ID: 1091101637

View in Genome Browser
Species Human (GRCh38)
Location 11:132879985-132880007
Sequence TAACCTTCCCCCAGCCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091101635_1091101637 8 Left 1091101635 11:132879954-132879976 CCTGCCAAGCACATTCTTTCTTG 0: 1
1: 0
2: 1
3: 35
4: 315
Right 1091101637 11:132879985-132880007 TAACCTTCCCCCAGCCCCAGAGG 0: 1
1: 0
2: 2
3: 23
4: 266
1091101636_1091101637 4 Left 1091101636 11:132879958-132879980 CCAAGCACATTCTTTCTTGTCTT 0: 1
1: 0
2: 3
3: 76
4: 862
Right 1091101637 11:132879985-132880007 TAACCTTCCCCCAGCCCCAGAGG 0: 1
1: 0
2: 2
3: 23
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091101637 Original CRISPR TAACCTTCCCCCAGCCCCAG AGG Intronic
900313626 1:2046656-2046678 CACCCTACCCCAAGCCCCAGCGG + Intergenic
900324989 1:2104336-2104358 TAACCTTCCCTCAGCCCGTGGGG - Intronic
901824171 1:11849764-11849786 TCACCTTCCCCATGCCCCTGGGG + Intergenic
902044882 1:13516801-13516823 TCCCCATCCCCCACCCCCAGCGG + Intergenic
902087555 1:13875036-13875058 TGACCTTCCACCAGCCACATGGG + Intergenic
903379608 1:22887514-22887536 TGGCCTTCCCCAAGCCCCACTGG + Intronic
903498674 1:23789830-23789852 GCACTTTCCCCCAGGCCCAGAGG - Intergenic
903983039 1:27203703-27203725 TACCCTTCCCCCAGGTGCAGTGG + Intergenic
904607658 1:31706768-31706790 TCAACCTGCCCCAGCCCCAGGGG - Intergenic
905261246 1:36720977-36720999 ACACCATACCCCAGCCCCAGGGG - Intergenic
906035409 1:42747590-42747612 TACCCTTCCCCCATCCAGAGGGG - Intronic
907157701 1:52349744-52349766 TTGTCTTCCCCCAGCCACAGTGG + Intronic
907528899 1:55073038-55073060 CTCCCTTCCCCCAGCCCCTGGGG - Intronic
910203633 1:84725501-84725523 TTCCCTTCCCCCATCCTCAGAGG + Intergenic
910395750 1:86792185-86792207 TCACTTTTCCCCATCCCCAGGGG - Intergenic
910508566 1:87977930-87977952 TCACCCTCCCTCAACCCCAGAGG - Intergenic
912500823 1:110121014-110121036 CAATCTTCCCACAGCCACAGCGG + Intergenic
913333684 1:117687713-117687735 TGACCTTCCCACAGCCCCCTTGG - Intergenic
914830976 1:151170655-151170677 TCTCCCTCCCCCAGCGCCAGTGG - Exonic
915298766 1:154940334-154940356 TTACCTTCGCTCAGCCCCAGGGG - Intergenic
915918238 1:159954139-159954161 TCAGCAGCCCCCAGCCCCAGAGG + Exonic
916128099 1:161589125-161589147 TTATCTTCAGCCAGCCCCAGGGG + Intronic
916138017 1:161670955-161670977 TTATCTTCAGCCAGCCCCAGGGG + Intronic
916205064 1:162308397-162308419 TAGCCTTCCCCCTGCCCCCCAGG - Intronic
917788351 1:178483530-178483552 TAACATTGCCCAAGCCCCACAGG - Intergenic
919166945 1:193907549-193907571 TACCCTTCTCCCAGCAGCAGTGG + Intergenic
920437200 1:205955059-205955081 CCACCTGCCCCCAGCCCCATGGG + Intergenic
922324123 1:224512730-224512752 TTACCTTCCTCCAGCCCCTGAGG + Intronic
