ID: 1091105385

View in Genome Browser
Species Human (GRCh38)
Location 11:132914404-132914426
Sequence CTGTTCCAATATAATATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 2, 1: 0, 2: 3, 3: 32, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091105383_1091105385 15 Left 1091105383 11:132914366-132914388 CCTGGTAATATGGTTCGTCTCTT 0: 1
1: 1
2: 0
3: 9
4: 145
Right 1091105385 11:132914404-132914426 CTGTTCCAATATAATATTTATGG 0: 2
1: 0
2: 3
3: 32
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091105385 Original CRISPR CTGTTCCAATATAATATTTA TGG Intronic
903076675 1:20774548-20774570 CAGTTCCATTATAATCTTAAGGG - Intronic
904632223 1:31850960-31850982 CAATTCCAATCTAATATTTCGGG + Intergenic
904946505 1:34202733-34202755 CTGTTCCAGAATAATATGAATGG + Intronic
905096466 1:35475779-35475801 CTGCTCCCATATCATATTTAAGG + Intronic
908529253 1:65018213-65018235 CTTTTCTAATATAAAATGTAAGG - Intergenic
910441036 1:87252292-87252314 CAATTCCAATATAAGATGTAAGG - Intergenic
910663323 1:89696947-89696969 CTTATCCAAATTAATATTTATGG + Intronic
911038821 1:93576275-93576297 CTGTTCTTATATGATGTTTAGGG + Intronic
911404085 1:97414323-97414345 CTGTATCAAAATACTATTTAAGG + Intronic
912315262 1:108661992-108662014 CAGTTCCAATATATCATTTGTGG - Intergenic
912353857 1:109039735-109039757 CTGTTCAAAAATAATATACAGGG + Intronic
913402013 1:118446517-118446539 CTATTCAAATATAATATTTTGGG - Intergenic
914942547 1:152035997-152036019 CTGTTCCAATACTTCATTTATGG + Intronic
917087852 1:171321519-171321541 CTGTTACACTGTAATGTTTAGGG + Intronic
917339746 1:173963717-173963739 GTGTTCATATATAATATTTATGG - Intronic
918464193 1:184805205-184805227 CTGTTCCAAGGCAATGTTTAGGG + Intronic
919460205 1:197867905-197867927 AAGTTCCAGCATAATATTTATGG - Intergenic
921008468 1:211116882-211116904 CTAATCCAATATAATAGTAATGG + Intronic
921210282 1:212890253-212890275 CTGTTATACTATAATGTTTAGGG - Intronic
921554967 1:216586907-216586929 CAGCACCAACATAATATTTAAGG + Intronic
924106862 1:240657621-240657643 GTGTTCTAATATAGCATTTAGGG + Intergenic
924507713 1:244701693-244701715 CTGTTCCACTATTATATTTTGGG + Intronic
924782231 1:247161178-247161200 ATTTTCAAATATAATATTCAGGG + Intronic
1062993432 10:1842514-1842536 CTATTACAAAATAATATTTAAGG + Intergenic
1063779853 10:9309388-9309410 GTGTTCCTACATTATATTTAAGG + Intergenic
1063810995 10:9707624-9707646 CTGTCTCTATATAATATTGATGG - Intergenic
1064767585 10:18690845-18690867 CTGTTCCATTATAATCTTACGGG - Intergenic
1064804818 10:19118948-19118970 CTGCTCCACTATAATCTTGAGGG - Intronic
1065065031 10:21953505-21953527 TTTTTACAAAATAATATTTAAGG - Intronic
1065118096 10:22501671-22501693 CTATTCCAATCTAATAATAAAGG - Intergenic
1065666019 10:28061989-28062011 CTGTTCAAAAAAAATATTCAAGG + Intronic
1067778455 10:49179595-49179617 TTTTTTTAATATAATATTTAGGG - Intronic
1067978414 10:51053305-51053327 CTGTTCCCATATAATAGTAGAGG + Intronic
1071367278 10:84911994-84912016 CTTTTCCAATGTATTAGTTAAGG + Intergenic
