ID: 1091100445

View in Genome Browser
Species Human (GRCh38)
Location 11:132868096-132868118
Sequence CTGCTACTTCTGTGGAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091100445 Original CRISPR CTGCTACTTCTGTGGAAAGC GGG Intronic
900486189 1:2923905-2923927 CTGCTCCTTCTGTGGCACCCTGG - Intergenic
901206870 1:7502581-7502603 CTGCTCCTTCTTGGGAAAGCCGG - Intronic
902179029 1:14673559-14673581 CTGCTCCTACTGTGAAATGCAGG - Intronic
902407319 1:16191837-16191859 CTCCTCCTTCTGCGGCAAGCAGG + Intergenic
905257071 1:36691674-36691696 CTGCAACTTCTATGGCCAGCAGG + Intergenic
907487136 1:54786069-54786091 CTTCTACTTCCTGGGAAAGCAGG - Exonic
907632184 1:56093744-56093766 CTACTACTACTGTGGACAACTGG - Intergenic
908115603 1:60937058-60937080 GTGCTATTTATGTGGAAAGGGGG - Intronic
910621595 1:89261243-89261265 CTCCTACTTCTGTGGTGACCTGG - Intronic
915298535 1:154938833-154938855 CTGCCAGTACTGAGGAAAGCAGG - Intergenic
916798776 1:168194220-168194242 CTGCAAGTTTTGTGGAATGCAGG + Intronic
919796115 1:201322526-201322548 CTTCTGCTTCTGGGGAAACCTGG - Intronic
919817909 1:201453216-201453238 CTGCTAAATCTGGGGAAAGGTGG + Intergenic
920694035 1:208168115-208168137 CATCTACTTATGTGGAAAGTAGG + Intronic
921933488 1:220774757-220774779 CTTATACTTCTGTGGTCAGCTGG + Intronic
923035121 1:230280243-230280265 GTGCTACTGCTGTGGCCAGCTGG + Exonic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
1063105667 10:2989417-2989439 CTGCTGCCTCTGTAGAAAACGGG - Intergenic
1063393320 10:5664238-5664260 CTGCTGCTGCTCTGGGAAGCCGG - Intronic
1063475362 10:6323822-6323844 CTGCAGCTTCTGTGGAAAATGGG + Intergenic
1065129715 10:22608399-22608421 CAGCTACTGCTGAGGAAAGGAGG + Intronic
1065487560 10:26249660-26249682 CTCCTACTCCTGTGAAAATCAGG + Intronic
1067168538 10:43884955-43884977 CTGCTGCTTCTGAGCCAAGCGGG - Intergenic
1070586987 10:77774005-77774027 CTGCTACTAATCTGGAAAGAAGG - Intergenic
1070806907 10:79276092-79276114 CTGCTGGGTCTGTGGAATGCTGG - Intronic
1076185169 10:128440934-128440956 CTGCTAGTTCTGAGGAATCCGGG + Intergenic
1076441415 10:130483676-130483698 CTGCTCCCCCTGTGGACAGCAGG - Intergenic
1076561347 10:131367215-131367237 CTCATACTTCAGTGGAAAGAGGG - Intergenic
1076870940 10:133194453-133194475 CTGCTACTGTTGTGGAAACTGGG + Intronic
1078230826 11:9440947-9440969 TGGTTACTTCTGAGGAAAGCTGG - Intronic
1079106005 11:17572930-17572952 CAGCTACTTCAGTGTACAGCTGG - Intronic
1079426099 11:20343244-20343266 CTGCTAGTTCTGAGGAATCCAGG + Intergenic
1079870669 11:25794358-25794380 CTGCTGCTGCACTGGAAAGCTGG - Intergenic
1081191306 11:40105369-40105391 CTGCTTCCTCTGTGGAAACTAGG + Intergenic
1083311770 11:61787471-61787493 CTGCCACCTCTTTGGGAAGCAGG + Exonic
1084987150 11:72885530-72885552 CTGCTACTACTGGGGATGGCGGG + Intronic
1085188014 11:74592724-74592746 CAGCTACTACTGGGGAACGCGGG + Intronic
1085572625 11:77572562-77572584 CTTCATCTCCTGTGGAAAGCAGG - Intronic
