ID: 1091106057

View in Genome Browser
Species Human (GRCh38)
Location 11:132920858-132920880
Sequence TGAGCTCAGGAGACGCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091106057 Original CRISPR TGAGCTCAGGAGACGCCAGG TGG (reversed) Intronic
900335676 1:2161841-2161863 TCAACTAAGGAGACTCCAGGTGG - Intronic
902836937 1:19053542-19053564 TGAGGCCAGGAGCCGGCAGGAGG - Intergenic
903182103 1:21609951-21609973 TGAGCTTTGGGGACGACAGGGGG + Intronic
903282532 1:22258084-22258106 TGTGCACAGGTGACGCCACGGGG + Intergenic
903357929 1:22759484-22759506 TGAGCTCAGCCGACTCCAAGAGG - Intronic
904442959 1:30543620-30543642 CGAGCTCAGGAGACAGGAGGTGG + Intergenic
906977320 1:50589378-50589400 GCAGCTCAGGTGACTCCAGGTGG + Intronic
907144602 1:52220743-52220765 GGAGCTCAGGAGAGCCCAGAGGG - Intronic
907735169 1:57105075-57105097 TGAGGGTAGGAGACGCCAGCAGG + Intronic
908096309 1:60742666-60742688 TGAGCACAGGTTACACCAGGAGG - Intergenic
912499371 1:110111917-110111939 TGATCCCAGGAGGCACCAGGAGG - Intergenic
916026404 1:160837262-160837284 TGAGATTAGGAGACCACAGGAGG - Intronic
916574059 1:166051436-166051458 TGAGCTCAGGATAAGCTATGTGG + Intergenic
919121185 1:193342220-193342242 GGAGCTCAGCAGGAGCCAGGTGG - Intergenic
921392684 1:214632581-214632603 TGAGCTGAGGAGAAGCATGGAGG + Exonic
922141157 1:222888179-222888201 TGAGCTCAGGAAACTCAAGTAGG - Intronic
923418895 1:233792804-233792826 GGAGCTCTGGAGTCACCAGGTGG - Intergenic
1062926792 10:1322055-1322077 TGGACTCAGGAGACACCAGTTGG + Intronic
1066349511 10:34624589-34624611 TGAGCCCAGAAGCCACCAGGAGG + Intronic
1068953271 10:62799533-62799555 TGAGCTAATGAGATGCCAGAAGG + Intergenic
1070162227 10:73873707-73873729 TGAGCTCTGGAAACGTCTGGGGG + Intronic
1073134245 10:101211229-101211251 TGAGCTCTGGAGACAGAAGGGGG - Intergenic
1076761295 10:132607131-132607153 AGAGCCCAGGAGCAGCCAGGTGG + Intronic
1076790827 10:132775838-132775860 TGCCCCCAGGGGACGCCAGGTGG + Intronic
1077394477 11:2314433-2314455 TGTGCTCCCGAGACCCCAGGAGG - Intronic
1078064113 11:8066699-8066721 TGAGCTCTGAAGAGGGCAGGAGG - Intronic
1079349402 11:19679949-19679971 TGGGCACAAGAGAGGCCAGGAGG + Intronic
1082693487 11:56332260-56332282 TGAGCTCAGGAAGCGCGGGGAGG - Intergenic
1083849746 11:65358124-65358146 AGAGCTAGGGAGACTCCAGGGGG + Intergenic
1084414269 11:69021948-69021970 TGAGCTCATGGGAAACCAGGTGG + Intergenic
1088981796 11:114870987-114871009 AGAGCTCAGGAGATGACAGAAGG - Intergenic
1089635405 11:119808550-119808572 TGGTCTCAGGAGCCGGCAGGCGG + Intergenic
1090066885 11:123510853-123510875 AGACCTCAGGAGAGGCGAGGAGG + Intergenic
1090434291 11:126673902-126673924 GGAGCTCAGTACAGGCCAGGAGG + Intronic
1091106057 11:132920858-132920880 TGAGCTCAGGAGACGCCAGGTGG - Intronic
