ID: 1091103473

View in Genome Browser
Species Human (GRCh38)
Location 11:132897270-132897292
Sequence GAGAGCTCTTGGCCAGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 3, 2: 18, 3: 213, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091103471_1091103473 6 Left 1091103471 11:132897241-132897263 CCATCATCTGTAGATAACTACTC 0: 1
1: 11
2: 215
3: 227
4: 243
Right 1091103473 11:132897270-132897292 GAGAGCTCTTGGCCAGCTACTGG 0: 1
1: 3
2: 18
3: 213
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091103473 Original CRISPR GAGAGCTCTTGGCCAGCTAC TGG Intronic
900184313 1:1325786-1325808 GAGAGCTCCTGGCCAGGAGCAGG - Intronic
900434961 1:2625612-2625634 GACAGCTCTTGGCCCGTTACTGG + Intronic
900545783 1:3228494-3228516 GGGAGCTCTGGGCCAGCCCCAGG + Intronic
901444630 1:9300560-9300582 GACAGCTCTTGGCCTAATACTGG + Intronic
901640756 1:10691953-10691975 GAGTGCTCTACTCCAGCTACAGG + Intronic
901904048 1:12392648-12392670 GACAGCTCTTGGCCTGTTACTGG - Intronic
903019078 1:20381064-20381086 GAGAGCTCTTGTTCATCTTCAGG - Intergenic
903123408 1:21231629-21231651 TAGAGTTCTTGGCCAGGTACGGG - Intronic
903315079 1:22496981-22497003 GAGAGCCCTTGGCAAACCACCGG + Intronic
903538554 1:24083377-24083399 GAGAGCTCCTGGCAAACCACTGG - Intronic
904179491 1:28655935-28655957 GACAGCTCTTGGCCTATTACTGG - Intergenic
904335935 1:29798022-29798044 GACAGCTCTTGGCCTATTACTGG + Intergenic
904373409 1:30065237-30065259 GAGAGCTCTTGGCTTTCTCCGGG - Intergenic
906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG + Intergenic
906766094 1:48435757-48435779 GAGTGCTCTAGGCCCGCTCCCGG - Intronic
907780344 1:57560870-57560892 GTCAGCTCTTGGCCTGTTACTGG + Intronic
909576923 1:77185894-77185916 GACAGCTCTTGGCCTGTTACTGG + Intronic
909810956 1:79931373-79931395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910370637 1:86512164-86512186 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG + Intergenic
910630224 1:89346288-89346310 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
910638988 1:89439938-89439960 GACAACTCTTGGCCTGTTACTGG - Intergenic
910790324 1:91043756-91043778 GACAGCTGTTGGCCTGTTACTGG + Intergenic
910831095 1:91463388-91463410 GATAGCTCTTGGCCTGTTATTGG - Intergenic
910948217 1:92616724-92616746 GACAGCTGTTGGCCTGTTACTGG + Intronic
911109095 1:94164169-94164191 GACAACTCTTGGCCTGTTACTGG - Intronic
911257322 1:95647328-95647350 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
911738395 1:101361883-101361905 CACAGCTCTTGGCCTGTTACTGG - Intergenic
912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG + Intergenic
912129909 1:106588014-106588036 GACAACTCTTGGCCTGTTACTGG - Intergenic
912212255 1:107568930-107568952 GACAGCTCTTGGATTGCTACTGG + Intergenic
912552610 1:110494019-110494041 GAGTGTTCTAGGCCAGCTAGGGG - Intergenic
912733320 1:112128793-112128815 GACAGCTCTTGGCCTGTTACTGG - Intergenic
913039444 1:115008359-115008381 GACAGCTCTTGTCCTGTTACTGG - Intergenic
916106327 1:161435291-161435313 GACAGCTCTTGGCCTGTTACTGG - Intergenic
916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG + Intergenic
916365965 1:164028051-164028073 AACAGCTCTTGGTCTGCTACTGG - Intergenic
917276498 1:173337230-173337252 AACAACTCTTGGCCTGCTACTGG + Intergenic
917462710 1:175246219-175246241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
918755711 1:188337773-188337795 GATGGCTCTTGGCCCGTTACTGG - Intergenic
918918229 1:190671843-190671865 GACAGCTCTTGGCCTGTTAATGG - Intergenic
918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG + Intergenic
919268383 1:195304370-195304392 GAGAGCCCCTGGCAAACTACTGG - Intergenic
919317976 1:195999398-195999420 GATAGCTTTTGGCCTGTTACTGG + Intergenic
920391877 1:205610134-205610156 TAGAACTCTGGGCCAGCCACAGG + Exonic
920998054 1:211014087-211014109 AAAAGCTCTTGGCCACCTTCAGG + Intronic
921619822 1:217313173-217313195 GACAGCTCTTGGTCTGCCACTGG + Intergenic
921712019 1:218382266-218382288 AAGAGCTCTTAATCAGCTACTGG + Intronic
922235043 1:223716374-223716396 GAGAGCTCTTATCCAGCTGATGG - Intronic
923253567 1:232199401-232199423 GACAGCTCTTGGCCTGTTACTGG - Intergenic
924135898 1:240966641-240966663 GAGAGCGGTTGCCCAACTACAGG - Intronic
924182506 1:241453205-241453227 GACAGTTCTTGGCCTGCTACTGG - Intergenic
924477396 1:244394165-244394187 GACAACTCTTGGCCTACTACTGG - Intergenic
924840774 1:247707796-247707818 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1063364023 10:5478949-5478971 GATGGCTCTTGCCCAGCTCCAGG - Intergenic
1064545686 10:16448099-16448121 GACAGCTCTTGGCCAGTTACTGG - Intronic
1065005328 10:21374200-21374222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1066167025 10:32799194-32799216 GTCAGCTCTTGGCCTGTTACTGG - Intronic
1067518968 10:46980521-46980543 AACAGCTTTTGGCCTGCTACTGG + Intronic
1067643278 10:48071313-48071335 AACAGCTTTTGGCCTGCTACTGG - Intergenic
1068007671 10:51409534-51409556 GACAGCTCTTGGCCTGTCACTGG - Intronic
1068447212 10:57138629-57138651 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1068837214 10:61568342-61568364 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1069145765 10:64890476-64890498 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1069192303 10:65506334-65506356 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1069790829 10:71019547-71019569 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1071267084 10:83973966-83973988 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1071673925 10:87637393-87637415 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1071937690 10:90549312-90549334 GACAGCTCTTGGCCTGTTCCTGG + Intergenic
