ID: 1091102351

View in Genome Browser
Species Human (GRCh38)
Location 11:132886768-132886790
Sequence TCATTTCCAAAGATGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091102351 Original CRISPR TCATTTCCAAAGATGCTGCA GGG (reversed) Intronic
900538876 1:3192879-3192901 TCATTTCCAACAAACCTGCAGGG - Intronic
902185215 1:14719923-14719945 TGTTTTCCAAACATGCTGTAGGG - Intronic
903285767 1:22275797-22275819 TCCTTTCCCAAGATGTTTCAGGG - Intergenic
904469178 1:30725489-30725511 TCTTCTCCAGAGATGCTGCAAGG + Intergenic
904909902 1:33927033-33927055 TCATTTCCACAGAGGCTGAGGGG - Intronic
906041936 1:42794246-42794268 TTATTCACAAAGATGATGCATGG - Intronic
907844401 1:58190743-58190765 GCATTTCCAAAGATGTTTCCTGG - Intronic
907942106 1:59098120-59098142 TCATTCCCAAAGTTACTTCATGG + Intergenic
908567588 1:65374014-65374036 TCTTTTCCATAGATGGTGCTGGG - Intronic
910716325 1:90235570-90235592 TCATGTCCAGAGATGCTGTCTGG + Intergenic
913139101 1:115922768-115922790 TCATTTCCAGAGCTGCTTCTGGG + Intergenic
914909684 1:151774669-151774691 TAATCTCCAAAGATGCTCTAGGG + Intronic
915895936 1:159810850-159810872 TCCTTTCCAGGGATGCTGTAAGG + Intronic
916289997 1:163155203-163155225 TGCTTTCCAAAGATGCAGAATGG - Intronic
918690025 1:187468119-187468141 TCATTTCAAATGATGTTCCATGG - Intergenic
920507783 1:206528903-206528925 GCATTGCCCAAGATGCTGAAAGG + Intronic
920671098 1:208004152-208004174 ACATTTCCAAAGAGTCTGAATGG + Intergenic
920842359 1:209565450-209565472 CCATGTCCAAACATGCTGCAGGG - Intergenic
921650891 1:217676426-217676448 TCTTTTCCATTGATGCTTCAGGG - Intronic
921757097 1:218870722-218870744 TCACTTCAAAATATACTGCAAGG - Intergenic
921777970 1:219125077-219125099 TCACTTCCAAAAATTCTTCAAGG + Intergenic
922675229 1:227545365-227545387 GCATTTCCAGATAAGCTGCAGGG + Intergenic
922999838 1:229997992-229998014 TCTTTTCCAAAAATGTTGCATGG - Intergenic
1063695356 10:8329932-8329954 TCACTTACAAAGATGGTGAATGG + Intergenic
1064428457 10:15251126-15251148 TTATTTCCATAGATGCAGGAAGG - Intronic
1065506277 10:26433157-26433179 TGATATCCAGAGATGTTGCAAGG - Intergenic
1065601801 10:27376299-27376321 TCATTTCAAAACATTCTTCATGG - Intergenic
1065753645 10:28911382-28911404 CCATATTCAAAGATGCAGCAAGG - Intergenic
1066287238 10:33980200-33980222 ACATTTCCAAAAAGGCTGCTTGG - Intergenic
1067904586 10:50277501-50277523 TCATTTCCAAAAAATGTGCAAGG - Intergenic
1068937874 10:62653798-62653820 TCATGGCCAAAGATATTGCATGG + Intronic
1069069600 10:63979561-63979583 TGATTTCCAAATATGCCTCAGGG - Intergenic
1069790347 10:71015591-71015613 TCCTTTCCAGAGAGGCTTCAAGG - Intergenic
1071300399 10:84252170-84252192 TCATATCAAAAGATGCTGCTGGG + Intronic
1072374099 10:94796398-94796420 TCACTTCCAACTATACTGCAAGG - Intronic