922355120 1:224767989-224768011 CCTCCTTCCCCCAGCCCCACTGG - Intergenic
922388677 1:225114839-225114861 CACCCTTCCCCCACCCCCTGTGG - Intronic
922719632 1:227893617-227893639 TCCCCTTCCCCCAGCCACATGGG - Intergenic
922884546 1:229007886-229007908 TTTCCTACCCTCAGCCCCAGTGG + Intergenic
923036795 1:230290152-230290174 TAAACTTCCACCAGGCACAGTGG - Intergenic
923738648 1:236635524-236635546 TACCCTTCGCCCTGCCCCATCGG - Intergenic
923953894 1:238992962-238992984 TAACCTCTCCCCAGCCCCACTGG + Intergenic
924870067 1:248032514-248032536 CTCCCTTCCCCCATCCCCAGGGG + Intronic
1064597230 10:16958212-16958234 TCCCCTACCCCCAGCCCCTGAGG + Intronic
1065755919 10:28931010-28931032 TAACCTTTCAGAAGCCCCAGAGG - Intergenic
1068103841 10:52590332-52590354 CACCCCACCCCCAGCCCCAGAGG - Intergenic
1069723977 10:70565897-70565919 TTGACCTCCCCCAGCCCCAGTGG - Intronic
1070802401 10:79251297-79251319 TAATCCTCCCACAGCCCTAGGGG - Intronic
1072486967 10:95864874-95864896 CAACCTCCCCCCAGCCCAACAGG - Intronic
1072632424 10:97155457-97155479 TAACCTTCCACCAGCCCTTGGGG - Intronic
1075197692 10:120375273-120375295 GACCCTGCCCCCAGCCCCTGGGG - Intergenic
1076191966 10:128489480-128489502 CAGCCTTGCCCCCGCCCCAGCGG + Intergenic
1076386970 10:130064211-130064233 AAACCTCCCCCCACCCACAGAGG + Intergenic
1076699122 10:132260990-132261012 ACAGCTTCCCCCAGCCCCAGGGG - Intronic
1076721220 10:132394213-132394235 TCACCCACCCCCAGCCCCGGTGG + Intergenic
1077393366 11:2309827-2309849 TGAGCTCCCCCCACCCCCAGAGG - Intronic
1077485115 11:2834984-2835006 CAACCTGGCCCCAGCCTCAGGGG + Intronic
1077808516 11:5613567-5613589 TGAACTTCCACCAGCCCCATAGG - Intronic
1077970344 11:7182285-7182307 CAAGCTCCCCCAAGCCCCAGAGG - Intergenic
1078186937 11:9060240-9060262 TAACCTTCCACTAGCCCAGGGGG + Intronic
1079102291 11:17549258-17549280 TGCCCCTGCCCCAGCCCCAGCGG + Intronic
1080699734 11:34634501-34634523 TTCCCTGTCCCCAGCCCCAGGGG - Intronic
1081539247 11:44018125-44018147 TGTCTGTCCCCCAGCCCCAGTGG + Intergenic
1081718561 11:45268785-45268807 CATCCTTCCTCCAGCCCCACTGG - Intronic
1083780377 11:64914445-64914467 AAGCCTTCCACCAGCTCCAGCGG + Exonic
1084025087 11:66443082-66443104 CAACCCTCCCCCCACCCCAGAGG + Intronic
1084031624 11:66484636-66484658 CTCCCTTCCCCCAGCTCCAGGGG - Intronic
1084170609 11:67399163-67399185 TGACCTTCCCCCGGCCCCCCAGG - Exonic
1084268557 11:68017271-68017293 GCACCTTCCCCCAGCCTCAGTGG + Intronic
1084288882 11:68148955-68148977 CAACCTTGCCCCAGGCCAAGTGG + Intergenic
1084580551 11:70020438-70020460 CCACCCTCCCCCAGCCCCTGGGG + Intergenic
1086883840 11:92180724-92180746 CGACCTTCCCCCTACCCCAGAGG + Intergenic