1071947084 10:90657695-90657717 GATAGCTCTTGGTCTGCTACTGG - Intergenic
1072816011 10:98510226-98510248 GGGTCCTCTTGGCCAGCTATAGG - Intronic
1073557351 10:104465936-104465958 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1073656679 10:105424448-105424470 TACAGCTCTTGGCCTGTTACTGG - Intergenic
1073918474 10:108432279-108432301 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073957680 10:108891617-108891639 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1075606791 10:123817435-123817457 GACAGCACTTGGCCTGTTACTGG + Intronic
1076152142 10:128171184-128171206 GAGAGGTCTTAGCGAGCTGCAGG + Intergenic
1076772627 10:132674803-132674825 GACAGCTCTTGGCCTGTTACTGG - Intronic
1076927414 10:133499190-133499212 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1080020138 11:27551630-27551652 GACAGCTCTGGGCCTGCTACTGG - Intergenic
1080076595 11:28157531-28157553 GACAGCTCTTGGCCTGTTACTGG + Intronic
1080171466 11:29308017-29308039 GGGGGCTCTTGGCTAGCTTCTGG - Intergenic
1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1082671701 11:56043052-56043074 GATAGCTCTTTGCCTGCTACTGG + Intergenic
1082999663 11:59279889-59279911 GAGAGTTCTTGGCCTGTTACTGG + Intergenic
1083093146 11:60221137-60221159 AAGAGCTCTTGCCCTGTTACTGG + Intronic
1084175414 11:67420110-67420132 GAGAGCTCTTGCCCACGTAGAGG + Intronic
1085079268 11:73620732-73620754 AACAGCTCTTGGCCTGCTACAGG + Intergenic
1085684622 11:78610427-78610449 AACAGCTCTTGGCCTGATACTGG + Intergenic
1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085747572 11:79128250-79128272 GACAGCTCTTGGCCTGTTACTGG + Intronic
1086834117 11:91600403-91600425 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1087021603 11:93608717-93608739 AATAGCTCTTGGCCTGCTACTGG - Intergenic
1088097206 11:106115168-106115190 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088191659 11:107234480-107234502 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1088407610 11:109498652-109498674 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1088836657 11:113583399-113583421 GACAGCTCTTGGCCTGTCACTGG + Intergenic
1089750856 11:120650105-120650127 AAGAGCTCATTGCCAGCCACGGG - Intronic
1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1090209491 11:124908040-124908062 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1090221614 11:125031575-125031597 GACAGCTCTTAGCCTGTTACTGG - Intronic
1090481235 11:127070514-127070536 GAGAGCACCTGGCAAGCCACTGG + Intergenic
1091103473 11:132897270-132897292 GAGAGCTCTTGGCCAGCTACTGG + Intronic
1091596473 12:1882206-1882228 GAGAGCTCGTGGTCAGCTCTGGG + Intronic
1091847803 12:3670739-3670761 TGGAGCTCTTGCCCAGCCACTGG - Intronic
1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG + Exonic
1092093285 12:5821661-5821683 GACAGCTCTTGGCCTGTTACAGG + Intronic
1093031869 12:14295939-14295961 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1093036338 12:14335694-14335716 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1093049669 12:14490952-14490974 GACAGCTCTTGGCCTGTTAAAGG - Intronic
1093645730 12:21583681-21583703 GAAAGCTCTTGGCCTGTTACTGG + Intronic
1094102532 12:26779273-26779295 GACAGCTCTTGGTCTGGTACTGG + Intronic
1095603855 12:44044345-44044367 GACAGCTCTTGGCCTGTTTCTGG + Intronic
1095856239 12:46863664-46863686 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1096288713 12:50322971-50322993 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1096457465 12:51799426-51799448 GACGGCTCTTGGCCTGTTACTGG - Intronic
1096734789 12:53644211-53644233 AGTAGCTCTTGGCCTGCTACTGG + Intronic
1096923920 12:55120883-55120905 GAGAGCGCTTGGCAAACCACTGG + Intergenic
1097058635 12:56266413-56266435 GAGAGCCCTTGGCAAACCACTGG - Intergenic
1097077001 12:56402452-56402474 GACAGCTCTTGACCTGTTACTGG + Intergenic
1097371162 12:58783030-58783052 GAGAGTCCCTGGCCAGCCACTGG - Intronic
1097437837 12:59572243-59572265 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097564647 12:61252418-61252440 GACAGCTCTTGACCTGTTACTGG - Intergenic
1097821340 12:64131853-64131875 GACAGCTCTTGGCCTGTTACTGG - Intronic
1097843356 12:64342750-64342772 AACAGCTCTTGGCCTGTTACTGG - Intronic
1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1098716091 12:73829826-73829848 GACAGTTCTTGGCCCGTTACTGG + Intergenic
1098731052 12:74037359-74037381 GACAGCTGTTGGCCTGTTACTGG + Intergenic
1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099379381 12:81936529-81936551 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1099508562 12:83507198-83507220 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1100083304 12:90878223-90878245 GACAGCTCTTTGCCTGTTACTGG + Intergenic
1100241151 12:92711597-92711619 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1100560563 12:95745296-95745318 GTGAGCTCTGGGACAGCTTCAGG - Intronic
1101264132 12:103066133-103066155 GACAGCTCTTGGCCAATTACTGG + Intergenic
1101534667 12:105606093-105606115 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101543072 12:105682647-105682669 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1101697456 12:107139819-107139841 AAAAGCTCTTGGCCTGCTACTGG - Intergenic
1103396528 12:120611458-120611480 GACAGCTCTTGACCTGTTACTGG + Intergenic
1104401501 12:128480447-128480469 CAGAGGTCTCCGCCAGCTACTGG + Intronic
1105740110 13:23315187-23315209 GACAACTCTTGGCCTGTTACTGG + Intronic
1107505170 13:41026628-41026650 GACAGCTCTTGACCTGCTACTGG + Intronic
1107983575 13:45755961-45755983 GACAGCTCTTGGCCTATTACTGG - Intergenic
1108302433 13:49091974-49091996 GACAGCTCTTGGCCCGTTACTGG - Intronic