1086504225 11:87486680-87486702 CTGGTACTTTTGTGGACACCTGG - Intergenic
1086592236 11:88529042-88529064 CTGCTACTTATTTGCAAAACGGG - Intronic
1088383346 11:109221275-109221297 CTGCTAGTTCTGAGGAATTCGGG - Intergenic
1089574605 11:119432492-119432514 CAGCGTCTTCTGTGGAAACCGGG + Intergenic
1090397660 11:126429796-126429818 CTGCTACTTCTGCAGGAGGCAGG + Intronic
1090905179 11:131068531-131068553 CTTATACTTCCGTGGAAATCTGG - Intergenic
1091100445 11:132868096-132868118 CTGCTACTTCTGTGGAAAGCGGG + Intronic
1092625696 12:10325889-10325911 GTGCTGCTTCTGTGGAAAACAGG - Intergenic
1094609707 12:31981908-31981930 TTGCCACTGCTGTTGAAAGCTGG - Exonic
1094751587 12:33416021-33416043 CTGTTACTTCACTGGCAAGCTGG - Intronic
1097378714 12:58868582-58868604 CTGGAACTGCTGTGGAATGCAGG + Intergenic
1097421893 12:59390554-59390576 CTGCTAGTTCTGAGGAATCCAGG + Intergenic
1098790570 12:74816931-74816953 CTGCCAGTTCTGTGGAAGCCTGG + Intergenic
1100537625 12:95525865-95525887 CTGCTTCTCATGTGGGAAGCAGG + Intronic
1103606383 12:122088804-122088826 CAGCTTCTTATGTAGAAAGCAGG + Intronic
1105668421 13:22586416-22586438 CTGCTAGCTCTGTGGAATCCTGG - Intergenic
1106287302 13:28329001-28329023 CTGCTACCTCTGTTGAGAGCTGG + Intronic
1111402584 13:87760540-87760562 CTGCTTTTTCTGTGGAAAACAGG + Intergenic
1111475355 13:88738976-88738998 CAGCTACTGATGTGGAGAGCTGG + Intergenic
1113055448 13:106262282-106262304 CTGCTTCCTCTGTGCCAAGCAGG + Intergenic
1114910041 14:27180836-27180858 ATAATACTTCTCTGGAAAGCAGG - Intergenic
1116023404 14:39487762-39487784 CATTTACTTCTATGGAAAGCAGG + Intergenic
1117035332 14:51722238-51722260 CTGTGCCTTCTGTGGAAGGCAGG + Intronic
1119262175 14:73244433-73244455 CAGCTCCTTATGAGGAAAGCAGG + Intronic
1119322293 14:73739262-73739284 CTGCTGCTTCTGTGGAGGGAAGG + Exonic
1121789365 14:96687353-96687375 CTGCAAATCCTGTGGAAAGCTGG - Intergenic
1122117592 14:99535546-99535568 CTGCTACCCCTGTGCAGAGCTGG - Intronic
1123457365 15:20438438-20438460 CTTGTGCTTCTGTGGTAAGCAGG - Intergenic
1123660693 15:22561921-22561943 CTTGTGCTTCTGTGGTAAGCAGG + Intergenic
1124263515 15:28213588-28213610 CTTGTGCTTCTGTGGTAAGCAGG - Intronic
1124269257 15:28265928-28265950 CTCCGCCTTCTCTGGAAAGCAGG - Exonic
1124314493 15:28656158-28656180 CTTGTGCTTCTGTGGTAAGCAGG + Intergenic
1125130414 15:36278472-36278494 CTGCTCCCTCTGTGGGAAGAGGG + Intergenic
1125482449 15:40089886-40089908 CGGCTCCTTCTCTGCAAAGCAGG + Exonic
1128330196 15:66750709-66750731 CAGCTACTTCTGTGGGCAGTCGG + Intronic
1131835749 15:96388961-96388983 CAGCTACAGCTGTGGAAACCTGG + Intergenic
1135180254 16:20267241-20267263 CTGCTTCTCCTGTGGCACGCAGG + Intergenic
1139670990 16:68492507-68492529 CTGCTACTGCTGTGGGAGCCTGG - Intergenic
1139754162 16:69129644-69129666 CAGCTACTTAAGTGGAGAGCTGG + Intronic
1144151980 17:12457111-12457133 CTGCTCATTCTGTGCTAAGCTGG + Intergenic