1072527957 10:96290673-96290695 TCATCTTCAAAGAAGCTGAAAGG + Intergenic
1073225812 10:101917872-101917894 TTATTTCCTGGGATGCTGCAGGG - Intronic
1074982007 10:118627247-118627269 CCATTTCCAAACATGCAGCAGGG + Intergenic
1075277940 10:121112115-121112137 TCAATTCAAAAAATGCTACAGGG - Intergenic
1076266369 10:129112477-129112499 TTGTTTCCAAAAATGCTCCAGGG - Intergenic
1078153404 11:8777949-8777971 TCTTTTCCAGAGAGGCTGAATGG + Intronic
1079470112 11:20769955-20769977 TCATTTCAAAGGATGCTGGTAGG - Intronic
1079941975 11:26692323-26692345 ACACTTCCAAAGATCCAGCAGGG - Intronic
1080099488 11:28443209-28443231 TGATGTCAAAAGATGCTGCTAGG - Intergenic
1080189480 11:29526802-29526824 TAATTACTAATGATGCTGCAAGG + Intergenic
1080355391 11:31438460-31438482 TCATTTAAAAAGATGCAGCCTGG - Intronic
1080763198 11:35272479-35272501 TCCTTTCTGAAAATGCTGCAAGG + Intronic
1083160053 11:60849126-60849148 TCAGCTCCAAGGCTGCTGCATGG - Intronic
1086055749 11:82644093-82644115 TCATTTCCCAGGATGGGGCAGGG - Intergenic
1088102879 11:106174486-106174508 TCGTTTCGAAAGAATCTGCATGG - Intergenic
1089736522 11:120553573-120553595 TCATTTTCCAAGAGGCTGTAGGG + Intronic
1090261515 11:125324300-125324322 TACTTTCCAAAGTTGCTGCAAGG + Intronic
1091102351 11:132886768-132886790 TCATTTCCAAAGATGCTGCAGGG - Intronic
1094732135 12:33189684-33189706 ATATTTCCAAATAAGCTGCAGGG + Intergenic
1097508699 12:60508116-60508138 TCAATTCCAGAGATGCTGTCTGG - Intergenic
1098427467 12:70381407-70381429 TCATGTACAAAGTTTCTGCATGG - Intronic
1099079505 12:78159208-78159230 TCTTTTCAAAAGCTGCTACAAGG - Exonic
1100520092 12:95366573-95366595 TCATTTCCAAAGAAACTTAAGGG - Intergenic
1100772908 12:97943007-97943029 TCCTGGCTAAAGATGCTGCATGG - Intergenic
1100817397 12:98399249-98399271 TAGCTTCCAAACATGCTGCATGG + Intergenic
1103124891 12:118413066-118413088 TCATTTAAAATGATTCTGCAAGG + Intronic
1103502007 12:121410235-121410257 AAATTTTCAAATATGCTGCATGG + Intronic
1103585218 12:121948156-121948178 TCACTTCCATAGTTTCTGCAGGG + Intronic
1106045138 13:26132172-26132194 ACAATTCCATAGATGCTTCAGGG + Intronic
1106439677 13:29754963-29754985 TCATTTCTGATGATGATGCAGGG - Intergenic
1107706427 13:43111412-43111434 TTATTTCTAATGATGCTGCTGGG - Exonic
1110185484 13:72669284-72669306 TTTTTTTCAAAAATGCTGCAAGG - Intergenic
1111785831 13:92785510-92785532 TCAATTGCATTGATGCTGCATGG - Intronic
1114582725 14:23777398-23777420 TCATTTCCGAAGATGCCAAAAGG + Intergenic
1114755032 14:25249544-25249566 TAATTTTCAAAAATGCAGCATGG + Intergenic
1118848209 14:69564362-69564384 TTATTTCCAGAGAACCTGCAGGG - Intergenic
1119821262 14:77617938-77617960 TCCTTTCTAAAGCTCCTGCAGGG - Intergenic
1120963168 14:90143442-90143464 TTCTTTACAAAGATGCTGAAGGG - Intronic