1087897605 11:103604334-103604356 AAACTTTCACCCAGCCCCTGAGG + Intergenic
1089180948 11:116582479-116582501 CAACCTTCCCTGAGCCCAAGAGG + Intergenic
1091101637 11:132879985-132880007 TAACCTTCCCCCAGCCCCAGAGG + Intronic
1091638034 12:2213085-2213107 TAGCCGGGCCCCAGCCCCAGAGG - Intronic
1096231009 12:49896916-49896938 GTAGCTTCCCCCAGCCCCACAGG - Intronic
1096672564 12:53209032-53209054 TACCCTTCCCCCACAACCAGGGG + Intergenic
1097261869 12:57725077-57725099 TGTCCTGCCACCAGCCCCAGTGG + Intronic
1100208175 12:92374124-92374146 GAGCCTTCCCCCAGCACCACTGG + Intergenic
1100478617 12:94956638-94956660 TCCCCTTCTCCCAGCCCCAGGGG - Intronic
1101740020 12:107493465-107493487 GAACCTTCTCTCAGCCTCAGAGG + Intronic
1102762928 12:115404834-115404856 TACCCATCACCCAGCCCAAGAGG + Intergenic
1103941776 12:124505266-124505288 GAACCTTCCCCCAACCCCAAGGG + Intronic
1104084090 12:125458546-125458568 TAACCATCCCCCAGCCCTGAGGG - Intronic
1104918404 12:132278141-132278163 TAACCCACTCCCAGCCCCCGGGG - Intronic
1105020692 12:132814700-132814722 TAACCCGCCCCCAGCCCTGGAGG - Intronic
1105292217 13:19060450-19060472 TAAACTCCCCACAGGCCCAGGGG + Intergenic
1105898727 13:24739702-24739724 GACCCTTGCCCCACCCCCAGTGG - Intergenic
1106583360 13:31036433-31036455 TAACCTTTCCCCAGCCTAGGGGG + Intergenic
1108155009 13:47575915-47575937 TATCTTTCCCCTAGCCCCTGAGG + Intergenic
1108582932 13:51842181-51842203 TACCCCTACCCCAGCCCCAGTGG - Intergenic
1112091591 13:96090029-96090051 AAAGCCTCCCCCAGCCCCGGAGG - Intergenic
1112367598 13:98768910-98768932 GAACATTCCCAGAGCCCCAGAGG + Intergenic
1113144815 13:107196838-107196860 TCACCTCCCCCCAACCCCTGTGG - Intronic
1113761735 13:112852712-112852734 CAACCTGCCCCCCGCCCCAGGGG - Intronic
1113935864 13:113995391-113995413 TAATCCTCCCACAGCCTCAGAGG - Intronic
1114880670 14:26781475-26781497 TGTTCTTCCCCCAGCCCTAGAGG + Intergenic
1115302253 14:31897645-31897667 AAACCTCCCCCCATCCCCACTGG - Intergenic
1117388889 14:55244124-55244146 TAGCCTTCCCCTAGCCCCAGTGG + Intergenic
1117709877 14:58516383-58516405 TACCCTTCCCCCAGCCAAATAGG - Intronic
1117728205 14:58695037-58695059 TAAACTTCCCCCAGCCTCAAGGG + Intergenic
1118350771 14:64971604-64971626 TAACATCCCCACACCCCCAGGGG - Intronic
1118985300 14:70749391-70749413 TAGCCTTCCCCCACCCACAATGG + Intronic
1121139512 14:91528813-91528835 TACCTTACCCCCAGCCACAGTGG - Intergenic
1121602738 14:95218155-95218177 CCACCTTCTCCCAGCCGCAGAGG - Intronic
1122965648 14:105123985-105124007 TGACCTTCAGCCACCCCCAGAGG + Intergenic
1124952558 15:34337438-34337460 TAACCTCCTCCCAGACCCCGAGG - Exonic
1125413682 15:39430565-39430587 AAAGCTTTCCCCAGCCCCTGCGG + Intergenic