1149036943 17:52145432-52145454 CTACTACTTCTGTGGCATGGAGG - Intronic
1149086217 17:52719397-52719419 CTGCTATTTCAGTGGAAAGAAGG - Intergenic
1149230634 17:54530478-54530500 ATGGTACTTTTGTTGAAAGCTGG + Intergenic
1150442561 17:65203132-65203154 CTGGTGCTTCTCTGGAAACCGGG - Intronic
1151251271 17:72837244-72837266 CTGCCACCTCGTTGGAAAGCAGG + Intronic
1155499518 18:26472844-26472866 CTGCAGCTGCTGTGGGAAGCTGG + Intronic
1157280330 18:46342641-46342663 CTATTATTTCTGTGGAAATCAGG - Intronic
1158105604 18:53882370-53882392 CTGCTAGTTCTGAGGAATCCGGG - Intergenic
1161302589 19:3550028-3550050 CTGCTGCTTCTGAGGCCAGCAGG - Intronic
1163872205 19:19831252-19831274 CTGCTAGTTCTGAGGAATTCAGG + Intergenic
1163888378 19:19989316-19989338 CTGCTAGTTCTGTGGAATTCAGG + Intergenic
925768813 2:7262775-7262797 CTGCTGCTGCTGTGTGAAGCTGG + Intergenic
927222292 2:20724497-20724519 CAGCTAGTGCTTTGGAAAGCGGG + Intronic
927344146 2:22017398-22017420 GCGCTTCTTCTGTGGAAACCTGG - Intergenic
927374637 2:22399697-22399719 CTGCAAGTTCTATGGAAATCAGG - Intergenic
927874978 2:26649244-26649266 CTGCTACTTATGCTGAAAGTGGG + Intergenic
930087265 2:47506648-47506670 TTGCTCCTTCTGTGGCCAGCTGG + Intronic
930639396 2:53839893-53839915 CTGCTACTGGAGTGCAAAGCAGG - Intergenic
934138375 2:89019910-89019932 GTGCTGTTTCTGTGGAGAGCAGG - Intergenic
934230877 2:90180715-90180737 GTGCTGTTTCTGTGGAGAGCAGG + Intergenic
935684294 2:105669933-105669955 CTGCTGCTCCTGGGCAAAGCTGG + Intergenic
938388312 2:130883366-130883388 CTCCCTCTTCTGTGGAATGCCGG + Intronic
938942659 2:136182572-136182594 CAGCTACTTCTGTGGGTAGATGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940491543 2:154368421-154368443 CTGCCACTTCTGTGGGATGAAGG + Intronic
940532745 2:154901017-154901039 CATCAACTTCTGAGGAAAGCAGG - Intergenic
942785703 2:179699574-179699596 CTGCATCTTTTGTTGAAAGCAGG - Intronic
945116049 2:206409249-206409271 CTACTACCTCTGTGGAGAGATGG - Intergenic
946620621 2:221558498-221558520 CAGTTACTGCTGTGCAAAGCAGG - Intronic
1170309413 20:14975941-14975963 CTGTTAATTCCGTTGAAAGCCGG - Intronic
1172823433 20:37759144-37759166 CTGCTACTTTTGTAGAATTCAGG + Intronic
1172834551 20:37864594-37864616 CTGCTGGTTCTGGGGAAGGCTGG - Intronic
1173091279 20:39974699-39974721 CTGCTAGTTCTGAGGAATCCAGG - Intergenic
1173449131 20:43147004-43147026 CTGATGCTTCAGTGGAAGGCAGG - Intronic
1174778411 20:53366530-53366552 TTACTACCTTTGTGGAAAGCGGG + Intronic
1175738539 20:61404326-61404348 ATGCTGCTTCTCTGGAAAGTTGG + Intronic
1177956542 21:27605971-27605993 CTGGTACTTCTGAGGAATCCAGG - Intergenic
1179041277 21:37804248-37804270 GTGCAGCTTCTGTGGAAAACAGG + Intronic
1179249117 21:39658063-39658085 CTCCTCCTTCAGTGGAAGGCTGG + Intronic
1179413534 21:41179998-41180020 CTGCTGCTGCTGTGCACAGCCGG - Intronic
1180089248 21:45525355-45525377 CTGCTGCTTCTGAGAAGAGCTGG - Intronic