1091496385 12:976655-976677 TGACCTCAGGTGATGCCATGGGG + Intronic
1091863044 12:3804059-3804081 TGAGAACAGCAGACGCTAGGTGG - Intronic
1094208225 12:27862977-27862999 TGAGCTAGGGAGAGGACAGGAGG - Intergenic
1096344025 12:50829200-50829222 TGACCTCAGGTGACACCAGCTGG - Intergenic
1096430447 12:51538721-51538743 TGACCTCAGGTGATGCCAGATGG - Intergenic
1097727425 12:63090934-63090956 TGAGCTCCAGAGACTCTAGGTGG - Intergenic
1100632242 12:96400365-96400387 GGAGCTCAGGAGACTGCGGGCGG + Exonic
1101749997 12:107575764-107575786 TAAGTTCAGGAGCCTCCAGGTGG - Intronic
1101906059 12:108827417-108827439 GGAGATCAGGAAAAGCCAGGAGG + Intronic
1102145945 12:110655284-110655306 TGAGCTCAGCAAGCACCAGGAGG + Exonic
1102222551 12:111204284-111204306 TGAGCTACGGAGCTGCCAGGTGG + Intronic
1103586595 12:121960937-121960959 TCAGCACAGGAGTCCCCAGGTGG - Intronic
1105861511 13:24419247-24419269 TGTGCACAGGAGTCGCCTGGGGG + Intergenic
1108098899 13:46934549-46934571 TGAGCTAGTGAGACACCAGGTGG + Intergenic
1108662267 13:52597998-52598020 TGTGCACAGGAGTCGCCTGGGGG + Intergenic
1111563496 13:89983876-89983898 TGAGCCCAGGAGGTCCCAGGAGG - Intergenic
1113885112 13:113654736-113654758 TCGGCTCTGGAGACGCCCGGGGG - Intronic
1114587277 14:23826326-23826348 TGAGGTCTGGGGAAGCCAGGAGG - Intergenic
1115862705 14:37706365-37706387 AGAGATGAGGAGACACCAGGAGG - Intronic
1121496459 14:94394851-94394873 TGAGCTCAGGAGGGGCCACAAGG - Intergenic
1202857494 14_GL000225v1_random:59937-59959 TGAGCTCAGGTCTAGCCAGGAGG - Intergenic
1123582775 15:21731215-21731237 GGCGCTCAGGAAACACCAGGAGG - Intergenic
1123619425 15:22173811-22173833 GGCGCTCAGGAAACACCAGGAGG - Intergenic
1123625323 15:22223280-22223302 TGAGCTGAGTCGACACCAGGTGG + Intergenic
1124125321 15:26933914-26933936 TCAGCTCAGGAGACTGCAGATGG + Intronic
1124367070 15:29079635-29079657 TCAGCACTGGACACGCCAGGAGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1125894836 15:43293660-43293682 TGAGCCCAGGGGACTGCAGGTGG - Intronic
1128331715 15:66760540-66760562 TGAGATCAGGAGCAGCCATGAGG - Intronic
1129304059 15:74645780-74645802 TGAGGTCAGGGGAGCCCAGGAGG + Intronic
1129519331 15:76176164-76176186 TGGGCTCAGCAGAGGCAAGGGGG + Intronic
1130585324 15:85176123-85176145 TGAGAACAGCAGATGCCAGGTGG + Intergenic
1131423645 15:92327755-92327777 TGGGCACAGGAGATGCCAGCTGG - Intergenic
1133801861 16:9091455-9091477 TGTGCTCAGAAGCCGCCACGCGG + Intergenic
1134215303 16:12312566-12312588 TGAGGGCAGGGGAGGCCAGGGGG + Intronic
1135607487 16:23836567-23836589 TGAGAGCAGGAGAGGGCAGGAGG - Intronic
1136000526 16:27289059-27289081 AGAGGTCAGGAGAAACCAGGAGG + Intronic
1138420092 16:56893172-56893194 TGAGCTCAGGGGAGCCCAGAGGG + Intronic