1126024726 15:44434972-44434994 TAACCTTCGACCAGACACAGTGG + Intronic
1126559825 15:50031306-50031328 TACCTTTCCCCTAGCCCCAGTGG + Intronic
1126587793 15:50306674-50306696 AGCCCCTCCCCCAGCCCCAGAGG + Intronic
1126961496 15:54001838-54001860 ATACCTTCCCCCACCCACAGGGG + Intergenic
1128459327 15:67854453-67854475 GTGACTTCCCCCAGCCCCAGTGG - Intergenic
1133025994 16:2989219-2989241 ACACCTTCCTCCAGGCCCAGGGG + Intergenic
1133209903 16:4257792-4257814 TCAGCTTCCTCCAGCCCCCGGGG + Exonic
1135313613 16:21424882-21424904 TAAGCTTCCCCCAGCATCACCGG + Intronic
1135366537 16:21857162-21857184 TAAGCTTCCCCCAGCATCACCGG + Intronic
1135384789 16:22028792-22028814 TAACCTTCCCTCACTCCCATAGG + Intronic
1135445278 16:22513996-22514018 TAAGCTTCCCCCAGCATCACCGG - Intronic
1135841060 16:25876628-25876650 GACCCTACCCCCAGCTCCAGAGG - Intronic
1136666693 16:31819267-31819289 TGACCTTCCCTGACCCCCAGCGG + Intergenic
1137768634 16:50996813-50996835 CCACCCTCCCCCAGCCCCACTGG + Intergenic
1138067855 16:53960567-53960589 CAAGATTCCCCCAGCACCAGAGG - Intronic
1138098189 16:54230157-54230179 TGCCCTTCCCCCAGCCCACGTGG - Intergenic
1138651141 16:58462575-58462597 TTCCTTTCCCCCAGCTCCAGGGG - Intergenic
1139346397 16:66306580-66306602 TCACCTTTGCCCAGCCCCACTGG - Intergenic
1139446683 16:67002567-67002589 ATACCATCCCCCAGCCCCAGGGG - Intronic
1141986894 16:87585941-87585963 TAACATACCCCCAGCCTCGGGGG + Intergenic
1143013694 17:3880303-3880325 TCCCCTAGCCCCAGCCCCAGTGG + Intronic
1144013316 17:11170735-11170757 TAACCTTCCCAAAGCCCCACTGG - Intergenic
1145979424 17:29003048-29003070 CAACCTTACCCCAGTCTCAGCGG + Intronic
1147563342 17:41522081-41522103 AAACCTTCCCTCTGCCTCAGGGG - Exonic
1147621273 17:41869229-41869251 AAACCTTCTACCAGCCCCACTGG + Intronic
1149186302 17:54001715-54001737 TAGCCTCCCTCCAGCCACAGTGG + Intergenic
1150816457 17:68395956-68395978 CAACATTCTCCCAGCTCCAGAGG + Intronic
1151383990 17:73744113-73744135 TACCTGTCCCCCAGCCCCTGTGG + Intergenic
1151954975 17:77375651-77375673 AAACCTTCCCCCAGAGCCAAAGG - Intronic
1152004597 17:77672168-77672190 ATCCCTTCCCCCAGCCCAAGCGG - Intergenic
1155061987 18:22236986-22237008 TACCCTTATCCCAGCTCCAGTGG - Intergenic
1156250039 18:35344100-35344122 TCACCTTCCCCCTCCCCCACCGG - Intronic
1156390235 18:36643428-36643450 TATTCTGCCCCCAACCCCAGGGG - Intronic
1157498125 18:48170915-48170937 TAGCCCTCCCCCTGCCCCACAGG + Intronic
1158589723 18:58769000-58769022 TGCCCTGCCCCCTGCCCCAGGGG - Intergenic
1160079531 18:75712133-75712155 TTCCCTTCTCCCAGCCCCACAGG - Intergenic
1160246742 18:77165535-77165557 CAGCCTTCCCCCAGCCTCATAGG - Intergenic
1160537148 18:79600762-79600784 CATCCTTCCCCCACCCACAGGGG + Intergenic
