
978283905 4:107051927-107051949 TACAATTTATAAATGCCATAGGG - Intronic
978566487 4:110088032-110088054 TAGAATTTATAGAACATCAAAGG + Intronic
979089979 4:116470840-116470862 TACAATTTTTACATGGGCAAAGG - Intergenic
980405951 4:132354224-132354246 TAAAATTTCTAGATGTCCAGTGG - Intergenic
981851965 4:149241836-149241858 TCCAATTTACAGATGAGAAAAGG + Intergenic
982103306 4:151989793-151989815 GACACTTTAGAGATTACCAAGGG + Intergenic
983858967 4:172680585-172680607 TTCAGTTTACAGATGACAAATGG - Intronic
984564736 4:181314988-181315010 TAAAATTCATAGAAGAGCAAAGG - Intergenic
985250103 4:188015552-188015574 TACATTTTAGAGATGATTAAAGG - Intergenic
986767289 5:10939519-10939541 TTCACTTTATAGATCACCCAGGG + Intergenic
987367422 5:17161445-17161467 TACAATTTAGAGAGAACTAAGGG - Intronic
988071958 5:26302342-26302364 CACAATTTAAAAATGATCAAAGG - Intergenic
988290956 5:29285937-29285959 TAAAATTGATAGATGATAAATGG - Intergenic
988393427 5:30665707-30665729 TACAAATAATAGATGATAAATGG - Intergenic
989618222 5:43358598-43358620 TAAAATTTATTGAAGACCAATGG - Intergenic
991869230 5:71094001-71094023 AACAATTTACAGAAGACTAAAGG + Intergenic
995803111 5:116021181-116021203 TACAATTTATAAATTGCCCAAGG + Intronic
995845110 5:116485073-116485095 TATAATTTATAGATGACAATGGG + Intronic
996209926 5:120796181-120796203 TACACTTTATAGGTGACAAAAGG + Intergenic
997962853 5:138335699-138335721 GCCATTTTATAGATGACGAAAGG + Intronic
998699049 5:144676511-144676533 CCCAATTTAAAAATGACCAAAGG + Intergenic
998928882 5:147158180-147158202 TCATATTTATAGATGACCAATGG - Intergenic
999527591 5:152424398-152424420 TGCAATTTATAGTAGACCACAGG + Intronic
1001164392 5:169350423-169350445 TTCAAATTATAGATGGACAAAGG + Intergenic
1002355143 5:178621459-178621481 TGCAATATATATATGACAAATGG + Intronic
1002491121 5:179578127-179578149 TCCCATTTATATTTGACCAATGG - Intronic
1002654017 5:180728023-180728045 TCCAATTTAAAAATGGCCAAAGG + Intergenic
1002945994 6:1761200-1761222 AACACATTATAGATGATCAAGGG + Intronic
1003278632 6:4673672-4673694 AACAATTTGAACATGACCAAAGG - Intergenic
1004552723 6:16664738-16664760 TAAAATTTATTGAGGACCCAAGG - Intronic
1005413504 6:25576181-25576203 CAAAATTTAATGATGACCAATGG + Intronic
1006742557 6:36319984-36320006 TACATTTTATGGATGACCAGAGG - Intronic
1008548007 6:52600382-52600404 TGCATTTTATAGATGAGAAAAGG + Intergenic
1009651938 6:66488093-66488115 TAAAAATTAGTGATGACCAAGGG + Intergenic
1010580819 6:77594342-77594364 TAAAATTTGTAGAGGTCCAAAGG - Intergenic
1011703762 6:89980980-89981002 TAAAGTTTAAAGATGACAAATGG + Intronic
1014610505 6:123538937-123538959 TACCTTTTATAGATTATCAATGG + Intronic
1016605367 6:145916445-145916467 TACATTTTATGCATTACCAATGG - Intronic
1016724210 6:147342072-147342094 TACAATTTACAGAAAACTAAAGG + Intronic
1016931003 6:149409300-149409322 TACAATTTATAGTAGAATAAAGG - Intronic
1017628624 6:156373967-156373989 GACAATTTTGAGATGACCCAAGG - Intergenic
1018288722 6:162268634-162268656 TCCACTTTATAGAAGACAAAGGG + Intronic
1020734016 7:11923543-11923565 TCCAATTTATATATGACTATAGG + Intergenic
1020945818 7:14604597-14604619 TAAAATGTATAAATCACCAAGGG + Intronic
1023157351 7:37264408-37264430 TACAATTCATAAATAACCACAGG - Intronic