1140655486 16:77135138-77135160 TGAGCTCTGGGGAGGCAAGGGGG + Intergenic
1142708305 17:1709978-1710000 TCAGCTCTGGAGACGCCCGGCGG + Intronic
1144074116 17:11701555-11701577 TGAGCACAGGACACACCAGTAGG + Intronic
1144769037 17:17748981-17749003 TGACCTCAGGAGACAGCAGCAGG + Intronic
1150876564 17:68977198-68977220 TGGTCACAGGAGCCGCCAGGTGG + Intronic
1151130931 17:71895366-71895388 GGAGCTCTGGAGTCACCAGGAGG - Intergenic
1151736832 17:75947797-75947819 TGAACCCAGGAGAACCCAGGAGG - Intronic
1152205844 17:78974001-78974023 GAAGCCCAGGAGACGCCATGGGG - Intronic
1203160387 17_GL000205v2_random:43788-43810 TCAGCAAAGGAGATGCCAGGGGG - Intergenic
1158932440 18:62334830-62334852 TGAGATCAGGAGACACTAGCGGG + Intronic
1160713786 19:565745-565767 GGAGCTCAGGAGAACCCAGAGGG - Intergenic
1160890689 19:1377286-1377308 TGCACTCAGGACAGGCCAGGCGG - Exonic
1162794502 19:13079537-13079559 CGAGCCCAGGAGATGGCAGGCGG - Intronic
1162936041 19:13982070-13982092 TGACCTCGGGAGACAGCAGGGGG + Intronic
1163356240 19:16813137-16813159 TGGGCTCAGGAGTAGCCATGGGG + Intronic
1165172995 19:33906559-33906581 GGTGCTCAGAAGACCCCAGGCGG + Intergenic
1166157096 19:40921890-40921912 GGAGCTCAAGAGTCTCCAGGGGG + Intergenic
1166166086 19:40989888-40989910 GGAGCTCAAGAGTCTCCAGGGGG + Intergenic
1167148450 19:47695802-47695824 TGAGCTCAGGACAGGAAAGGCGG + Intronic
1167598619 19:50440707-50440729 AGAGGTCAGAAGACCCCAGGAGG + Intronic
1167719303 19:51167773-51167795 TGAGCATCAGAGACGCCAGGAGG + Intergenic
1167721876 19:51185129-51185151 TGAGCATCGGAGACGCCAGGAGG + Intergenic
1167725699 19:51211478-51211500 TGAGCATCGTAGACGCCAGGAGG + Intergenic
1167727368 19:51225488-51225510 TGAGCATCGTAGACGCCAGGAGG + Exonic
1167732479 19:51268707-51268729 TGAGCTGAGGAGAGTCCAGGGGG - Exonic
925903071 2:8522509-8522531 TGGGCCCAGGAGACCCAAGGAGG - Intergenic
926055148 2:9769988-9770010 AGAGGTCAGGTGATGCCAGGAGG - Intergenic
926843105 2:17105018-17105040 AGACCTCAGGAGAGGTCAGGGGG + Intergenic
933556475 2:83836626-83836648 TGAGCTGAGATGGCGCCAGGAGG + Intergenic
937086841 2:119177555-119177577 GGAGGTCAGGAGACGCTGGGAGG - Intergenic
939790136 2:146562143-146562165 TGAGCTAAGGAAATCCCAGGAGG - Intergenic
940806656 2:158194952-158194974 TGAGCTCAGGAGTAACCAGCAGG - Intronic
941704538 2:168643962-168643984 AGAGATCAGGAGACACCAGTAGG - Intronic
942152150 2:173087269-173087291 TGTGCTCAGGAGACTCAAAGAGG + Intronic
942605435 2:177685646-177685668 TGAACCCAGGAGAACCCAGGAGG - Intronic
948056979 2:235015948-235015970 TGAGCACAGGGGACCCCACGAGG - Intronic
1169896855 20:10513587-10513609 TGAGGGCAGAAGATGCCAGGTGG + Intronic
1170592772 20:17783521-17783543 TGAGATCTGGTGAGGCCAGGAGG - Intergenic
1172977697 20:38919069-38919091 TGGGCTCAGGGGAAGCAAGGGGG + Exonic