1109293225 13:60500129-60500151 GACGGCTCTTGGCCTGTTACTGG + Intronic
1109519023 13:63484812-63484834 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1109583049 13:64366178-64366200 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1109712680 13:66180811-66180833 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1109951023 13:69502194-69502216 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110375428 13:74788236-74788258 GGGAACTCCTGGACAGCTACAGG + Intergenic
1110377173 13:74806480-74806502 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1110834134 13:80064618-80064640 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111057798 13:82973016-82973038 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111317503 13:86581812-86581834 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
1111432252 13:88159623-88159645 GACAGATCTTGGCCTGCTACTGG - Intergenic
1112249926 13:97770267-97770289 GACAGCTCTTGGGCTGTTACTGG - Intergenic
1113168635 13:107472693-107472715 GAGAGCCCCTGGCAAGCCACTGG - Intronic
1114205871 14:20570780-20570802 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1115070785 14:29319635-29319657 AACAGCTCTTAGCCTGCTACTGG + Intergenic
1115112104 14:29836492-29836514 GAGAGCTGTAAGCCAGATACTGG + Intronic
1115130694 14:30049271-30049293 GACAGCTCTTGGCCTGTCACTGG + Intronic
1115143400 14:30199398-30199420 GGCAACTCTTGGCCTGCTACTGG + Intergenic
1116058909 14:39896949-39896971 GACAGCTCTTGGCCTGTTGCTGG + Intergenic
1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG + Intergenic
1116158377 14:41236654-41236676 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1116250379 14:42474330-42474352 GAGAGCCCTTGGCAAACCACTGG + Intergenic
1116308043 14:43283436-43283458 GACAGCTCTTGGCCTGCTACTGG - Intergenic
1116381048 14:44268238-44268260 GAGAGCACATGGACAGATACAGG - Intergenic
1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG + Intergenic
1117222081 14:53616521-53616543 GAGAGCCCTTGGCAAACCACTGG + Intergenic
1117634134 14:57724384-57724406 GACAGCTGTTGGCCTGTTACTGG + Intronic
1118122433 14:62860159-62860181 GACAGCTCTTAGCCTGTTACTGG - Intronic
1118385501 14:65252534-65252556 GACAGCTCTTGGTCTGCTACTGG - Intergenic
1118501835 14:66369400-66369422 GATAGCTCTTGGCCTGCTACTGG + Intergenic
1118880773 14:69824007-69824029 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1118889354 14:69894959-69894981 CAGTGCACTTGGCCAGCTAGTGG + Intronic
1119107563 14:71938828-71938850 GACAGCTCTTGGCCTATTACTGG - Intronic
1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1120231422 14:81845240-81845262 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1122720585 14:103719806-103719828 AAAAGCTCTTAGCCAGCCACAGG - Intronic
1123908497 15:24943643-24943665 AACAGCTGTTGGCCTGCTACTGG - Intronic
1127217296 15:56836963-56836985 GCGAGCACTTTGCCTGCTACTGG + Intronic
1127326142 15:57896907-57896929 GAGAGCCCCTGGCCAACCACTGG + Intergenic
1127356917 15:58209200-58209222 GACAGCTCTTGGCCTGTTATTGG + Intronic
1127380078 15:58423383-58423405 AAGAGCTCCTGGCAAGCGACTGG - Intronic
1128247564 15:66143503-66143525 GAGAGAGCCTGGCCAGCTGCTGG - Intronic
1128931465 15:71708367-71708389 GATAGCCCTTGGCCAGGCACTGG - Intronic
1130121407 15:81050871-81050893 GAATGCTCTTGGCCAACTGCTGG - Intronic
1130669115 15:85894678-85894700 GAGAGCTCTTGGGGAACAACAGG + Intergenic
1130859364 15:87873073-87873095 GAGAGCTGTCAGCCAGCTTCTGG - Intronic
1131185648 15:90271745-90271767 GAGAGTTCTTTGACAGCAACGGG + Exonic
1131724011 15:95202806-95202828 GACAGCTCTTGGCCTGTTACCGG + Intergenic
1132305739 15:100810856-100810878 AACAGCTCTTGGCCTGCTACTGG - Intergenic
1133665776 16:7966380-7966402 GAGAGCTCCTGGCAAACCACTGG - Intergenic
1133743275 16:8667758-8667780 GAGAGCTCTTGGGGAGCTCTTGG - Intergenic
1135626004 16:23995507-23995529 GACAGCTCTTGGCCTGCTACCGG + Intronic
1136134937 16:28250063-28250085 GAGAGCCCCTGGCAAACTACTGG - Intergenic
1138586227 16:57971996-57972018 AAGAGCTCTAGGCCAGGTGCAGG - Intergenic
1141363586 16:83420810-83420832 GAGAGCTCCTGGCAAGTCACTGG + Intronic
1141559542 16:84858027-84858049 GACAGCTCTTGGCCTGTTACTGG - Intronic
1142557884 17:791904-791926 CAGTGCTCTCGGCCAGCTGCAGG - Exonic
1143343747 17:6234232-6234254 TGGAGCTCTTGGAAAGCTACTGG + Intergenic
1143364915 17:6400790-6400812 AAGAGCTCCTGGCAAGCCACTGG - Intronic
1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1146850934 17:36221051-36221073 GACAGCTCTTAGCCTGTTACTGG + Intronic
1147219351 17:38919437-38919459 GGGAGCTCTTTGCCCGCTGCAGG - Exonic
1148244427 17:46021214-46021236 GAGAGCTCTCGGCCAGCTACGGG - Intronic
1148562301 17:48613097-48613119 GAGAGCTCTGGCCCCGCTAGCGG - Exonic
1149784093 17:59421086-59421108 GTGAGCTCTTGGCAAGCAAGAGG + Intergenic
1151067297 17:71165907-71165929 AAGAGCTCTTAGCTAGTTACTGG + Intergenic
1151430682 17:74060513-74060535 GAAAGCTTTTGCCCAGCTACAGG - Intergenic
1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153217693 18:2835595-2835617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1154506173 18:15042897-15042919 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1155940708 18:31799605-31799627 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1156303861 18:35858701-35858723 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1157299065 18:46466686-46466708 CAGAGCTCTAGGGCAGCTATAGG + Intergenic
1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG + Intergenic
1157707443 18:49819269-49819291 GAGAGCTCCTGGCAAGCCATTGG + Intronic
1157870931 18:51229574-51229596 GATAGCTCTTGGTCTGCTACTGG - Intergenic