1160537169 18:79600822-79600844 GACCCTTCCCCCACCCGCAGGGG + Intergenic
1160754808 19:751607-751629 AAACCAGCCCCCAGCCCCACGGG - Intronic
1160809519 19:1007405-1007427 GATCCTGCCCCCCGCCCCAGGGG + Intronic
1161036058 19:2085151-2085173 TAACCTGCCCCCGGCCTCAGGGG - Intronic
1161797026 19:6393133-6393155 TTACCTTTTCCCAGCGCCAGAGG - Exonic
1162142950 19:8595696-8595718 GTTCCCTCCCCCAGCCCCAGCGG + Intronic
1162736517 19:12750045-12750067 AAGCCTGCCCCCAGCCCCTGCGG + Intergenic
1162923652 19:13918832-13918854 CAGCCTGCCCCCAACCCCAGAGG - Intronic
1162947317 19:14051910-14051932 GAACTTTCTCCCAGACCCAGCGG - Exonic
1163650190 19:18512989-18513011 TGTCCTTCCCCCAGGCCCATCGG - Intronic
1164537828 19:29099477-29099499 TAACATTCACCAAGGCCCAGTGG - Intergenic
1165231405 19:34389446-34389468 TATGCTTCCCCCTGCCTCAGTGG + Intronic
1165312882 19:35039560-35039582 CTACCTTCCCCCATCCCCCGGGG + Intronic
1166938801 19:46350684-46350706 TAGCCATCTCCCAGCCCCCGGGG - Intronic
925337841 2:3111610-3111632 TATATTTCCCCCACCCCCAGAGG - Intergenic
926051214 2:9746013-9746035 TGCCCTACCCCCACCCCCAGCGG - Intergenic
926072297 2:9907523-9907545 AAGCTTTCCCCGAGCCCCAGAGG - Intronic
927146712 2:20170993-20171015 CAGCCTTCTCACAGCCCCAGGGG + Intergenic
928265025 2:29803933-29803955 TAACCTCCCCCAAGCAACAGTGG + Intronic
929430314 2:41880716-41880738 CAACCTTCCCCCACCCTGAGTGG - Intergenic
929470827 2:42191325-42191347 TGATCTTCCCCCAGCAGCAGTGG + Intronic
931355758 2:61537221-61537243 CAACTTCTCCCCAGCCCCAGGGG + Intronic
931644325 2:64408038-64408060 TCACCTTCTCCCTGCCACAGGGG + Intergenic
931917694 2:66976739-66976761 TAATATTCGTCCAGCCCCAGTGG - Intergenic
932431660 2:71679241-71679263 TCTACTTCCTCCAGCCCCAGTGG + Intronic
936006318 2:108892197-108892219 TGTCCTTCCCACAGTCCCAGTGG + Intergenic
936917710 2:117656813-117656835 AAATCTTCCTCCAGCCCGAGTGG - Intergenic
937121699 2:119444040-119444062 TTACCTATCCCCAGCCTCAGCGG - Intronic
937288469 2:120767698-120767720 TCACCCTGCCCCAGCCACAGTGG + Intronic
938067078 2:128287086-128287108 TAAGCCACCCCCTGCCCCAGAGG - Intronic
938376661 2:130812263-130812285 TATCCGTCCCCCAGCCCCCCAGG + Intergenic
938653914 2:133411519-133411541 TGCCCCTCCACCAGCCCCAGTGG - Intronic
941920983 2:170850498-170850520 TCACCTTGCTCCAGCCCCAATGG - Intronic
944751886 2:202717683-202717705 CATCCCTCCCCCAGCTCCAGGGG - Intronic
948096428 2:235337842-235337864 TACTCTTCTCCTAGCCCCAGTGG - Intergenic
948398287 2:237663550-237663572 TTAACTTCCCCCAGTTCCAGAGG - Intronic
1170567270 20:17614363-17614385 TCCCTGTCCCCCAGCCCCAGGGG - Intronic
1172275187 20:33675410-33675432 TCTCCTTTCCCCAGCCCCAGAGG - Intergenic