1023681966 7:42696328-42696350 TACAATTTAAAGATTATCTAGGG - Intergenic
1027487792 7:78783615-78783637 TACACTTTATTGATTTCCAATGG - Intronic
1027500843 7:78949345-78949367 TACAATTAATACCTGATCAATGG + Intronic
1028192591 7:87870121-87870143 CCCAATTTAAAAATGACCAAAGG - Intronic
1028240958 7:88420096-88420118 TACACTTTAAAGATGGCAAATGG - Intergenic
1030219345 7:107080579-107080601 TACATCTTGTGGATGACCAAGGG + Intronic
1030452838 7:109734282-109734304 GACAAAATCTAGATGACCAAGGG + Intergenic
1030891009 7:114999163-114999185 TACCATTTATAGAAACCCAATGG + Intronic
1033616433 7:143020660-143020682 TACAATTTAAAAATCAACAAAGG + Intergenic
1033966866 7:146985827-146985849 AACAATTGATAGTTGGCCAATGG - Intronic
1035905321 8:3503594-3503616 TACCATTTAAAGCTGACAAAAGG - Intronic
1038086365 8:24201639-24201661 TCCAATTAAAAGATGAGCAAAGG - Intergenic
1040485432 8:47866642-47866664 TCCAATTTATAGGTGAGAAAGGG - Intronic
1041317164 8:56575831-56575853 TACAATTTATAGGAGGCCATTGG + Intergenic
1041527186 8:58820295-58820317 TAAAATTTATAAAGGACAAATGG - Intronic
1041983301 8:63889348-63889370 TACAATTTACATAATACCAAAGG + Intergenic
1043467235 8:80523118-80523140 TCCATTTTATAGATGAGGAAAGG + Exonic
1043505954 8:80902903-80902925 TTCAATTTAAAGATGGGCAAAGG + Intergenic
1044600783 8:94002203-94002225 TATAATTGATAGGTCACCAATGG - Intergenic
1045536777 8:103036655-103036677 TATTATTTATAGATGAGAAATGG + Intronic
1046521988 8:115336763-115336785 AACAATTTATTGATGAATAAAGG + Intergenic
1050667110 9:7951713-7951735 TACATTTTATAGGTGACAATAGG + Intergenic
1050800035 9:9599310-9599332 CACAATTTACAGATGCCCACTGG + Intronic
1052444660 9:28545064-28545086 TGCACTTTACAGATGAGCAAGGG + Intronic
1052688742 9:31787749-31787771 TACAATTTAAATATCTCCAAAGG - Intergenic
1055357984 9:75457297-75457319 TACAGGTTATAGTTGACCATTGG - Intergenic
1056962401 9:91137407-91137429 TCCAATTTAAAAATGAGCAAAGG + Intergenic
1057213601 9:93215491-93215513 TAAAACTTATAGAAGACAAAGGG - Intronic
1057728582 9:97588411-97588433 CACAATTTATAAATGAGCAAAGG - Intronic
1060447913 9:123708919-123708941 TACACTAAATAGATGACCATGGG + Intronic
1185777814 X:2819731-2819753 TACAATTTAGAAATGTCCACTGG - Intergenic
1186516350 X:10168614-10168636 TTCAATTAAAAGTTGACCAAAGG - Intronic
1187565762 X:20448026-20448048 TACAATTTGTGGATGCCTAATGG + Intergenic
1188798361 X:34494897-34494919 TACATTTTATACATGACAACAGG - Intergenic
1189714348 X:43849908-43849930 TACCATTTCTGGATGACCAGAGG - Intronic
1191908281 X:66119365-66119387 TAAAAATTATGGATGACAAAAGG + Intergenic
1194779163 X:98002140-98002162 TCCAATTTAAAAATGAACAAAGG + Intergenic
1194983919 X:100469651-100469673 TCCAATTTAAAAATGAGCAAAGG + Intergenic
1195291639 X:103435570-103435592 TCCCTTTTACAGATGACCAAGGG - Intergenic
1195602032 X:106760181-106760203 TAAAATTTATAGGTAACAAAAGG - Intronic
1197276134 X:124481672-124481694 TAAAATCTTTAGATGACCCAAGG + Intronic
1197304763 X:124828006-124828028 TACAATTTTCAGATGACATAAGG + Intronic
1201233356 Y:11887278-11887300 TACCATATATAGATGACATAAGG - Intergenic
1201720663 Y:17093656-17093678 TATTATTTATAAATGACCACAGG + Intergenic
1202332138 Y:23765626-23765648 TGAAATTCAAAGATGACCAATGG + Intergenic
1202538631 Y:25904434-25904456 TGAAATTCAAAGATGACCAATGG - Intergenic