1071691468 10:87824475-87824497 CTGTTCCCATATTAAATATAAGG - Intronic
1073374799 10:103023777-103023799 TTATTTCAAAATAATATTTAGGG - Intronic
1073850204 10:107606980-107607002 ATTTTCCAATTTAACATTTATGG - Intergenic
1075239652 10:120766303-120766325 ATGTTACAACATCATATTTAAGG + Intergenic
1076277981 10:129221377-129221399 CTTTTCCAACATAAAATATATGG + Intergenic
1077735841 11:4789876-4789898 TTGGTTCAATAAAATATTTATGG + Intronic
1077792175 11:5452780-5452802 GTGTACCTATAGAATATTTAGGG + Intronic
1078677588 11:13437428-13437450 ATGTTCCAAAATAATTTTTGAGG - Intronic
1080362008 11:31526031-31526053 ATGTTTCAATAAAATATTTAAGG - Intronic
1081066010 11:38539906-38539928 CTGTTTTTATTTAATATTTAAGG - Intergenic
1081095537 11:38929338-38929360 CTGTTTCCATACAATATTTAAGG - Intergenic
1082696400 11:56370457-56370479 CTGTTCCAATATAATATTTATGG + Intergenic
1083083679 11:60120355-60120377 CTGTTGTAATACAATAGTTAAGG - Intergenic
1085160843 11:74342908-74342930 CTGTTTCAATGTTATATTCATGG + Exonic
1085907182 11:80777638-80777660 CTTTTCTTATATAATCTTTATGG + Intergenic
1086168667 11:83809846-83809868 GTCTTCTAATATAATATTCATGG - Intronic
1087491700 11:98836108-98836130 TTGTAGCAATATATTATTTAAGG + Intergenic
1087995227 11:104797913-104797935 CTGTACCAATATGATGTTCAGGG - Intergenic
1091105385 11:132914404-132914426 CTGTTCCAATATAATATTTATGG + Intronic
1092110272 12:5956068-5956090 CTGTTCCATTATAATTTTATGGG - Intronic
1093656145 12:21695990-21696012 ATGTTCCAATGTTATTTTTAAGG - Intronic
1094530159 12:31266654-31266676 CAGTTCTAAGGTAATATTTAAGG - Intergenic
1094633548 12:32202044-32202066 CTGATCATATATAATACTTATGG + Intronic
1094679216 12:32652758-32652780 CTGGTACAATATAATATTCCAGG - Intergenic
1095427826 12:42096332-42096354 CTGTTCCAACAAAATATTCCAGG - Intronic
1097343073 12:58461666-58461688 CTGTTGCACTATATTATTTAGGG + Intergenic
1098198886 12:68033979-68034001 CACTTTGAATATAATATTTAGGG + Intergenic
1098385021 12:69909486-69909508 ATGTTCCAAAAGAAAATTTAGGG + Intronic
1098648366 12:72934174-72934196 CAGTTCCAATATATTTTTGATGG + Intergenic
1098651461 12:72975904-72975926 ATGTTGCAATATAATCCTTAGGG + Intergenic
1099981394 12:89607751-89607773 TTGTTACACTATATTATTTAGGG + Intronic
1100480881 12:94977770-94977792 CTGTTCCAACATGGTATTTGGGG + Intronic
1101374073 12:104155836-104155858 CAGTTCCAACATTAGATTTAAGG - Intergenic
1101989430 12:109472758-109472780 CAGTTCCATTATAATCTTAAGGG + Intronic
1107243252 13:38262994-38263016 TTGTTCCAATCCACTATTTATGG - Intergenic
1108648240 13:52451073-52451095 GTGTTACAATATAATCTTAAAGG - Intergenic
1110700135 13:78537496-78537518 TTTTTCCAAAATAATATTTCAGG - Intergenic
1111032445 13:82621337-82621359 ATGTGTCCATATAATATTTAGGG + Intergenic
1111139134 13:84091353-84091375 CTTTTCTAAACTAATATTTATGG + Intergenic
1111258897 13:85708996-85709018 CTCTTTCAATAAAATATTGAGGG - Intergenic
1111574201 13:90129113-90129135 CTGCTCCATTATATTATTTGAGG - Intergenic