1172380360 20:34484940-34484962 CTCCCTTCTCCCAGCCCCAGAGG + Intronic
1173514742 20:43657446-43657468 TAACCAGCCCCGCGCCCCAGAGG - Intergenic
1173666584 20:44767431-44767453 AAGCCCTTCCCCAGCCCCAGGGG + Intronic
1175357498 20:58380514-58380536 AACACTGCCCCCAGCCCCAGAGG + Intergenic
1175940236 20:62534429-62534451 TGCCCTTCCCACAGCCCCCGGGG + Intergenic
1176181295 20:63751121-63751143 TACCCCTCCCCCCGCCCCCGCGG + Intronic
1178628974 21:34243053-34243075 CCACCTTCCACCTGCCCCAGAGG - Intergenic
1179715258 21:43283067-43283089 TATCCTGCCCCCAGCCCACGTGG - Intergenic
1180962165 22:19766955-19766977 ATACGTTCCCCCAGCCCCAGGGG + Exonic
1181457237 22:23066747-23066769 CAACCACCCCCCACCCCCAGCGG - Intronic
1181625333 22:24119031-24119053 TCCCCATACCCCAGCCCCAGAGG + Intronic
1183407272 22:37636483-37636505 TACCCTGAGCCCAGCCCCAGAGG - Intronic
1183517989 22:38278826-38278848 TGGCCTTCCCCCCCCCCCAGTGG + Intergenic
1184151902 22:42644267-42644289 GCACCTGCCCCCAGCCCCGGGGG + Intronic
1185105574 22:48867681-48867703 AATCCTTCCCACAACCCCAGAGG - Intergenic
1185347193 22:50315748-50315770 GAACCTGCTGCCAGCCCCAGTGG - Exonic
1185383840 22:50522603-50522625 TCCCCTGCCCCCAGCTCCAGTGG - Intronic
949505089 3:4719898-4719920 TCCCCCTGCCCCAGCCCCAGGGG - Intronic
949710376 3:6863726-6863748 TAACCTACCCCAGCCCCCAGTGG - Intronic
952930867 3:38360209-38360231 GAACCTTCCCCAACCCCAAGTGG - Intronic
953194847 3:40722551-40722573 TCACCTTCCCCCAACCTCAAGGG - Intergenic
954917969 3:54164684-54164706 CATCCTTCCCCCATCCCCACTGG - Intronic
955587676 3:60499157-60499179 TCACCATCCCCCAGCCCCAAGGG - Intronic
955677633 3:61465337-61465359 TAACCCTACCCCACCCCTAGAGG + Intergenic
956172853 3:66446266-66446288 TCACCTTCCCCCTTCCCCGGGGG - Intronic
958727689 3:97925696-97925718 TAAACTCCCACCACCCCCAGAGG - Intronic
959902372 3:111674970-111674992 CTACCTTCCCCCATCTCCAGAGG + Exonic
960076812 3:113495560-113495582 CAACCCTTCCCCAGCCCCACAGG + Intronic
960854788 3:122091936-122091958 CAGCCTTCCCCCATCCCCATGGG - Intronic
961644909 3:128387732-128387754 ATTCCTTTCCCCAGCCCCAGTGG - Intronic
961701614 3:128748928-128748950 CACCCTTCTCCCTGCCCCAGTGG - Intronic
962352374 3:134665282-134665304 TAGCCTTTCCCCAGATCCAGGGG - Intronic
962676215 3:137760621-137760643 CAGCCATTCCCCAGCCCCAGAGG + Intergenic
962848396 3:139290061-139290083 TAACCAGCCCGCAGCCCCAATGG + Intronic
962855462 3:139340927-139340949 CAACCCTCCCCAACCCCCAGTGG + Intronic
966557893 3:181284499-181284521 TTCCCTGCCCCCAGCCCCACCGG + Intergenic
968438949 4:611939-611961 GAGCCTTCCCCCAGCCACAGAGG - Intergenic
969224882 4:5789301-5789323 CATGCTGCCCCCAGCCCCAGTGG + Intronic