1121098832 14:91235828-91235850 TCACATACCAAGATGCTGCAGGG + Intronic
1121676422 14:95756966-95756988 TCATTTTCAACGAGGCTGCAGGG - Intergenic
1124071138 15:26394010-26394032 ACATTTCCAAAGATGCTTATAGG - Intergenic
1124409107 15:29420913-29420935 TCACCTAAAAAGATGCTGCAGGG - Intronic
1124822784 15:33063994-33064016 TCATTTACACAGTTTCTGCAGGG - Intronic
1125996966 15:44171526-44171548 TAATTTCTAAAGATACTACATGG - Intronic
1126186448 15:45835173-45835195 AAATTTCCCAAGATTCTGCAGGG - Intergenic
1126851791 15:52801633-52801655 TCTTTTCCCCAGATGCTGGAAGG + Intergenic
1127114652 15:55713397-55713419 TTATTGCAAAAGATGCTTCAAGG + Intronic
1127929703 15:63584981-63585003 TCTTTTCAAAAGATGGTGCTGGG - Intronic
1128531812 15:68457463-68457485 TCATTTCAATAGATGGTGCTAGG + Intergenic
1130219096 15:82002715-82002737 TAACTTCAAAATATGCTGCAAGG + Intergenic
1131932759 15:97463332-97463354 TTATTACCAATAATGCTGCAAGG + Intergenic
1133593517 16:7268488-7268510 TCCTTTCCAAAGATGCTCTGCGG + Intronic
1135007993 16:18844958-18844980 TCAATTCCACATATGCTGCGTGG - Intronic
1136610951 16:31364678-31364700 TGATTTCCAAAGCAGCTGCGTGG - Intronic
1137473307 16:48782446-48782468 TGTCTTCCAAAGAGGCTGCATGG + Intergenic
1137817525 16:51412991-51413013 GCATTTCCCAACTTGCTGCATGG + Intergenic
1138375332 16:56559638-56559660 TCTATTACAAAAATGCTGCAAGG - Intergenic
1139225170 16:65227660-65227682 CCCTTGCCAAGGATGCTGCAAGG - Intergenic
1142239088 16:88936972-88936994 TCTTTTCCACTGATGCTACAAGG + Intronic
1143296650 17:5876322-5876344 CCATGGCCAAAGATGCTCCAGGG - Intronic
1145998499 17:29117860-29117882 TCACTGCCAAAGATGCTTCCCGG + Intronic
1146456799 17:33015058-33015080 TCCGTTCCACAGAGGCTGCAGGG + Intronic
1152306630 17:79524740-79524762 CCATTTACAAACCTGCTGCACGG - Intergenic
1153319339 18:3757104-3757126 TCAAAGCCAAAGATACTGCAAGG + Intronic
1154129674 18:11725988-11726010 TCTTTTCAAAAGATGGTGCTGGG - Intronic
1154138162 18:11799142-11799164 TAATTTCCAAAGATGTTAAAAGG - Intronic
1156678023 18:39554409-39554431 TCACTTCCATTAATGCTGCATGG + Intergenic
1156695623 18:39762828-39762850 TAATTTCCAAAAATCCTGGATGG + Intergenic
1157103116 18:44747969-44747991 GTATTTGTAAAGATGCTGCATGG + Intronic
1158293749 18:55971234-55971256 TCATCTACAAAGAGGCAGCAAGG - Intergenic
1159295254 18:66478134-66478156 TTATTTGCCAAGATGCTGAAAGG - Intergenic
1160049356 18:75417673-75417695 TCATTTCCCAAGGTGCTTCCAGG + Intronic
1161223854 19:3133230-3133252 TCCTGTCCAAAAATGCCGCAGGG + Intergenic
1162831997 19:13291045-13291067 TCATTTCCAAAGTGTCTCCAAGG + Intronic
1165488162 19:36107963-36107985 TCATTTGCAAAGGAGCAGCAGGG + Intergenic
1168200062 19:54808432-54808454 TCATTTCAATAAATGGTGCAGGG - Intronic