1112138981 13:96617152-96617174 CTGATTCAATATAATAATGATGG - Intronic
1113152051 13:107274762-107274784 GTGTGCCAATATAATACTAAAGG - Intronic
1114286205 14:21246123-21246145 CTGCTCCATTATAATCTTAAGGG + Intronic
1114364684 14:22013631-22013653 CTATTCCAGTATAAGATTTGTGG + Intergenic
1115732506 14:36286571-36286593 CTGTTTAAATATAGTTTTTAAGG - Intergenic
1116767159 14:49086670-49086692 CTGTGCCTATTAAATATTTATGG - Intergenic
1116968170 14:51036601-51036623 TTGTTACACTATACTATTTATGG + Intronic
1117806763 14:59500888-59500910 GTGTTCCAATAAAAACTTTATGG - Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118816083 14:69314978-69315000 CTGTTTAAATCTAAAATTTAGGG + Intronic
1119016370 14:71060137-71060159 CAGTTCCATTATAATCTTAAGGG - Intronic
1119683107 14:76607542-76607564 TTGTTCCATTACAATATTAATGG - Intergenic
1120727233 14:87958492-87958514 GTGTTCCTATATAAATTTTATGG - Intronic
1120828513 14:88976956-88976978 ATGCTCCAATATGATATTAAAGG + Intergenic
1123809416 15:23908290-23908312 CTGTACCAATATGATATCTCAGG + Intergenic
1125322617 15:38504860-38504882 CTGCTCCATTATAATCTTAAGGG + Intronic
1126375754 15:47995333-47995355 TTTTTCCAATTTAAAATTTAGGG - Intergenic
1128564669 15:68692932-68692954 CTGTTAGAATATAATTTTTTAGG - Intronic
1129449279 15:75641108-75641130 CTTTTACAATACAATATTTGAGG + Intronic
1134638409 16:15810001-15810023 CTTTTTCAATTTAATATTTACGG + Intronic
1136650593 16:31666510-31666532 CTGTCTCAATATACTATGTATGG - Intergenic
1137438667 16:48479900-48479922 CTGTTCCAATGTAAAATCCAGGG + Intergenic
1139081188 16:63523292-63523314 CTGTTACAATATATTGATTAAGG + Intergenic
1140720970 16:77771826-77771848 CTGTTCCAATATTCTTCTTATGG + Intergenic
1141359692 16:83384129-83384151 CAATTCCAATCTAATATCTAAGG + Intronic
1145111512 17:20166818-20166840 CTGGTCCCATATAATTTTTGGGG - Intronic
1145407436 17:22616630-22616652 ATGTCCAAATATAATTTTTAAGG + Intergenic
1147695353 17:42348285-42348307 CTGTTCCATTAAAAAATGTATGG - Intronic
1149093352 17:52811560-52811582 CTGTTGCAATATGACATTGAAGG - Intergenic
1150239516 17:63621145-63621167 CTGTTCCAGTGTAATATGTCAGG - Intergenic
1150713480 17:67551132-67551154 ATATTTCAATATAATATTTAAGG + Intronic
1155196683 18:23481695-23481717 CTGGGCCAATAAAATATTCAAGG - Exonic
1155292583 18:24356588-24356610 CTATTCCAATTTCATATTCAGGG - Intronic
1155793788 18:30007694-30007716 ATGTTCCAATTTAATGTTTAGGG - Intergenic
1156086993 18:33417610-33417632 CTGTATCAATATAAATTTTATGG + Intronic
1156740376 18:40319451-40319473 CTGTTATTATCTAATATTTATGG + Intergenic
1158371275 18:56807547-56807569 CTGTATCAATAGAATATTAATGG - Intronic
1158795831 18:60845259-60845281 CTTATGCAATATAAGATTTAAGG + Intergenic
1159489009 18:69105263-69105285 CTGCTCCAGTACAAAATTTAGGG + Intergenic
1159611898 18:70535083-70535105 TTGTTCCTATGTTATATTTAAGG + Intergenic
1159654852 18:71020813-71020835 CTTTTCCAAGAAAATATATATGG + Intergenic
1159733628 18:72064570-72064592 CTGTTGCAGTATAATTGTTATGG - Intergenic