969316531 4:6384753-6384775 TAACCTCACGCCAGCCCCTGCGG + Intronic
970104341 4:12563709-12563731 TAACTTCCTCCCAGCCCCATTGG - Intergenic
972740480 4:41882146-41882168 TACCCCTCCCCCACCCCCGGAGG + Intergenic
973293065 4:48489664-48489686 GTCCCTTCCCCCAGTCCCAGTGG - Intergenic
973781343 4:54290739-54290761 CATCCCTCTCCCAGCCCCAGGGG - Intronic
980002114 4:127501731-127501753 GCCCCTTCCCCCAGCCCCAACGG - Intergenic
980890480 4:138809731-138809753 TCCCCTTCCCCCAGCCCCAGAGG + Intergenic
986734093 5:10655421-10655443 TACACTCCCCCCAGCCCCACCGG + Intergenic
987306363 5:16641359-16641381 TCACCTCACCCCAGGCCCAGTGG + Intergenic
987483085 5:18484308-18484330 TAACTTTCCCCCAGCCTTATTGG - Intergenic
987720237 5:21624074-21624096 CACCCTTCCTCCAGGCCCAGGGG + Intergenic
993075609 5:83226355-83226377 CACCCTCCCTCCAGCCCCAGAGG - Intronic
993683984 5:90915699-90915721 AGACCCTCCCCCAGCCCCCGTGG + Intronic
995573493 5:113505831-113505853 TAACATTCCAAGAGCCCCAGTGG - Intergenic
998148926 5:139746213-139746235 GAGCCTTCCCCCACCCCCAGCGG + Intergenic
999324853 5:150637589-150637611 AAACCTGCCCCCAACCCCTGCGG - Intronic
1001566325 5:172701679-172701701 AATCCTCCCTCCAGCCCCAGCGG - Intergenic
1001642720 5:173256499-173256521 GTCCCTTCCCCCAGCCTCAGGGG - Intergenic
1001705282 5:173737082-173737104 GTTTCTTCCCCCAGCCCCAGGGG - Intergenic
1003520842 6:6857131-6857153 CACCCTTCCGCCAGCCCCAGGGG - Intergenic
1006512235 6:34527764-34527786 TACCCTTCCCCCAGGCTCACTGG + Intronic
1006534492 6:34687221-34687243 TTTCTTTCCCCCACCCCCAGGGG - Intronic
1007419576 6:41711687-41711709 TCAGCTCCCCCAAGCCCCAGGGG + Intronic
1007461484 6:42022469-42022491 AAACCATGACCCAGCCCCAGAGG - Intronic
1008355439 6:50547350-50547372 GCACCTTCCTCTAGCCCCAGAGG + Intergenic
1008817224 6:55582466-55582488 TGACTTACCCCCACCCCCAGAGG - Intergenic
1008876587 6:56336202-56336224 TAGCTGTGCCCCAGCCCCAGAGG - Intronic
1010940866 6:81916183-81916205 TATCCCTCCCCCCTCCCCAGGGG + Intergenic
1011789140 6:90879218-90879240 TATCCCTCGCCCAGGCCCAGAGG - Intergenic
1013096390 6:106949195-106949217 TAACCTCACCCCACTCCCAGAGG - Intergenic
1017625277 6:156341507-156341529 TCACCTTCTCCCACCTCCAGAGG - Intergenic
1018154216 6:160970496-160970518 TAAGCTTTCCCCATCTCCAGAGG - Intergenic
1020978821 7:15042131-15042153 TTTCCTTCCCCGACCCCCAGAGG - Intergenic
1021386774 7:20040441-20040463 TAGCCTTCCCCCAACACCTGAGG + Intergenic
1022472006 7:30687817-30687839 CAACCTTCCCTCACCCTCAGAGG - Intronic
1023263784 7:38383971-38383993 TAGCCTACCTCCAGCCACAGCGG + Exonic
1023387194 7:39670798-39670820 TTTTCTTACCCCAGCCCCAGTGG - Intronic
1023913271 7:44570037-44570059 TGATCTTCCCCCAACCCCTGAGG - Exonic