1181737052 22:24890394-24890416 CTGTTACCACTGGGGAAAGCTGG - Intronic
1182167105 22:28186895-28186917 CTGCTACTTTCTTGGAAAGAAGG - Intronic
1183669745 22:39265464-39265486 GCGCTGGTTCTGTGGAAAGCTGG + Intergenic
949115859 3:322133-322155 CTACTATTTCTGTGTAGAGCAGG - Intronic
950865434 3:16184768-16184790 CAGCTACCTCTGTGGGCAGCTGG + Intronic
952401594 3:32968406-32968428 CTGCACCTGCTGTGGAAGGCAGG + Intergenic
952814410 3:37434764-37434786 CTGATGCCTCTGTGGAATGCTGG + Intronic
953227492 3:41033856-41033878 CTGCTCCTGCTGTGGAAGGAAGG + Intergenic
954754694 3:52832801-52832823 CAGCAGCTTCTGTGGAAGGCAGG + Intronic
955063673 3:55516155-55516177 CTGCTCCTTCTGGGGGCAGCGGG + Intronic
955429278 3:58825729-58825751 TTACAACTTCTGTGGAAACCAGG - Intronic
957269454 3:78010605-78010627 CTGCAATTTCTGTAGAAAGAGGG - Intergenic
957291387 3:78281850-78281872 CTGGTACTTCTGAGGAATCCGGG + Intergenic
959567866 3:107851056-107851078 CTTCTACTTCTGTAGAAAATTGG + Intergenic
961518497 3:127453423-127453445 CTCCTAGTTCAGTGGAAAGCTGG - Intergenic
961736969 3:129008353-129008375 CTCCAACTTGTGTGGAAAGCAGG - Intronic
962852191 3:139316485-139316507 CTGCAACTTCTATGGAGAGATGG + Intronic
962896070 3:139715985-139716007 CTGCTATTTCTGTGGTAACCAGG + Intergenic
963603707 3:147397169-147397191 CTGCTACTTCTGTAGTGTGCAGG - Intronic
963850278 3:150204078-150204100 CTTCTCATTGTGTGGAAAGCAGG + Intergenic
965437747 3:168673229-168673251 CTTCTACTTCTGAGGAAAAGAGG + Intergenic
966140938 3:176754630-176754652 CTGCTGCTTGTGTTGAAACCGGG - Intergenic
966652399 3:182315663-182315685 CATCTACTTCTGTGGAAAGGGGG - Intergenic
967154350 3:186678898-186678920 CTGCTACTTCTGTAGAAAACTGG + Intergenic
967451887 3:189633640-189633662 CTGATACTTTTGGGGAAGGCAGG + Intronic
970492011 4:16584448-16584470 CTGCCACTTGTGTGTAAAGCTGG + Intronic
971558837 4:28047951-28047973 ATGCTGCTGCTGTGGAAAGAGGG + Intergenic
973018664 4:45172551-45172573 CTGCTAGTTCTGCGGAATCCGGG - Intergenic
975474476 4:74807425-74807447 CTGCAACTTCAGTTGAAAGAAGG + Intergenic
977060725 4:92254608-92254630 CTGCTAGTTCTGAGGAATCCAGG - Intergenic
978069136 4:104444765-104444787 CTACTACAGATGTGGAAAGCAGG + Intergenic
978953926 4:114593375-114593397 CTGCACCTGCTGTGGAAGGCAGG - Intergenic
981352871 4:143752599-143752621 CTGCTAGTTCTGAGGAATCCAGG + Intergenic
981684931 4:147443190-147443212 CTGACACTTCTCTGGAAAGATGG - Intergenic
983784414 4:171714887-171714909 CTGCTAGCTCTGTGGAGTGCAGG - Intergenic
983861749 4:172716021-172716043 TTGCTACAGTTGTGGAAAGCTGG - Intronic
984790502 4:183610472-183610494 TTGCTAAGTCTGTGGAAAGAGGG - Intergenic
986082122 5:4405769-4405791 CTTCTACATCTGTGGACATCTGG - Intergenic
986146360 5:5081713-5081735 CTACTACTTCTGGGGACAGAAGG - Intergenic
987250501 5:16095745-16095767 TTTATACTTCTGGGGAAAGCTGG + Intronic
988124014 5:27005580-27005602 GTTCAACTACTGTGGAAAGCAGG + Intronic