1159988684 18:74876521-74876543 CTTATACAATATAATATTTCAGG - Intronic
1162177891 19:8845233-8845255 GGATTCCAAAATAATATTTAAGG - Intergenic
1163878224 19:19894781-19894803 AGGTTTTAATATAATATTTATGG + Intergenic
1164003353 19:21127371-21127393 CTGTTCCAATACTATTTTTTTGG + Intergenic
1164978478 19:32593651-32593673 CTTTTCCTATCTAATATTCATGG - Intergenic
925074767 2:1006655-1006677 CTGTTACAATATATTATTTAGGG - Intronic
926583243 2:14655251-14655273 TTGTTCCAATAACACATTTAAGG - Intergenic
928526038 2:32141807-32141829 CTTTTAAAATATAATATTCAAGG - Intronic
929092257 2:38230554-38230576 CTGTCACAATATAGTATTAAGGG + Intergenic
929702947 2:44180534-44180556 CTCTGCCAATTTAATATTTCTGG + Intronic
930647327 2:53925538-53925560 ATGTTCCAAAGAAATATTTATGG - Exonic
930815405 2:55591825-55591847 CTGTTCCAATATATTTATGAAGG + Intronic
931434328 2:62234007-62234029 CTGTTCCCAGATGCTATTTAAGG + Intergenic
931438908 2:62273379-62273401 CTGAACCAATATGATATATATGG + Intergenic
932039032 2:68278976-68278998 TTTTTCCACTAGAATATTTATGG + Intergenic
933044264 2:77515548-77515570 GTTTTCCAATTAAATATTTATGG + Intronic
933470856 2:82721538-82721560 GTATTCAAATATAATATTGATGG - Intergenic
933475522 2:82785211-82785233 CACTTCCAATATGATCTTTAAGG + Intergenic
933478696 2:82825420-82825442 CTCTTCCTATACAATATTTTCGG + Intergenic
934968925 2:98747423-98747445 CAGTTCCATTATAATCTTTTGGG + Intergenic
934980955 2:98840121-98840143 TTTTTATAATATAATATTTAAGG + Intronic
935317284 2:101848244-101848266 CTGTTACACTATATTATTTAGGG + Intronic
935484479 2:103636451-103636473 ATGTTCCAATAAAATAGGTAGGG - Intergenic
936135009 2:109884245-109884267 CTGTTCCAAAAAAACATTTGAGG - Intergenic
936209688 2:110487240-110487262 CTGTTCCAAAAAAACATTTGAGG + Intergenic
938613361 2:132972103-132972125 CTGTTCCAGTATACTATTAATGG - Intronic
938682340 2:133704417-133704439 ATGTTACATTATAATATTGATGG - Intergenic
939359659 2:141153056-141153078 CAGTTTCATGATAATATTTAAGG - Intronic
940609874 2:155976750-155976772 CTGTGAAGATATAATATTTAGGG + Intergenic
941420124 2:165274291-165274313 TTATTCCAATAGTATATTTATGG + Intronic
941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG + Intergenic
941799840 2:169646667-169646689 CTGTTCCAATTTTAAATTTTCGG - Intronic
942361558 2:175178006-175178028 ATATTCCAATGTAATTTTTATGG - Exonic
942507565 2:176659712-176659734 TTGTACCATTAAAATATTTATGG + Intergenic
943544186 2:189254434-189254456 CTGTTCCACTAAAATATTTTGGG + Intergenic
943554819 2:189389577-189389599 TTATTCCAATCTAAAATTTATGG - Intergenic
944404318 2:199365085-199365107 CTATTCCAAAATTATTTTTAAGG - Intronic
944736059 2:202567075-202567097 CTGATACAATATAATCTCTATGG - Exonic
944890467 2:204111807-204111829 CTGTTTCAATTTAATACTTTAGG - Intergenic
945212550 2:207398394-207398416 CTGATCAAGTATAATAATTAAGG + Intergenic
947088621 2:226484567-226484589 CTTTTCTAATATAAAATTTGGGG - Intergenic
1169917934 20:10702323-10702345 CTTTTGCAATATAATTTTGAAGG + Intergenic