1157998504 18:52588117-52588139 GACAGCTCTTGGCCTGTTACTGG - Intronic
1158285390 18:55875356-55875378 GAGAGCTCTGTTCCATCTACAGG - Intergenic
1159152205 18:64535031-64535053 GACAGCTCTTGGCATGTTACTGG - Intergenic
1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1159559104 18:69975344-69975366 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1160092464 18:75840022-75840044 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1161362576 19:3859272-3859294 GAGAGCCCCTGGCCAACTGCTGG - Intronic
1161788115 19:6340786-6340808 GAGAGCTCTTCCCCCGCTAGGGG + Intergenic
1163529144 19:17839544-17839566 GAGAGCTCCTGGCAACCTGCTGG - Exonic
1163721359 19:18899661-18899683 GACAGCTCTGGGCCAGCCTCAGG + Exonic
1164117257 19:22234567-22234589 GACAACTCTTGGCCTGTTACTGG - Intergenic
1167624162 19:50576170-50576192 GAGCTCTCTTGTCCATCTACAGG + Intergenic
925152209 2:1622757-1622779 GAGAGCTGCGGGTCAGCTACAGG - Intergenic
925251171 2:2440281-2440303 GAGAGGTCCTGGCCAGCAATGGG - Intergenic
925279953 2:2676875-2676897 GACAGCACTTGGCCTGTTACTGG + Intergenic
925900239 2:8504060-8504082 GAGAGCCCCTGGCAAGCCACTGG - Intergenic
926395444 2:12437278-12437300 GAAAGCTGTTAGCCAGATACTGG + Intergenic
926563556 2:14444703-14444725 GAGAGCCCCTGGCAAACTACTGG - Intergenic
926810395 2:16750669-16750691 GACAGCTCTTGGCCTGTTACTGG - Intergenic
926826763 2:16913675-16913697 GACAGATCTTGGCCTGTTACTGG + Intergenic
927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG + Intergenic
927492417 2:23529402-23529424 TGGAGCTCTTAGCCAGCTGCAGG - Intronic
927660433 2:24988676-24988698 GACGGCTCTTGGCCTGTTACTGG + Intergenic
928172692 2:29013533-29013555 GAGAGCCCCTGGCAAGCCACTGG + Intronic
929269825 2:39960774-39960796 AACAGCTCTTGGCCTGTTACTGG - Intergenic
930295402 2:49547502-49547524 AAGAGCTCTTGGCCGGTTACTGG - Intergenic
932870706 2:75395074-75395096 GACAGCTCCTGGCCTGTTACTGG - Intergenic
933265684 2:80178373-80178395 GACAGCTCTTGGCCTGTTACTGG - Intronic
933394462 2:81713348-81713370 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG + Intergenic
935425109 2:102911318-102911340 TACAGCTCTTGGCCTGTTACTGG - Intergenic
935564308 2:104590244-104590266 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935944629 2:108274356-108274378 GACAGCTCTTGGCCTGCTACTGG - Intergenic
936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG + Intergenic
937785205 2:125887719-125887741 GACAGCTCTTGGCCTGTTACTGG - Intergenic
937852569 2:126648729-126648751 GACAGCACTTGGCCTGTTACTGG - Intergenic
938375539 2:130803381-130803403 GACAGCTCTTGGCCTGCTACCGG + Intergenic
939069063 2:137517865-137517887 GGCAGCTCTTGGCCTGTTACTGG + Intronic
939213873 2:139212249-139212271 GACAGCTCTTGGCCTGTTATTGG + Intergenic
939788685 2:146546104-146546126 GACAACTCTTGGCCTGTTACTGG - Intergenic
940605915 2:155924279-155924301 GACAGCTCATGGCCTGTTACTGG - Intergenic
940711452 2:157167209-157167231 GGGAGCTCCTGGCAAGCCACTGG - Intergenic
941330667 2:164174556-164174578 GACAGCTCTTTGCCTGTTACTGG - Intergenic
943239218 2:185362563-185362585 GACAACTCTTGGCCTGTTACTGG - Intergenic
943317928 2:186412310-186412332 GACAGCTCTTGGTCTGTTACTGG - Intergenic
943388130 2:187227145-187227167 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
943517597 2:188907233-188907255 GACATCTCTTGGCCTGTTACTGG - Intergenic
944615123 2:201451824-201451846 GAGCGCTCTAGGCCCGCTCCCGG - Exonic
945717834 2:213380660-213380682 GACAGCTCTTGGCCTGTTACTGG - Intronic
946527867 2:220539958-220539980 GACAGCTCTTGGCCCGTTACTGG - Intergenic
946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG + Intergenic
948166076 2:235863665-235863687 GAGAGCACATGGCTAACTACGGG + Intronic
948225445 2:236306118-236306140 GAGAGCCCTTGGACAGCTGCAGG - Intergenic
1169200711 20:3707943-3707965 GATAGCTCTGGGGTAGCTACAGG - Intergenic
1173131981 20:40402499-40402521 AAGAGCTCTTACCCAGCTAAGGG + Intergenic
1174186264 20:48708403-48708425 GAGTCCTCTTGGCCAGCTCCTGG + Exonic
1175309514 20:58001901-58001923 GAGAGCCCAGGTCCAGCTACAGG + Intergenic
1176099797 20:63359747-63359769 GAGAGCTCCTGGACAGCTCCCGG - Intronic
1176791680 21:13326127-13326149 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1176895867 21:14377841-14377863 GAGAGCCCTTGGCAAACCACTGG - Intronic
1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177005918 21:15672155-15672177 GAGAACTCTGTGCCAGCTGCTGG + Intergenic
1177139415 21:17342260-17342282 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177192843 21:17870906-17870928 GACAGCTCTTTGACTGCTACTGG - Intergenic
1177505560 21:22014173-22014195 GACAGCTTTTGGCCTGCTACTGG - Intergenic
1177913176 21:27056219-27056241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177933697 21:27316923-27316945 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177961180 21:27668533-27668555 CAGAGCTTTTGGCCAGCAAAGGG - Intergenic
1178012661 21:28305184-28305206 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1178063299 21:28875348-28875370 AACAGCTCTTGGCCTGCTACTGG - Exonic
1178634467 21:34290206-34290228 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1178718618 21:34988978-34989000 GAGAGATCTGGGCCAGCCAAAGG - Intronic
1179282848 21:39949878-39949900 GAGAGCTCCTGGCAAACCACTGG - Intergenic
1179383528 21:40921059-40921081 GACAGCTCTTGGCCTGCAACTGG + Intergenic
1179415149 21:41192512-41192534 GAGAGCTCTTGGCCTGTTACTGG - Intronic
1179908492 21:44436140-44436162 GAGAGCAGTGGGCCAGCTGCTGG - Intronic
1180591146 22:16938358-16938380 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1181367436 22:22388935-22388957 GACAGCTCTTGGCCTATTACTGG - Intergenic