926334803 2:11855093-11855115 GCATTTGCATAGATGATGCAGGG + Intergenic
926334810 2:11855151-11855173 GCATTTGCACAGATGATGCAGGG + Intergenic
926538648 2:14146572-14146594 TCATTTCCACAGATCCAGAATGG - Intergenic
929581993 2:43087124-43087146 TCATTGCCAAAGCTGCTCTAGGG + Intergenic
929753835 2:44746556-44746578 TCATTGTCAAAAATGCTGAATGG - Intronic
929781180 2:44958170-44958192 TGATCTCCCAGGATGCTGCAAGG - Intergenic
930901458 2:56511822-56511844 ACATTTCCAAAGTTCCTACAAGG - Intergenic
931866235 2:66414545-66414567 TGATTTCCAGAAATGTTGCAGGG - Intergenic
932373213 2:71210388-71210410 TTATTTCCAGAGCAGCTGCATGG + Intronic
933582858 2:84147124-84147146 ATATTTCCAAAGGTGCTGAAGGG - Intergenic
935055694 2:99564691-99564713 CCATGTCCAAACATTCTGCATGG - Intronic
937796221 2:126024212-126024234 ACTTTTACAAAGATGTTGCATGG - Intergenic
938574350 2:132590153-132590175 TCAAATGCAAAGATGCTGCAAGG + Intronic
940234268 2:151492713-151492735 TCATTTTCAAAGAAGGGGCACGG + Intronic
941530410 2:166662977-166662999 TCTCTTCAAAAGATGCTGCTGGG - Intergenic
945328204 2:208507851-208507873 TGATTTCAAAATATGCTACAAGG - Intronic
946524346 2:220502295-220502317 TCATTTCCAAAGAAGTTCTATGG + Intergenic
948689549 2:239693397-239693419 TGCTTTCCAAAGTGGCTGCAGGG + Intergenic
948781747 2:240325741-240325763 TCATTTCCAAAAACACTGCACGG + Intergenic
1169007917 20:2224268-2224290 TCAGTTCCAAAGATACACCATGG - Intergenic
1171136301 20:22697714-22697736 TCTTTTCCAATGCTGCTGAAGGG - Intergenic
1173691466 20:44964432-44964454 TCGTTTCCATAGGTTCTGCAGGG - Intergenic
1174069121 20:47887694-47887716 TGATGTCCAAGGATCCTGCAGGG - Intergenic
1174259452 20:49283199-49283221 GCATTTCGAAAGATCCTGTAGGG + Intergenic
1175161943 20:57014791-57014813 ACTTTTCCAAAGATGCTTTAGGG + Intergenic
1177077091 21:16589254-16589276 CCATTTCCAAGTAAGCTGCAAGG - Intergenic
1177892415 21:26822499-26822521 TCATTTCAAAGGATACTTCAGGG - Intergenic
1179145162 21:38761612-38761634 TCATTCCCAGAGCGGCTGCAGGG + Intergenic
1179160530 21:38893273-38893295 TCTTTGACAAAAATGCTGCATGG - Intergenic
1181365419 22:22372865-22372887 TCATTGCCCAAAATGCTGCCTGG + Intergenic
1182603655 22:31487139-31487161 TCATTTCCTAAAATGCTGACAGG - Intronic
1182954654 22:34411131-34411153 TCTTTTTGAAAGATACTGCAAGG + Intergenic
949208819 3:1473731-1473753 TTATTTGTAAAGATGGTGCAAGG - Intergenic
950968205 3:17161179-17161201 TGATTTCCAAAGATGATGATGGG - Exonic
951806478 3:26649800-26649822 TCTTCTCCTAAGATGTTGCATGG + Intronic
952336774 3:32410416-32410438 TCCTTTCCAAAGAGTCAGCATGG + Intronic
953960545 3:47262769-47262791 TTATTTCCAAAGATGCTTCAGGG - Intronic
955775198 3:62425357-62425379 ACATTTCCAAATGTGCTGTAGGG + Intronic
956768874 3:72507543-72507565 TAATTTCCAAAGATGCCCTAGGG + Intergenic