1170289271 20:14749559-14749581 CTGTTCACATATTATATTTTGGG - Intronic
1172026221 20:31950779-31950801 CTGTTCCAATCTAGTATTGTTGG - Intronic
1174704031 20:52637443-52637465 CAGCTCTAATATAATTTTTAAGG - Intergenic
1175560511 20:59924667-59924689 CTCTTAAAATATAATATTTTTGG - Intronic
1176890578 21:14313168-14313190 CTGTGCTAATAAAATGTTTATGG + Intergenic
1177265175 21:18774294-18774316 CTGCTCTAATATAAACTTTATGG - Intergenic
1177636536 21:23794525-23794547 CTATTTCTATATAGTATTTAAGG + Intergenic
1178449150 21:32677342-32677364 TTGTTCCAATATGATATATTAGG - Intronic
1178462194 21:32812513-32812535 CAGTTTCAATAAAGTATTTATGG - Intronic
1179999487 21:44988883-44988905 CTGTTCCAATTTCATATTCTGGG + Intergenic
1180620119 22:17155820-17155842 CTGTTCCATTATAATCTTAAGGG - Intronic
1182246985 22:28966324-28966346 CAGTTCCATTATAATCTTTACGG - Intronic
1184979866 22:48088384-48088406 CTGTTGCAATATGTTATTTTGGG - Intergenic
949288918 3:2440073-2440095 CTTTACAAATATAATATTTATGG - Intronic
949386229 3:3505277-3505299 CTTTTCTAATATGATGTTTAAGG + Intergenic
951250158 3:20385009-20385031 CTATTCCAATATCCAATTTATGG - Intergenic
951885870 3:27523779-27523801 ATGTTCCAATATAAAAAATATGG + Intergenic
952433134 3:33245581-33245603 CTGTTTCAACATGAAATTTAGGG - Intergenic
954494601 3:50944520-50944542 CTGTGCCAAGATAGTAATTAAGG + Intronic
954940571 3:54368662-54368684 CTGCTCCAAGGTAATATTTGGGG + Intronic
955087303 3:55715689-55715711 CTGTTCCTAAATAATCATTATGG - Intronic
955784208 3:62519221-62519243 ATGTTCCAATAGAAGTTTTATGG - Intronic
955819399 3:62880224-62880246 CTTTTCCAAAATAACATTTGTGG + Intergenic
957122897 3:76119486-76119508 GTGGTCCAATAAAATATTAATGG + Intronic
957618278 3:82561534-82561556 CAGTTCCAAAATATTATTGAAGG + Intergenic
957709041 3:83830004-83830026 CTGTCCCAATATGATACTTCGGG - Intergenic
957766973 3:84638056-84638078 CTGTTCCAATATTATATGACAGG - Intergenic
957836485 3:85598490-85598512 CTGTTCCAATATTCTACGTATGG + Intronic
958719625 3:97827737-97827759 CTTTTACAATATATAATTTAAGG + Intronic
958991600 3:100852376-100852398 CTGTTACAATATCTTATGTATGG + Intronic
960574905 3:119219804-119219826 TTGTTCAAATGTTATATTTAAGG - Intronic
960858498 3:122127354-122127376 CTTTTCCAACATTATATTTTAGG - Intergenic
961232797 3:125334050-125334072 GTATACCTATATAATATTTAAGG + Intronic
962622796 3:137196503-137196525 CTGTTCCACTGTTGTATTTAGGG - Intergenic
962687788 3:137864021-137864043 AAGTTCCAAAATAAAATTTAAGG - Intergenic
964015740 3:151943910-151943932 CTGCTCCATTATAATCTTTTGGG + Intergenic
965698696 3:171437597-171437619 CTGGTCCAATCTAATATGGAAGG - Intronic
966113008 3:176426305-176426327 TTGAACCAACATAATATTTATGG + Intergenic
967354229 3:188550158-188550180 TTGTTCCATTAAAAAATTTATGG - Intronic
968580888 4:1394344-1394366 CATTTCAAATATAATCTTTAAGG - Exonic
971116636 4:23654442-23654464 CAGCTCCATTATAATATGTATGG + Intergenic
972724375 4:41733490-41733512 CTGTTCCATTGTAACATTTTTGG + Intergenic