1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG + Intronic
1182429601 22:30291971-30291993 GAGAGCTCGTGTACAGCTAGGGG - Exonic
1182466665 22:30521125-30521147 GAGACCTCTTGTCCAGATTCAGG - Intergenic
1184603560 22:45558366-45558388 GACAGCTCTTGGCCTGTTACTGG - Intronic
949170039 3:986595-986617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
949245869 3:1924931-1924953 GACAGCTCTTGGTCTGTTACTGG + Intergenic
949445612 3:4131062-4131084 GACAGCTCTTGGCCTGTTACTGG + Intronic
949894103 3:8756666-8756688 GGCAGCTCTTGGGCAGCTAGAGG - Intronic
950181274 3:10915170-10915192 GCCAGCTCTTTCCCAGCTACTGG + Intronic
951384526 3:22027543-22027565 GACAGCTCTTGGCCTGTTACTGG + Intronic
951970762 3:28441857-28441879 GACAGCTCTTGGTCTGTTACTGG - Intronic
954054157 3:48007968-48007990 GTCAGCTCTTGGCCTGTTACTGG + Intronic
954511490 3:51129653-51129675 GGCAGCTCTTGGCCTGTTACTGG - Intronic
956360453 3:68441446-68441468 GATAGCTCTTGGCCTGTTACTGG + Intronic
956509662 3:69980380-69980402 GACAGCTCTTGGCCTATTACTGG + Intergenic
956703894 3:71982879-71982901 GACAGCTCTTGGCCTATTACTGG - Intergenic
957298498 3:78361635-78361657 AACAGCTCTTGGCCTGCTGCTGG - Intergenic
957754598 3:84469434-84469456 GACAGCTCTTGGCCTGTTACTGG + Intergenic
958487677 3:94732466-94732488 GACAGCTCTTGGCCTGTTACTGG - Intergenic
959226778 3:103597268-103597290 GACAGCTTTTGGCCTGTTACTGG - Intergenic
959997860 3:112698328-112698350 GAGAGCTCTTGGCCTGCTACTGG + Intergenic
960273505 3:115700093-115700115 GTGAGCTCCAGGCCAGCTCCTGG - Intronic
960349530 3:116575709-116575731 GACAGCTCTTGGTCTGTTACTGG + Intronic
963331816 3:143923365-143923387 GACAGATCTTGGCCTGTTACTGG - Intergenic
963453671 3:145516675-145516697 GACAGCTCTTGGCCTGTTACTGG + Intergenic
963929236 3:150984961-150984983 GACAGCTCCTGGCAAACTACTGG - Intergenic
964527453 3:157630549-157630571 GAGAGCTCCTGGGCAGTTACTGG - Intronic
964679244 3:159318906-159318928 GACAGCTCATGGCCTGTTACTGG - Intronic
965226766 3:166000756-166000778 GACAGCTCTTGGCCTGTTAGTGG - Intergenic
965251332 3:166348259-166348281 GACAGCTCTTGGTCTGTTACTGG - Intergenic
965667655 3:171112348-171112370 TAGAGTTCCTGACCAGCTACTGG + Intronic
965708643 3:171534771-171534793 AGCAGCTCTTGGCCTGCTACTGG - Intergenic
965814311 3:172620963-172620985 GTGCACACTTGGCCAGCTACTGG + Intergenic
965893154 3:173540086-173540108 AACAGCTCTGGGCCTGCTACTGG - Intronic
966044329 3:175530913-175530935 GACAGCTCTTGGCCTGTTACTGG - Intronic
966445694 3:179998567-179998589 GACAGCTCTTGGTCTGTTACTGG + Intronic
967831777 3:193925998-193926020 GACAGCTCTTGGCCTGTTACTGG + Intergenic
967882972 3:194314623-194314645 GACAGCTCTGGGCCAGGCACGGG + Intergenic
967968774 3:194984338-194984360 CAGAGCTCATGGACAGCTGCAGG - Intergenic
968438789 4:611036-611058 GAGTGCTCTTGGCCACTTGCAGG + Intergenic
968800184 4:2738129-2738151 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG + Intergenic
969502097 4:7559404-7559426 GAGAGCTCTGGGCCTCCTCCAGG - Intronic
969574282 4:8027515-8027537 GAGAGGGCTTGGAAAGCTACAGG - Intronic
971396763 4:26235661-26235683 GAGAGCTCTGGAACAGCTAGAGG - Intronic
971884819 4:32430851-32430873 GAGAGCCCTTGGCAAACCACTGG + Intergenic
971897541 4:32617013-32617035 GACAGCTCTTGGCTTGCTACTGG + Intergenic
971979294 4:33732865-33732887 GACAGCTCTTGGCCTGCTATTGG - Intergenic
972095494 4:35342697-35342719 GAATGCTCTTGGCCTGTTACTGG + Intergenic
972805917 4:42529335-42529357 GACAGCTCTTGGCTTGTTACTGG + Intronic
973098053 4:46226768-46226790 GACAGCTCTTGGCCTCCTACTGG + Intergenic
973102925 4:46294760-46294782 GACAGCTCTTGGCCCATTACTGG + Intronic
973118443 4:46489051-46489073 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
973120980 4:46520890-46520912 TACAGCTCTTGGCCTGTTACTGG - Intergenic
973143682 4:46798614-46798636 AATAGCTCTTGGCCTGCTACTGG + Intronic
974262370 4:59542261-59542283 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974557606 4:63471907-63471929 GTTAGCTCTTGGTCTGCTACTGG + Intergenic
974644615 4:64674756-64674778 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974727213 4:65812531-65812553 AACAGCTCTTGGCCTGTTACTGG + Intergenic
974746914 4:66088897-66088919 GACAGCTCTTGGTCTGTTACTGG - Intergenic
975024469 4:69531640-69531662 GACAGCTCATGGCCTGTTACTGG + Intergenic
975386716 4:73767501-73767523 GACAGCTTTTGGCCTGTTACTGG - Intergenic
975934506 4:79562153-79562175 GAGAGCCCCTGGCAAACTACTGG - Intergenic
975982614 4:80177269-80177291 GACAGCTCTTGGCCTGTTACTGG - Intergenic
976359179 4:84157539-84157561 GGGAGCCCATGGCAAGCTACAGG - Intergenic
976425111 4:84894367-84894389 GTCAGCTCTTGGCCAGGTGCAGG + Intronic
977001687 4:91512416-91512438 GAGAGCCCTTGGCAAACCACTGG - Intronic
977204717 4:94155692-94155714 GACAGCTCTTGGCCTGTTACTGG + Intergenic
977490070 4:97700063-97700085 GACAGCTCTTGGCCTGTTACTGG - Intronic
977626275 4:99192646-99192668 GATAGCTCTTGGCCTGTTACTGG - Intergenic
977701730 4:100029879-100029901 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977833274 4:101618160-101618182 GACAGCTCTTGGCCTGTTACTGG - Intronic
977930411 4:102743811-102743833 GACAGCTCTTGGCCTGTTACTGG - Intronic
978772151 4:112467772-112467794 GACAGCTTTTGGCCTGTTACTGG - Intergenic
978899074 4:113926810-113926832 GACAGCTCTTGGCCTGTTACTGG - Intronic
979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG + Intergenic
979888567 4:126062165-126062187 GATAGCTCTTGGCCTGCTATTGG - Intergenic
979898401 4:126189049-126189071 GAAAGCTCTTGGCCTTTTACTGG - Intergenic
980405890 4:132353783-132353805 GACAGCTTTTGGCCTGTTACTGG - Intergenic
980497526 4:133605354-133605376 GACAGCTCTTGGCCTGTTATTGG - Intergenic