956920495 3:73923577-73923599 TGTGATCCAAAGATGCTGCATGG + Intergenic
960412848 3:117349061-117349083 TCATTTGCAAAGGAGCTTCAAGG - Intergenic
960727879 3:120689331-120689353 TCATTTTCAAAGATGCAAAATGG - Exonic
963733640 3:148994633-148994655 TCCTTTCCCAGGATGCAGCAGGG + Intronic
964296813 3:155241990-155242012 TCTTTTCAAATTATGCTGCATGG + Intergenic
965441707 3:168722899-168722921 TTATTTCCAAAGATGATTTAAGG - Intergenic
965606621 3:170503930-170503952 TCATTTCCCAAGGTCCTGCTGGG + Intronic
965756903 3:172036766-172036788 TCATTTCCAAAGTAGGTTCAGGG + Intergenic
965890199 3:173503770-173503792 CCATTTCCAAAGGTGCTACAGGG + Intronic
967451811 3:189632891-189632913 TTATTTCCAAAGATGTTTAATGG - Intronic
970297855 4:14650408-14650430 TCCTTTCCAATATTGCTGCAAGG - Intergenic
970890764 4:21041970-21041992 TCTTGTACAAGGATGCTGCAAGG + Intronic
971238058 4:24861683-24861705 TCATTGCCAAATATGATCCATGG - Intronic
971631950 4:29004071-29004093 TCATTTCTAAAGAGGCTAGAAGG + Intergenic
972735453 4:41836570-41836592 CTATTTCCAACAATGCTGCAAGG - Intergenic
977076379 4:92456174-92456196 TCATTTCCAAAAATGCTAGAGGG - Intronic
978838311 4:113180182-113180204 TGACTTCCAAATATGCTTCATGG - Intronic
979613105 4:122710401-122710423 TCTTTTCCCAAGATAATGCAGGG + Intergenic
979997502 4:127449417-127449439 TCATTTCAAAACAGGCTACATGG + Intergenic
980192621 4:129544341-129544363 TCATTACAAAAGAGACTGCAAGG + Intergenic
980303291 4:131022573-131022595 TTGTTTCCAAATATGTTGCATGG + Intergenic
980495797 4:133586729-133586751 CCATCTCAAAAGAGGCTGCAAGG + Intergenic
981138358 4:141238375-141238397 TCATATCCAAAGATGATGAGAGG + Intergenic
981821717 4:148894736-148894758 ATATTTCATAAGATGCTGCAGGG + Intergenic
982240757 4:153297107-153297129 TCATTTCCCAAGACGTTCCAGGG - Intronic
982339593 4:154282732-154282754 TTATTTTTAAAAATGCTGCAAGG - Intronic
984227635 4:177054216-177054238 TTATTTTCAAAGGTGCTCCAGGG - Intergenic
984467831 4:180123923-180123945 TGACTTCAAAAGAAGCTGCAAGG - Intergenic
985043175 4:185913024-185913046 TCATTTGCTAAAGTGCTGCAGGG + Intronic
985313871 4:188633111-188633133 TCTTTTCAAAAAATGATGCAAGG + Intergenic
985709472 5:1420138-1420160 TGATTTCCAACGATGCCCCAAGG + Intronic
987105982 5:14639843-14639865 TCAGCTCCAAAGATGCAGTAAGG - Intergenic
990053697 5:51542502-51542524 ACATTACCAAAGATGTTACAAGG + Intergenic
990928775 5:61061952-61061974 TCACTGCTGAAGATGCTGCATGG + Intronic
995908142 5:117151311-117151333 CCATTTCCACAGATCCTGAAAGG - Intergenic
995995045 5:118287721-118287743 TAATTTCAAAATATACTGCAAGG - Intergenic
998730787 5:145074451-145074473 TTTTTTCCAAAGTGGCTGCATGG + Intergenic
999050091 5:148513373-148513395 TCCTTTCAATACATGCTGCAGGG - Intronic