974401319 4:61411464-61411486 GTGTTACAAAATAATATCTATGG - Intronic
974786903 4:66630156-66630178 TAGTGCCAATAAAATATTTAAGG - Intergenic
974810999 4:66945673-66945695 CTTTTCTAATATAAAATTTTAGG - Intergenic
975255312 4:72228323-72228345 CTGAGCTAATAAAATATTTAGGG - Intergenic
975895377 4:79083823-79083845 CTGCTCTAATAAAATATGTAGGG + Intergenic
976061410 4:81132349-81132371 TTCTTCCTTTATAATATTTAGGG + Intronic
976118535 4:81754680-81754702 CTTTTTCCATATAACATTTAAGG + Intronic
976287791 4:83386762-83386784 CTGTTCCTATAAAGAATTTAAGG + Intergenic
976949162 4:90808277-90808299 GTTTTCTAATATAATTTTTATGG - Intronic
977679341 4:99781698-99781720 CTGTATACATATAATATTTAAGG - Intergenic
979861707 4:125701258-125701280 GTGTTTCAAAAAAATATTTATGG + Intergenic
980077133 4:128305875-128305897 CTTTTACAACATAATATTGATGG - Intergenic
980183958 4:129437638-129437660 TAGTTGCAATATACTATTTATGG + Intergenic
982420582 4:155191888-155191910 CTTTTAAAATAAAATATTTATGG - Intergenic
982914960 4:161196238-161196260 CTTTTACAGTATAATAATTATGG - Intergenic
984251044 4:177335181-177335203 CTATTGCAAAATAATATCTATGG - Intronic
984389065 4:179103924-179103946 CTGTTGAAATATAATATAGATGG + Intergenic
984404730 4:179313413-179313435 TTTATCAAATATAATATTTATGG - Intergenic
987445759 5:18017363-18017385 ATGTTTCTATATATTATTTATGG + Intergenic
987852657 5:23377258-23377280 TTGTTTTTATATAATATTTAAGG - Intergenic
987965843 5:24871665-24871687 CTTATCCAATTTAGTATTTAAGG + Intergenic
987990468 5:25203007-25203029 CTGTTCCAAGATTCTATCTAGGG + Intergenic
988159965 5:27506349-27506371 CCTTCCAAATATAATATTTAAGG - Intergenic
988291270 5:29290704-29290726 CTTTGCCCAAATAATATTTAGGG - Intergenic
989100293 5:37816864-37816886 CTGTTCCTTTATGATTTTTAAGG - Intronic
989413554 5:41147912-41147934 CTCTGCCAATTTAATACTTAAGG - Intronic
989648461 5:43662535-43662557 CTGACCCAATATGATATTTATGG - Intronic
990206687 5:53437368-53437390 CTTTGCCAATATAATATATAAGG + Intergenic
990213079 5:53501481-53501503 CTGTTCCTAGATAATAGTGAAGG - Intergenic
991964437 5:72077222-72077244 CTGTTCCTAGAAAATATTTTGGG - Intergenic
993069482 5:83141787-83141809 CTGTTCCAGATTAATATTTTGGG - Intronic
993562378 5:89426356-89426378 TTGTTTCTATATAATATTTTAGG + Intergenic
993928836 5:93910645-93910667 CTGTTCAGATATAATATATGTGG + Intronic
994927174 5:106131400-106131422 CTGTTATAATGTAATTTTTATGG - Intergenic
995227763 5:109722310-109722332 ATGTACTAATATAGTATTTAGGG - Intronic
995636466 5:114198227-114198249 TGGCTCCTATATAATATTTATGG + Intergenic
997907457 5:137833008-137833030 CTGTTAAAAGATAATTTTTAAGG + Intergenic
999025272 5:148222623-148222645 CTGTTCCTTTTTAATATTTGGGG + Intergenic
1000311482 5:160049214-160049236 GTGTTCCAATAAACTATTTATGG - Intronic
1000851470 5:166345391-166345413 ATGTTTCAATATAATAGTAATGG + Intergenic
1002916504 6:1532562-1532584 ATATTTCAATATAATATTTTTGG - Intergenic
1003767390 6:9254590-9254612 TTGTTCCAAAATTATATTAATGG - Intergenic