980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG + Intergenic
981648412 4:147026929-147026951 GAGAGCTCTTGCCCTACTTCTGG - Intergenic
981835004 4:149043953-149043975 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982623340 4:157732893-157732915 GACAGCTCTTGGCCTGTTACTGG - Intergenic
982835540 4:160116649-160116671 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
982847770 4:160274304-160274326 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982851048 4:160316648-160316670 AACAGCTTTTGGCCTGCTACAGG - Intergenic
982913506 4:161175630-161175652 GAGAGCCCCTGGCAAGTTACCGG - Intergenic
983027391 4:162755303-162755325 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983582676 4:169324820-169324842 GACAGCTCTTGGCTTGTTACTGG + Intergenic
984060283 4:174982016-174982038 GACAGCTCTTGGCCTGCTACTGG - Intergenic
986025575 5:3847422-3847444 GATAGCTCTTGGCCTGTTGCTGG + Intergenic
986037032 5:3950429-3950451 GACAGCTCTTGGCCTGTTACTGG - Intergenic
986054315 5:4120843-4120865 GAGAACTCATGGACACCTACAGG + Intergenic
986087110 5:4462726-4462748 GACAGCTCTTGGCCTGTTAGTGG + Intergenic
986742920 5:10719514-10719536 GACAGCTCTTGGCCTGTTACTGG + Intronic
986938331 5:12918742-12918764 GACAGCTCTTGGCCTATTACTGG - Intergenic
987153177 5:15061674-15061696 AACAGCTCTTGGCCTGTTACTGG + Intergenic
987468188 5:18296976-18296998 GACAGCTCTTGGCCTATTACTGG - Intergenic
987578340 5:19758303-19758325 GGCAGCTCTTGGCCTGTTACTGG - Intronic
987646373 5:20677321-20677343 GACAGAACTTGGCCTGCTACTGG - Intergenic
987915311 5:24205211-24205233 GAGAGCTCCTGGCAAGCCCCAGG - Intergenic
987967647 5:24896349-24896371 GATAGGTCTTGGCCTGCTATTGG + Intergenic
988079830 5:26401411-26401433 GACAACTCTTGGCCTGTTACTGG - Intergenic
988169201 5:27632829-27632851 GTCAGCTTTTGGCCAGTTACTGG - Intergenic
988188776 5:27901245-27901267 GACAGCTCTTGGCCTGTTACTGG + Intergenic
988228769 5:28448135-28448157 GACAGCTCATGGCCTGTTACTGG + Intergenic
988562131 5:32290856-32290878 GACAGCTCTTGGCCCGTTACTGG + Intronic
989045205 5:37267582-37267604 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989486383 5:41996350-41996372 GACAGCTCTTGGCCTGTTACTGG - Intergenic
990777024 5:59314354-59314376 GAGAGCTCTTGGCCTTATAATGG + Intronic
991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG + Intergenic
991946146 5:71900150-71900172 GACAGCTGTTGGCCTGTTACTGG + Intergenic
993231900 5:85247524-85247546 GACAGCTCTTGGCCTGTTACTGG - Intergenic
993319827 5:86458587-86458609 GATAGCTCTTGGCTTGTTACCGG + Intergenic
993412581 5:87591803-87591825 GGAAGCTCTTGGCCTGTTACTGG - Intergenic
993791792 5:92218920-92218942 GACAGTTCTTGGCCAATTACTGG + Intergenic
994291372 5:98031962-98031984 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994855434 5:105113575-105113597 GACAGCTCTTGGCATGTTACTGG - Intergenic
994984419 5:106915720-106915742 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995427732 5:112043717-112043739 CAAAGCTCTTGGCCTGTTACTGG - Intergenic
995776286 5:115727670-115727692 GACAGCTCTTGGCCTGTTACTGG - Intergenic
996018561 5:118567865-118567887 GACAGCTCTTGGTCTGTTACTGG + Intergenic
996164955 5:120212499-120212521 GACAGCTTTTGGCCTGTTACTGG - Intergenic
996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG + Intergenic
996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG + Intronic
998290335 5:140908542-140908564 GACAGCTCTTGGCCTATTACTGG - Intronic
999065426 5:148680425-148680447 GAGAGCTCCTGGCCAACCACTGG - Intergenic
999351386 5:150874854-150874876 GACAGCTCTTGGCCTGTCACTGG + Intronic
999618168 5:153447463-153447485 GCGAGCTCCTTGCCTGCTACTGG - Intergenic
1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1000422870 5:161058029-161058051 GAGAGCTCTTGGCCTGCTACTGG - Intergenic
1001173596 5:169444652-169444674 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003695897 6:8406130-8406152 GACAGCTCTTGGCCTGTTACAGG - Intergenic
1003758608 6:9150091-9150113 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003791221 6:9550001-9550023 GACAGCTCTTGGCCTATTACTGG + Intergenic
1004316460 6:14592398-14592420 GAGAGCCCCTGGCCAGCCACTGG - Intergenic
1004824288 6:19403226-19403248 GACAGCTCTTGGACTGTTACTGG - Intergenic
1006001557 6:30969085-30969107 GACAGCTCTTGGCCTATTACTGG + Intergenic
1006062352 6:31433232-31433254 GACAGCTCTTAGCCTGTTACTGG + Intergenic
1006581530 6:35080392-35080414 GAGAGCTCTTCCTCAGCTGCAGG - Intronic
1008043485 6:46827999-46828021 GAGAGCTCTTGCATAGTTACAGG + Intronic
1008266921 6:49439279-49439301 GACAGCTCTTGGCCTGTTACTGG - Intronic
1008675427 6:53813170-53813192 GAGAGGTCATGGCCAGATCCAGG + Intronic
1009390111 6:63135068-63135090 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1009660694 6:66606912-66606934 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1009770333 6:68136842-68136864 GATAGCTCTTGGCCTGCTACTGG - Intergenic
1010054612 6:71550977-71550999 GAGAGTTCTTTGACAGCAACAGG - Intergenic
1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG + Intergenic
1010325329 6:74556589-74556611 GACATCTCTTGGCCTGTTACTGG - Intergenic
1010580752 6:77593895-77593917 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1010617637 6:78031832-78031854 GAGAGCCCCTGGCAAACTACTGG + Intergenic
1010938245 6:81886407-81886429 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1011069102 6:83361675-83361697 GACAGCTCCTGGCCTGTTACTGG + Intronic
1012362990 6:98406675-98406697 AACAGCTCTTGGCGTGCTACTGG - Intergenic