989619679 5:43372046-43372068 CTGTTACTAATCTGGAAAGCAGG - Intergenic
991977554 5:72198095-72198117 CATCTACTTCTGTGGAATGTGGG - Exonic
992376384 5:76191944-76191966 CTTCTAGTTCTGTGGAAGGCAGG + Intronic
993807959 5:92436373-92436395 CTGCTAGTTCTGAGGAATCCAGG + Intergenic
995394648 5:111674432-111674454 GTGCCACCTCTGTGGAATGCAGG - Intronic
997235074 5:132267986-132268008 CTGCTACCTCTGAGGGAGGCTGG - Intronic
997791862 5:136769126-136769148 CTGCTAGCTCTGTGGAGAGAAGG - Intergenic
999938963 5:156519680-156519702 CTGTTTCATCTCTGGAAAGCAGG + Intronic
1000138966 5:158382621-158382643 CTTATACTTCTGTGGTCAGCTGG + Intergenic
1000353420 5:160370578-160370600 CTGCTGCCGCTGAGGAAAGCCGG - Exonic
1000641342 5:163706102-163706124 CTGTTTCTACTGTGGAAGGCTGG + Intergenic
1001645431 5:173278279-173278301 ATGCTGCTTCTGTGGGAAGTTGG + Intergenic
1001739089 5:174035158-174035180 CTGCTAGTTCTGAGGAATCCAGG - Intergenic
1003020760 6:2507242-2507264 CTGCTTCAGCTGTTGAAAGCTGG - Intergenic
1003153933 6:3575277-3575299 CCCCTAGTTCTGTGGAAACCAGG + Intergenic
1007647852 6:43396601-43396623 CGGCTACCTCTGCGGGAAGCAGG - Intergenic
1008244208 6:49150543-49150565 CTGCTAGTTCTGAGGAATCCAGG - Intergenic
1009316664 6:62229080-62229102 CTGCTAATTCTGAGGAATTCAGG - Intronic
1009490715 6:64286548-64286570 CTGCAATATCTGTGCAAAGCAGG - Intronic
1010411694 6:75568507-75568529 CTGCTAGTTCTGAGGAATCCAGG + Intergenic
1010676148 6:78745763-78745785 GTGCTGCTGCTGTGGAGAGCAGG - Intergenic
1011191049 6:84728712-84728734 ATGATACATCTGTGGCAAGCTGG + Intronic
1011771513 6:90678591-90678613 CTGCTGCTACTGTGACAAGCTGG + Intergenic
1012164504 6:95931365-95931387 CTTCTTCTTCTGTGACAAGCAGG + Intergenic
1012968759 6:105704309-105704331 CTGCTTCTCCTGGGAAAAGCTGG + Intergenic
1014054009 6:116991928-116991950 ATGCTACTTCTGTGGAATTATGG - Intergenic
1014548294 6:122757732-122757754 CTCCTACTTGTGTGGATTGCAGG + Intergenic
1015635090 6:135267069-135267091 CTGCTACTTGTGTGGGGAGAAGG + Intergenic
1015660130 6:135566148-135566170 CTGCTAGTTCTGAGGAATACAGG - Intergenic
1017607316 6:156147967-156147989 CTGGTCCTTCTGTTGAGAGCTGG - Intergenic
1017909737 6:158782532-158782554 CTGCTCTTTACGTGGAAAGCAGG + Intronic
1018606661 6:165604692-165604714 TAGGTACTTCAGTGGAAAGCTGG + Intronic
1018918627 6:168154983-168155005 CTGCAACCTCTGTGGGAAGTTGG + Intergenic
1019042834 6:169120674-169120696 CTGCTACAGATGTGGTAAGCTGG + Intergenic
1019332099 7:465316-465338 CTCCTGCTTCTGAGGAATGCTGG + Intergenic
1020525307 7:9251386-9251408 CTGCTAGTTCTGAGGAATCCAGG + Intergenic
1021664581 7:22962945-22962967 CTGGTACTTAGGTGGAGAGCTGG - Intronic
1022273128 7:28829793-28829815 CTCCTACTTCTGGAGACAGCAGG + Intergenic
1022471317 7:30683322-30683344 CCGCTACTGGTGTGGAAACCAGG - Intronic
1022886854 7:34655463-34655485 CTAATTCTTCTGTGAAAAGCGGG - Intergenic