1003781030 6:9427067-9427089 TTGTACCAATGTAATATTTTTGG - Intergenic
1004122867 6:12842173-12842195 ATGTTTCAATAGAATTTTTAAGG - Intronic
1004132046 6:12929750-12929772 CTATTCCAAAATATTATCTAGGG - Intronic
1005215636 6:23524578-23524600 CTGTTCTAACATTCTATTTAGGG + Intergenic
1005565040 6:27083057-27083079 CTCTTCCAAGATGACATTTAAGG + Intergenic
1007911220 6:45516300-45516322 TTGTTCCATTACAATATTTAAGG - Intronic
1008001894 6:46369546-46369568 CTGTTCCATTATAATCTTATGGG + Intronic
1008827960 6:55721504-55721526 TTTTTGAAATATAATATTTAAGG - Intergenic
1009576525 6:65469430-65469452 CTTTTCCATTAAAATTTTTAAGG + Intronic
1009953536 6:70423947-70423969 CTGATCCACTATAATATGTTGGG - Intronic
1011524430 6:88248166-88248188 TTGTTCTAATCTCATATTTAGGG + Intergenic
1011842167 6:91515176-91515198 CCCTTCCAATATTATATTAAAGG + Intergenic
1012602176 6:101112186-101112208 CTGTTCCACTATTGTATTTTGGG + Intergenic
1013024514 6:106257480-106257502 CAGTTCCATTATAATCTTAAGGG + Intronic
1013731234 6:113170083-113170105 CTGTTGAAATACATTATTTAGGG + Intergenic
1014735085 6:125084176-125084198 CTGCTCAAACATAATATTTTTGG + Exonic
1015307668 6:131727924-131727946 CTGTTCCAATTCAAAATTTTTGG + Intronic
1015990226 6:138933379-138933401 GTGTTCTAATACAATTTTTATGG + Intronic
1016822343 6:148358505-148358527 CTGTTTCAAAATAATTTTTATGG + Intronic
1017267800 6:152471044-152471066 CTGTACCAACTTAATTTTTAAGG - Intronic
1020757957 7:12227904-12227926 CAGTTTCATTAGAATATTTAAGG - Intronic
1020972709 7:14966127-14966149 CTGTTGTAATAAAATTTTTATGG - Intronic
1027485837 7:78760859-78760881 TTTTTCCAATATAATCTTTTAGG - Intronic
1027768349 7:82375052-82375074 CAGATCCAATATGATATTTTTGG - Intronic
1028118531 7:87029525-87029547 AAGTTCCAAAATAATATTTATGG - Intronic
1028414804 7:90568161-90568183 CCGTTTGAATATAGTATTTACGG + Intronic
1030414540 7:109225771-109225793 CTGTTCCATTGTATTATGTAAGG + Intergenic
1030481353 7:110108414-110108436 CTGTTCCATTATAATCTTATGGG + Intergenic
1030943411 7:115683740-115683762 TTGTTCAAGTATAATATATATGG + Intergenic
1031064076 7:117085472-117085494 CTGTTACCAAACAATATTTATGG + Intronic
1032506734 7:132441072-132441094 CTGTTCCTATATTATATTTGAGG - Intronic
1032924769 7:136590722-136590744 CTATTCCAATATATTGTTGAGGG - Intergenic
1034980816 7:155475110-155475132 GTGTTCGATTATAATATTTGGGG + Intronic
1035010128 7:155708114-155708136 CTGTTGAAATATTATATTTCAGG + Intronic
1035430632 7:158817915-158817937 GTACTCCAGTATAATATTTATGG + Intronic
1036179549 8:6572226-6572248 CTATTCTAGTAAAATATTTACGG + Intronic
1036594997 8:10203469-10203491 CAGTTCCACTATAATCTTAAGGG - Intronic
1038648353 8:29380040-29380062 CTGGTCCAAAATAATTTTCAAGG + Intergenic
1038812378 8:30862351-30862373 ATATTACAAAATAATATTTAAGG + Intronic
1038895720 8:31779575-31779597 CTGGTCCAATTTAGTAATTATGG + Intronic
1039165373 8:34673528-34673550 CTATTACAATATAATTTTTATGG - Intergenic
1040950596 8:52935307-52935329 CTGTTCCATGATAATATTAATGG + Intergenic