999398199 5:151244238-151244260 TATTTTCCAGTGATGCTGCAGGG + Intronic
999750399 5:154624214-154624236 TCGTTGCCAAAGAGGCTACAGGG - Intergenic
1000281021 5:159782179-159782201 TCATTTCCACACATGCTTCTAGG + Intergenic
1000825476 5:166038687-166038709 GCAGTTCCAGAGATGGTGCAAGG + Intergenic
1001588239 5:172847890-172847912 CCATTTCCAAAGATGTTATAAGG - Intronic
1001709123 5:173763768-173763790 TCATTTTCAGAGATACTGCAAGG - Intergenic
1001766493 5:174251784-174251806 TCTTTTCCAAGGAGGCAGCACGG + Intergenic
1001830334 5:174781550-174781572 TCTTTTCAAAAGATGGTGCTGGG - Intergenic
1002378577 5:178807622-178807644 TCTTTTCCATAGATGATGCTTGG + Intergenic
1002859195 6:1065053-1065075 GAAATTCCAAAGATACTGCAAGG - Intergenic
1002918403 6:1547572-1547594 TTATTTCCAAAGACACTGCAAGG - Intergenic
1003655153 6:8000184-8000206 TCATCTCCCAAGAGGCTGTAAGG + Intronic
1004376368 6:15094060-15094082 TCATATCCAAAGAGCATGCATGG + Intergenic
1006416819 6:33909332-33909354 TCATTTTCAAATATTCTCCAAGG + Intergenic
1006675902 6:35762943-35762965 TCATTACAAATGATGCTGCAAGG + Intergenic
1007069058 6:39021696-39021718 TCATCTTCAAAGATGCTGCTGGG + Intronic
1007208941 6:40176033-40176055 CCATTTCGAAATATGCTGGATGG - Intergenic
1009523399 6:64713238-64713260 TGATTTCCAAAACTGCAGCAGGG + Intronic
1009931012 6:70177702-70177724 TGATTTCCAAATATGTTGCTGGG - Intronic
1013040251 6:106425953-106425975 TCATGACCACATATGCTGCATGG + Intergenic
1013795352 6:113881791-113881813 TCATATCCAAAAAAGATGCAGGG - Intergenic
1014229488 6:118887387-118887409 TCTTTTCAACAGATGCTGCTGGG + Intronic
1014512732 6:122344314-122344336 TCAATCCCAGAGATGATGCAGGG + Intergenic
1018442306 6:163824472-163824494 ACATGGACAAAGATGCTGCATGG + Intergenic
1018966253 6:168491486-168491508 TTATTTTAAAAGATGCTCCATGG - Intronic
1019044464 6:169132474-169132496 GCATGTCCAGAGATGCTGCCTGG - Intergenic
1019054161 6:169210027-169210049 TCATTTCAATAGATGTTGAAAGG + Intergenic
1020689090 7:11332243-11332265 GCAGTTCGAAAGATGCTGTACGG + Intergenic
1021209492 7:17829323-17829345 TCATTTTCTAAGATGCTGTTAGG - Intronic
1021220205 7:17966808-17966830 TAATTTCCAAAGATTATACATGG - Intergenic
1025617449 7:63134120-63134142 TCATTTCAATTGATGCTGAAAGG + Intergenic
1025823279 7:64991434-64991456 TCATTACCAATGAAACTGCAGGG - Exonic
1026280021 7:68913988-68914010 TTATTTACAAAAATGTTGCAAGG - Intergenic
1026384557 7:69833277-69833299 TCATTTTCATACCTGCTGCATGG - Intronic
1028409507 7:90513301-90513323 TCATTCTCAAAGAGGCTGTAAGG - Intronic
1028577133 7:92364473-92364495 TCACATCTAAAGGTGCTGCAGGG - Intronic
1028798507 7:94932720-94932742 TCATTTACAAAGATGGTGCTGGG + Intronic
1028843944 7:95459482-95459504 TTATTCCCAAAGATTATGCAGGG + Intergenic