1028420333 7:90625714-90625736 CTGCTGCTTCTGTAGCATGCTGG - Intronic
1028459226 7:91072086-91072108 CTGCTAGTTCTGAGGAACCCAGG + Intronic
1028976937 7:96924969-96924991 GTGATACTTCTGTGGAATGTAGG - Intergenic
1029493753 7:100886186-100886208 CTGCTGTTTCTCTGGCAAGCGGG + Intronic
1030889500 7:114982016-114982038 CTGCTTTTTCTGTGGAATGAAGG + Intronic
1031115890 7:117667981-117668003 CTGGAGCTTCTGTGGAAAGAAGG - Exonic
1031300601 7:120057986-120058008 CTGTACCTTCTGTGGAAAGCTGG - Intergenic
1031956515 7:127947993-127948015 CTGCTACTTTTGGGTACAGCAGG + Intronic
1032919965 7:136534347-136534369 CTGCTAGTTCTGAGGAATCCAGG + Intergenic
1033451384 7:141465129-141465151 CTGCTCCTGCTGGGGAGAGCAGG + Intronic
1035882677 8:3259068-3259090 CTGCTACTTATATATAAAGCAGG + Intronic
1037619657 8:20552129-20552151 ATGCCACTACAGTGGAAAGCAGG - Intergenic
1038073739 8:24046638-24046660 CTGCTAGTTCTGAGGAATCCAGG + Intergenic
1038243292 8:25830725-25830747 CTGGTAGTTCTGAGGAATGCAGG - Intergenic
1038741324 8:30219516-30219538 CTGGCACTTCTGTGGAATACAGG + Intergenic
1041211806 8:55559520-55559542 CTGCTAGTTCTGAGGAATCCAGG - Intergenic
1044923849 8:97192970-97192992 CAGCTCTTTCTGTGGAAACCTGG - Intergenic
1046670344 8:117050120-117050142 CTGCCACATCTCTGCAAAGCAGG + Intronic
1047284377 8:123474319-123474341 TTGACACTTCTGAGGAAAGCTGG + Intergenic
1048587662 8:135790416-135790438 CTGCTAGTTCTGAGGAATCCGGG - Intergenic
1050476365 9:6045321-6045343 CTCCTACTCCTGGGGAAAGGGGG - Intergenic
1051664042 9:19451449-19451471 CTACTACCTCTGTGGAGAGATGG + Exonic
1052717000 9:32129065-32129087 CTGCTAGTTCTGAGGAATCCAGG + Intergenic
1052989485 9:34510803-34510825 CTTCTCCTTCTGTGTAAAGGTGG - Intronic
1054905401 9:70410454-70410476 CTGCTACTTCTGTAGTGTGCTGG - Intronic
1055252424 9:74323847-74323869 CTGCCACTACTGTGGCCAGCTGG + Intergenic
1055400154 9:75914880-75914902 CCCCTACTTCTGTGAAAATCTGG + Intronic
1055483558 9:76734178-76734200 CCCCTCCTTCTGTGGAAAGGAGG + Intronic
1056305516 9:85286864-85286886 CTGCCACTTGTGGGGAAAACAGG + Intergenic
1058510292 9:105710931-105710953 CTCCTACCTCTGCGCAAAGCTGG + Intronic
1061805589 9:133135900-133135922 CTGATACTTCTGTAAAATGCAGG + Intronic
1062601505 9:137320494-137320516 CTGCCCCTGCTGTGGCAAGCAGG - Intronic
1186101632 X:6163565-6163587 CTGCTCCTTCTGTGGGATGGTGG + Intronic
1187068456 X:15864313-15864335 CTGCTATTTCTGGGGCAAGCAGG - Intergenic
1187232857 X:17439024-17439046 CTGGGACTTCTCTGGAAAGATGG - Intronic
1188971307 X:36618891-36618913 CTGCTGCTTCTTTGCAAAACTGG - Intergenic
1192716491 X:73647784-73647806 CTGCTACTGCTGAGGAATCCAGG + Intronic
1193384726 X:80856937-80856959 CTGCCAGGTCTGTGGAAAGGGGG - Intergenic
1194445922 X:93986959-93986981 CTGCTAGTTCTGAGGAATCCAGG + Intergenic
1198494287 X:137175426-137175448 GTGCTGCTACTGTGGAAAGCAGG + Intergenic
1201495441 Y:14587926-14587948 CTGCTCCTTCTGTGAAATGTTGG - Intronic