1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1012920794 6:105219535-105219557 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1013406672 6:109849812-109849834 GACAGTTCTTGGCCAGTTACTGG + Intergenic
1014363396 6:120508344-120508366 GAGAGCTCTTGGCCTGTTACTGG - Intergenic
1014416987 6:121195399-121195421 GACAGCTCTTGGCATGTTACTGG + Intronic
1014534196 6:122596612-122596634 GAGAGCTCTTGGCCTATTACTGG - Intronic
1014895655 6:126896584-126896606 GACAGCTCTTGGCCTGATAATGG + Intergenic
1015095449 6:129409591-129409613 GACAACTCTTGGCCTGTTACTGG - Intronic
1015443284 6:133272555-133272577 GACAGCTCTTGGCCCATTACTGG - Intronic
1015475750 6:133657501-133657523 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1015862094 6:137691851-137691873 GACAGCTTTTGGCCTGCTCCTGG + Intergenic
1016144291 6:140649412-140649434 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1016147329 6:140692706-140692728 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1016174914 6:141069085-141069107 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1016419614 6:143870672-143870694 GACAGCTCTTGGCCTGTTACTGG - Intronic
1016576257 6:145572577-145572599 GACAGCTCTTGGTCTGTTACTGG - Intronic
1017044069 6:150330844-150330866 AACAGCTCTTGGCCTGCTACTGG - Intergenic
1018128683 6:160707099-160707121 GAGAGCTCTTGACAAGCACCAGG + Intronic
1018136557 6:160783782-160783804 GAGAGCTCTTGACAAGCACCAGG + Intergenic
1018599888 6:165527536-165527558 GACAGCTATTGGCCTGGTACTGG + Intronic
1018803791 6:167242981-167243003 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1020396718 7:7725524-7725546 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020710350 7:11597635-11597657 GACAGCTCTTGGCCTGTTACTGG + Intronic
1021305091 7:19022517-19022539 AATAGCTCTTGGACTGCTACTGG - Intronic
1021988810 7:26122932-26122954 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024040538 7:45550154-45550176 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024046911 7:45591252-45591274 GGCAGCTCCTGGCCACCTACTGG - Intronic
1024731703 7:52260603-52260625 GAGAGCTCTTTTCCAGGTAATGG + Intergenic
1024744207 7:52388453-52388475 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1028237821 7:88382830-88382852 GACAGCTCTTGGCCTATTACTGG + Intergenic
1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1029638887 7:101805604-101805626 GAGAACTCTTGGCAAGGGACTGG - Intergenic
1030037684 7:105421927-105421949 GAGAGCCCTTGGCAAACCACTGG + Intergenic
1030368754 7:108674036-108674058 GACAGATCTTGGCCTGTTACTGG + Intergenic
1030457463 7:109793043-109793065 GACAACTCTTGGCCTGTTACTGG - Intergenic
1030931287 7:115525674-115525696 GACAGCTCTTGGCCCATTACAGG - Intergenic
1031236827 7:119188024-119188046 GACAGCTCTTGGCCTGTTACAGG + Intergenic
1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1031832996 7:126650025-126650047 GATAGCTCTTGTCCCGTTACTGG + Intronic
1031876036 7:127141935-127141957 AAGAGTTCTTGACCAGCTTCTGG - Intronic
1032153104 7:129446949-129446971 GACAGCTCTTGGCCTGTTACTGG - Intronic
1032923470 7:136576107-136576129 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1035316856 7:158001941-158001963 GAGACAGCTTGGCCAGCTTCCGG - Intronic
1036824953 8:11968745-11968767 GAGATCTCCTGCCCAGATACTGG + Intergenic
1038715031 8:29983912-29983934 GAGAGCCCTTGGCAAACCACTGG - Intergenic
1040030984 8:42823422-42823444 GACAGCTCTTGACCTGCTAATGG - Intergenic
1040911946 8:52528426-52528448 GACAGCTCTTGGCGAGTTACTGG + Intergenic
1041934554 8:63321338-63321360 GACAGCTCTCGGCCTGTTACTGG + Intergenic
1041986182 8:63924481-63924503 GATAGCTCTTGGCCTGTCACTGG + Intergenic
1042001060 8:64123988-64124010 GACAGCTCTTGGCTTGTTACGGG - Intergenic
1042068182 8:64901928-64901950 GATAGCACTTGCCCTGCTACTGG + Intergenic
1042342421 8:67694359-67694381 GACAGCTCTTGGCCTGCTGCTGG + Intronic
1043018437 8:74970064-74970086 GAGAGCCCCTGGCAAACTACTGG - Intergenic
1043259971 8:78184185-78184207 GAGCGCTCTTGACCTGGTACTGG - Intergenic
1044202390 8:89452496-89452518 GACAGCTCTTGGCCCATTACTGG + Intergenic
1044285973 8:90412438-90412460 GACAGCTCTTGTTCTGCTACTGG - Intergenic
1044487150 8:92767114-92767136 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1044578764 8:93801169-93801191 GATAGCTATTAGCCAGCTATAGG - Intronic
1045221839 8:100207073-100207095 GACAGCTCTTGGCCTGTTACTGG + Intronic
1046128673 8:109941594-109941616 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1046417637 8:113937786-113937808 GACAGGTCTTGGCCTGTTACTGG - Intergenic
1046585785 8:116147711-116147733 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1047438004 8:124851296-124851318 CAGGGCTCCTGGCCAGATACTGG + Intergenic
1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG + Intergenic
1048952801 8:139510096-139510118 CAGAGCCCCTGGCAAGCTACTGG + Intergenic
1048976524 8:139676000-139676022 GAGAGCCCATGGGCAGCTATGGG - Intronic
1049661031 8:143819841-143819863 GAGAGCTCTTGGCCTGCCTGGGG - Intronic
1050482675 9:6102611-6102633 GACAGCTCTTGGCCTATTACTGG + Intergenic
1051261782 9:15271919-15271941 GAGAGCGGTTGGCCATCTCCGGG - Intronic
1052227590 9:26108384-26108406 GACAGCTCTTGGCCTGTTACTGG + Intronic
1052999139 9:34567924-34567946 GAGAGATCCTGGCCAGCCCCAGG - Intronic
1055678621 9:78691686-78691708 AAGAGCTTTTGGCTTGCTACTGG - Intergenic
1055903940 9:81271196-81271218 GATACCTCTTGGCCTGTTACTGG - Intergenic
1056156667 9:83845217-83845239 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056231965 9:84556282-84556304 GAGAGCTCTCTGCCTGCTAATGG - Intergenic
1056314234 9:85372937-85372959 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056353871 9:85778310-85778332 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056653414 9:88488690-88488712 AAGAGCTGTTGGCCAGCCTCAGG + Intergenic