1024989898 7:55224942-55224964 TACCCTACACCCATCCCCAGTGG + Intronic
1025924510 7:65946200-65946222 TCACCATGCCCCAGCCTCAGTGG + Intronic
1025931831 7:66001429-66001451 TCACCATGCCCCAGCCTCAGTGG + Intergenic
1026206816 7:68264835-68264857 AAACCATCCTCCAGCCCCAAGGG - Intergenic
1026679289 7:72453106-72453128 TTTCTTTCCCCCAGCCCTAGTGG + Intergenic
1029478724 7:100800486-100800508 TGATCTTCCCCCAGCCCAATTGG - Intergenic
1029712426 7:102307070-102307092 TGAGCTTCGCCCAGGCCCAGGGG - Intronic
1034044406 7:147912731-147912753 AAACCTCCTCCAAGCCCCAGAGG + Intronic
1035099399 7:156384045-156384067 TCCCCTTCCCACAACCCCAGTGG + Intergenic
1035261029 7:157661736-157661758 TCACCTGCCCCCAGGCTCAGGGG - Intronic
1035299945 7:157890730-157890752 TCACCTGCCCCCAGCACCACAGG + Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1037693746 8:21206121-21206143 TTCACTTCACCCAGCCCCAGAGG + Intergenic
1040111821 8:43570115-43570137 CCACCTTTCCCCATCCCCAGGGG + Intergenic
1041258733 8:56001842-56001864 TCACCTTCTCCAAGCCTCAGGGG - Intronic
1045860693 8:106812210-106812232 TTCCCTGCCCCCAGTCCCAGAGG - Intergenic
1049363952 8:142227415-142227437 CAACCTGCCCACAACCCCAGTGG + Intronic
1049443513 8:142619704-142619726 GAATGTTCCCGCAGCCCCAGGGG - Intergenic
1049951905 9:653238-653260 TAACGTTCCCAGAGTCCCAGAGG + Intronic
1049998028 9:1049736-1049758 TAACCTTCACCGAGCCCGTGTGG - Intergenic
1050537675 9:6644989-6645011 TAAACCACCCCCAGCCCAAGTGG - Intronic
1053484113 9:38439268-38439290 TTCCCTTCTCCCAGCCCAAGGGG - Intergenic
1057282374 9:93722106-93722128 CACCCTGCCCCCAGCCCCAACGG + Intergenic
1061562569 9:131415426-131415448 TGACCCAGCCCCAGCCCCAGGGG - Intronic
1061743601 9:132724284-132724306 CAAGCTTCCCACAGCCCCAGAGG + Intergenic
1061801168 9:133114122-133114144 CACCCTTCCCCCACCCCCGGGGG + Intronic
1062533991 9:137013629-137013651 TCCCCTTCCCCCAACCCCAAGGG + Intronic
1187388908 X:18873070-18873092 AATCCTCTCCCCAGCCCCAGGGG - Intergenic
1187757899 X:22546669-22546691 TATCCTTCCCCCAGCCACCTGGG + Intergenic
1189720127 X:43907290-43907312 TTACATTCACCCAGCACCAGGGG - Intergenic
1192448229 X:71226047-71226069 TTATCTTCCCCCAGCCTCACAGG + Intergenic
1192523613 X:71823347-71823369 AAACCCACCCCCTGCCCCAGTGG - Intergenic
1192583512 X:72303339-72303361 TCACATTCTCCCAGTCCCAGTGG - Intronic
1194143516 X:90234990-90235012 TAACCTCCCCCCAACCAGAGAGG + Intergenic
1195672979 X:107484594-107484616 TCCCCTCCCCCTAGCCCCAGGGG - Intergenic
1197148675 X:123195961-123195983 TAACCTTCCCCCAGGCAATGCGG + Intronic
1198522205 X:137464491-137464513 CAACCTCTCCCCAGCCCCTGAGG - Intergenic
1200489269 Y:3804311-3804333 TAACCTCCCCCCAACCAGAGAGG + Intergenic