1041276291 8:56161805-56161827 ATGATCCAATATAATATTGAAGG + Exonic
1041481546 8:58326440-58326462 CTGTTCCAGTATAGCATTTAAGG - Intergenic
1041625593 8:60022662-60022684 CTGTTCCAATATTATACTTAAGG - Intergenic
1041718258 8:60951488-60951510 GTGTTCCAATAAAATTTTTATGG + Intergenic
1042888280 8:73577126-73577148 CTGTTTAAATATAATATTTATGG + Intronic
1043960498 8:86412830-86412852 CTGCTCCAAAATAATAATAATGG - Intronic
1043964573 8:86459384-86459406 ATGTTTCAATACAATATTAAGGG + Intronic
1044106478 8:88213805-88213827 ATTTTCCAATTTGATATTTATGG - Intronic
1044390302 8:91642276-91642298 CTATTCCATTATCATATGTAAGG + Intergenic
1044496341 8:92889375-92889397 CTATACTATTATAATATTTATGG + Intronic
1046258113 8:111727768-111727790 CAGTTCCAATATCATGTTTAGGG - Intergenic
1046265688 8:111826336-111826358 CTGTTAAAATACAATACTTAGGG - Intergenic
1046576033 8:116030080-116030102 CTGCTCTATTATAATCTTTACGG - Intergenic
1046688155 8:117250244-117250266 CTGATCTAATATTATATTTCTGG + Intergenic
1046907841 8:119593010-119593032 CTGTTTCAATCTAATAGTTCCGG + Intronic
1047535360 8:125714470-125714492 CTTTTCTAATGTAATATTAAAGG + Intergenic
1047588815 8:126304107-126304129 CTGTTCCAAGAAAATACTTTAGG - Intergenic
1047635483 8:126757034-126757056 ATATTCCACTATAGTATTTATGG + Intergenic
1047803888 8:128338600-128338622 CTGCTCCAAAATAATATTCAAGG - Intergenic
1048004048 8:130403981-130404003 CTCTGAGAATATAATATTTAAGG - Intronic
1049038468 8:140094971-140094993 CTATTTCAATAAAACATTTATGG - Intronic
1050745388 9:8870185-8870207 CTGTTCTAATATAATTTAAAGGG - Intronic
1050946774 9:11531616-11531638 GTGCTCAAATATATTATTTAAGG + Intergenic
1052016546 9:23475058-23475080 ATGATACTATATAATATTTATGG - Intergenic
1052120979 9:24715739-24715761 ATGTCCCAATATAATTTTAATGG + Intergenic
1052810774 9:33057408-33057430 GTGATCCAATAACATATTTAAGG - Intronic
1056252236 9:84761474-84761496 CTGTACTATTATAATATTTCTGG - Intronic
1057157012 9:92851405-92851427 GTGTTCCAATAAAAACTTTATGG - Intronic
1057840176 9:98479924-98479946 TTGTTCTAATATAATATGTTAGG + Intronic
1058837133 9:108867465-108867487 CTGCTTCAATACATTATTTAAGG + Intergenic
1059616388 9:115956038-115956060 CTTTTCCCATTTAATATTTTAGG - Intergenic
1185989702 X:4879681-4879703 GAGTTCCAACATAATATTTTAGG + Intergenic
1186260723 X:7776334-7776356 CTTTTCCTCTATGATATTTAGGG + Intergenic
1187137031 X:16557949-16557971 CTCTTCCAATATCACTTTTATGG - Intergenic
1188003097 X:25000458-25000480 GTGTTCCAAAATATTATTTTAGG + Intergenic
1193214391 X:78845592-78845614 TTGTTCCTATATAAATTTTAGGG - Intergenic
1193227638 X:79003297-79003319 CAGTTCCATTTTTATATTTATGG - Intergenic
1193678393 X:84485023-84485045 CTGTTTAATTAAAATATTTAGGG + Intronic
1197235464 X:124057776-124057798 CTGTTTCAATTTCATATCTAAGG - Intronic
1197338697 X:125239777-125239799 CTGTTGCTATATAAATTTTAAGG + Intergenic
1198633718 X:138672542-138672564 CTGTGAACATATAATATTTAGGG + Intronic
1198722645 X:139639852-139639874 CTTTTCCTATTTAATCTTTAGGG + Intronic