1057058997 9:91986598-91986620 AACAGCTCTTGGCCTGCTACTGG + Intergenic
1057692729 9:97300590-97300612 GATAGCTTTTGACCTGCTACTGG - Intergenic
1058239798 9:102542501-102542523 GACAGCTCTTAGCTTGCTACCGG + Intergenic
1058544165 9:106042742-106042764 GACAGCTCTTGGCCTATTACTGG - Intergenic
1059196505 9:112375860-112375882 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1060178782 9:121517325-121517347 GACAGCTCTTGGCCTGCGGCTGG + Intergenic
1060635779 9:125199051-125199073 GAGAACTCTGTGCCAGCTGCTGG + Intergenic
1060805142 9:126570680-126570702 GATTGCTCTTGGCCTGGTACTGG - Intergenic
1061652629 9:132063276-132063298 CAGAGCTCTTGGCTAGCTGAGGG - Intronic
1062135472 9:134925031-134925053 GACAGCTCTTGACCTGTTACAGG + Intergenic
1186279496 X:7977126-7977148 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1186384093 X:9091754-9091776 GACAGCTCTTGGCCTGTTACTGG - Intronic
1186469766 X:9812101-9812123 TAAAGCTCTTGGCCTGTTACTGG - Intronic
1186895990 X:14005204-14005226 GTGGGCTCTTGGACAGCTTCGGG + Intergenic
1187604866 X:20871870-20871892 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1188775735 X:34216140-34216162 GAGAGCCCCTGGCAAGCTGCTGG - Intergenic
1189032440 X:37464272-37464294 AATAGCCCTTGGCCTGCTACTGG - Intronic
1189154883 X:38746714-38746736 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1190255320 X:48758146-48758168 AACAGCTCTTGGTCTGCTACTGG + Intergenic
1190527878 X:51346241-51346263 AATAGCTCTTGGCCTGCTACCGG - Intergenic
1190601537 X:52097827-52097849 AACAGCTCTTGGTCTGCTACTGG - Intergenic
1191134033 X:57044480-57044502 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191630037 X:63312581-63312603 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191658804 X:63629799-63629821 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1191769494 X:64740091-64740113 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1191832729 X:65432316-65432338 GATCACTCTTGGCCTGCTACTGG - Intronic
1191932926 X:66394170-66394192 GACAGCTTTTGGCCTGTTACTGG + Intergenic
1192898704 X:75471916-75471938 GACAGCTCTTGGCCTATTACTGG + Intronic
1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG + Intergenic
1193447157 X:81618777-81618799 GACAGCTCTTGGCCTATTACTGG + Intergenic
1193832948 X:86310103-86310125 GACAGCTCTTGACCTGTTACTGG + Intronic
1193914801 X:87351922-87351944 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1193957285 X:87878216-87878238 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194179590 X:90695929-90695951 GACAACTCTTGGCCTGTTACTGG - Intergenic
1194443550 X:93961109-93961131 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194513417 X:94822246-94822268 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1194604389 X:95961962-95961984 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1194626616 X:96233172-96233194 GACAGTTCTTGGCCTGCTACTGG + Intergenic
1194824979 X:98550710-98550732 GAGAGCTCTTGGCCAACCACTGG + Intergenic
1194833959 X:98658810-98658832 GCGAGCTCTTGGCCTGTTACTGG + Intergenic
1194849245 X:98852168-98852190 GACAGCTCTTGGTCTGTTACTGG - Intergenic
1195069189 X:101262953-101262975 GAGAGCTCTTGGGCTGCTGAGGG + Exonic
1195228469 X:102822277-102822299 AACAGCTCTTGGCCTGCTAATGG + Intergenic
1195782352 X:108479859-108479881 GACAGCTCTTGGCCTGTTACTGG - Intronic
1196114480 X:111984119-111984141 AACAGCTCTTAGCCCGCTACTGG - Intronic
1196135968 X:112209837-112209859 GACAGCTCTTGGACTGTTACTGG - Intergenic
1196647016 X:118128815-118128837 GAGAGCGCTTGAACAGCTCCTGG - Intergenic
1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG + Intergenic
1197245045 X:124158988-124159010 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197372055 X:125637860-125637882 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1197380000 X:125727899-125727921 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1197477358 X:126941323-126941345 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1197534717 X:127673485-127673507 AAGAGCTGTTGGCCTGCTACTGG + Intergenic
1198701301 X:139400302-139400324 GACGGCTCTTGGCCTGTTACTGG + Intergenic
1198783039 X:140257791-140257813 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG + Intronic
1199021248 X:142881107-142881129 AACAGCTCTTGGCCTGCCACTGG + Intergenic
1199024380 X:142919725-142919747 GACAGCTCTTGGACTGTTACCGG + Intergenic
1199040592 X:143111106-143111128 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1199144441 X:144348959-144348981 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1199310426 X:146314394-146314416 GACAGCTCTTGGCCCGTTACTGG - Intergenic
1200228165 X:154430836-154430858 GTGTGCTCTTGGCCAGCTCAAGG + Intronic
1200289357 X:154857145-154857167 GATAGCTCTTGGCCTACTACTGG + Intronic
1200340494 X:155390636-155390658 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1200526252 Y:4278098-4278120 GACAACTCTTGGCCTGTTACTGG - Intergenic
1200973123 Y:9177704-9177726 GACAGCTCTTGGCCCATTACTGG - Intergenic
1200976630 Y:9218486-9218508 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201798428 Y:17926705-17926727 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201803125 Y:17979252-17979274 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1202134541 Y:21648071-21648093 GAGAGATCTTGGCCTGTTACTGG - Intergenic
1202137955 Y:21686809-21686831 GACAGCTCTTGGCCCATTACTGG + Intergenic
1202359748 Y:24095395-24095417 GACAACTCTTGGCCTGTTACTGG + Intergenic
1202511030 Y:25574719-25574741 GACAACTCTTGGCCTGTTACTGG - Intergenic