1030943838 7:115691270-115691292 TCCTGTCCAAAGAATCTGCAAGG + Intergenic
1031542967 7:123017576-123017598 TCTTTTCAACAGATGCTGCTGGG - Intergenic
1032099238 7:128959489-128959511 TCATTTCCAAAGTCTCTGCTGGG - Intronic
1032502428 7:132409989-132410011 TCAATTCCAAAGAGGGAGCAGGG - Intronic
1035748501 8:1978740-1978762 TATTTTCCAAACATGCCGCATGG - Intronic
1036069905 8:5429846-5429868 TCATATCCATTGATTCTGCAGGG - Intergenic
1036731353 8:11268328-11268350 TCATTTCTAAAGAGGCTGTCTGG - Intergenic
1037720725 8:21441664-21441686 ACATTTCCTAGGATGCTACATGG - Intergenic
1038347164 8:26743096-26743118 TCTTTTCAAAAAATCCTGCAGGG - Intergenic
1038789142 8:30651980-30652002 TCATTTCAAAAAATGATGCTGGG + Intronic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1042443582 8:68857270-68857292 TGATCTCCAAAGATACTGAAAGG + Intergenic
1043563167 8:81518939-81518961 TGACTTCAAAATATGCTGCAAGG - Intergenic
1044998804 8:97862255-97862277 TCATTCCTATAGATGATGCAAGG + Intergenic
1045846335 8:106641363-106641385 TCATTTACAGAGAAGATGCAGGG - Intronic
1045902070 8:107293947-107293969 AGATTTCCAAAGAGGCTGGAAGG - Exonic
1046091706 8:109511042-109511064 TCATTTCCAAGGATGCATCAGGG + Intronic
1046343445 8:112889526-112889548 ACATTTCCATAGGTGCTGCCTGG - Intronic
1046357507 8:113107509-113107531 TCATTTCCATGGGTTCTGCAGGG - Intronic
1046451966 8:114405144-114405166 GCATTGCCAAATATGCTGCTTGG - Intergenic
1046943076 8:119950108-119950130 TCCTTTCGACAGATGGTGCAGGG - Intronic
1047822099 8:128532132-128532154 TCATTACTAAAGATGCTGTGAGG + Intergenic
1049817820 8:144616119-144616141 ACATTTGCAAAGCTGCTGCTTGG + Intergenic
1049956137 9:694985-695007 TGATTTCCAAAGTTGCTTCCAGG - Intronic
1053369822 9:37551409-37551431 AGATTTCAAAGGATGCTGCAGGG - Intronic
1057112221 9:92483901-92483923 TCATTCCCTAAGGTGCTGCAGGG - Intronic
1057541557 9:95977372-95977394 TCATTGCCAGAGCTGTTGCAGGG + Intronic
1058128341 9:101222132-101222154 TCAATTCCCAAGTTGCTGCAGGG - Intronic
1058271334 9:102975528-102975550 ACATTTCAAAGAATGCTGCAGGG - Intergenic
1062560702 9:137140372-137140394 TGAATTCCAATGAGGCTGCAAGG + Intronic
1190934800 X:54988747-54988769 TCTTTTCAAAAAATGCTGCTAGG + Intronic
1192981874 X:76352703-76352725 TCATTTCCAAATGTTCTGAATGG - Intergenic
1194978902 X:100420369-100420391 TCAAGTCCCAAAATGCTGCATGG + Intergenic
1197436562 X:126435683-126435705 TCTTTTCAAAATATACTGCAAGG + Intergenic
1197509056 X:127348122-127348144 TCTTTTCCAAAGATGCAATATGG - Intergenic
1199088485 X:143662222-143662244 TCATTTCAAAACATGGTGCTGGG + Intergenic
1201800807 Y:17953169-17953191 ACATTTCCCAAGATGCTGGGTGG + Intergenic
1202360585 Y:24105687-24105709 GCATTTCCCAAGATGCTGGGTGG + Intergenic
1202510193 Y:25564431-25564453 GCATTTCCCAAGATGCTGGGTGG - Intergenic