1173371602 20:42441391-42441413 TGAGCTTGGGAAATGCCAGGAGG + Intronic
1175466048 20:59191868-59191890 GGAGCCCAGGTGACGCCATGGGG - Exonic
1175800654 20:61799536-61799558 TGTGGTCTGGAGAGGCCAGGGGG + Intronic
1176244274 20:64089955-64089977 TGACCTCAGGAGCCGAGAGGGGG - Intronic
1176290875 21:5043973-5043995 GGAGCCCAGGAGACTCCAGCAGG - Intergenic
1176388906 21:6153657-6153679 TGAGCTCAGGTGAGGCCGGGGGG + Intergenic
1179734566 21:43384591-43384613 TGAGCTCAGGTGAGGCCGGGGGG - Intergenic
1179866380 21:44219668-44219690 GGAGCCCAGGAGACTCCAGCAGG + Intergenic
1180612971 22:17109415-17109437 GGAGGTCAGGAGACGCCATGGGG - Exonic
1181306269 22:21919010-21919032 TGGCCTCAGGAGGTGCCAGGAGG + Intergenic
1181356357 22:22298409-22298431 TGAGCTAGGGAGGCGCCGGGAGG + Intergenic
1181758900 22:25044188-25044210 TGAGGCCAGGAGAGGCCAAGAGG - Intronic
1182185580 22:28398262-28398284 TGTGCTCAGGAGACACAAAGAGG + Intronic
1182375980 22:29848349-29848371 TGAACTCAACAGAGGCCAGGGGG - Intergenic
1182639268 22:31753801-31753823 CGAGGGCAGGAAACGCCAGGAGG + Intergenic
1184086161 22:42266546-42266568 TGATCTCAGGTGAGGTCAGGAGG - Intronic
1184671534 22:46014329-46014351 TGAGGTCACGAGAAGACAGGCGG - Intergenic
1185228295 22:49666155-49666177 TCAGCTCAGTAGACTCCTGGAGG - Intergenic
1185299577 22:50072439-50072461 TCAGGGCAGGAGACCCCAGGAGG - Intronic
950551975 3:13671608-13671630 TGAGGACAGGAGAACCCAGGAGG - Intergenic
950833420 3:15897487-15897509 TAAGTTCAGGAGAACCCAGGTGG - Intergenic
953424258 3:42780162-42780184 TGAGCTCAGGGGATGACAGCGGG + Intronic
954150758 3:48655999-48656021 CGAGGTCAGGAGACCCCGGGCGG + Intronic
955408333 3:58639853-58639875 TGAGCTCAGGAAACGTCAGATGG - Intronic
958636263 3:96750626-96750648 AGAGCTCAGCAGATGACAGGAGG + Intergenic
961034720 3:123634489-123634511 TGTGGTCGGGAGATGCCAGGAGG - Intronic
961116757 3:124336340-124336362 TGAGCACAGGAGAGCACAGGAGG + Intronic
961799112 3:129431066-129431088 TGAGCTCATGAGGGCCCAGGAGG - Exonic
962342173 3:134594944-134594966 GGAGCTCAGGTGAGGTCAGGAGG + Intergenic
962343925 3:134606282-134606304 TGAGCCCAGGAGTAGCCAGGTGG - Intronic
967055089 3:185824279-185824301 GCGGCTCAGGAGACGCCAGAGGG + Intronic
968653222 4:1768010-1768032 TGAGCTCAGGAAACTCCCGCTGG - Intergenic
969666605 4:8560978-8561000 TGAGAGCAGGAGGCCCCAGGAGG - Intronic
969837821 4:9857771-9857793 TGATCCCAGGAGACATCAGGAGG - Intronic
978932793 4:114336534-114336556 TGAGCCCAGTTGACACCAGGAGG + Intergenic
985150859 4:186945743-186945765 TCAGCTGAGGAGAGGCCTGGGGG + Intergenic
985705620 5:1399968-1399990 TGAGCTCATGAGACCCCTGCTGG + Intronic
986315075 5:6581789-6581811 TGACCTCAGGAGACACCCGACGG - Intergenic
990041649 5:51383959-51383981 AGAGCTCAGGATTCCCCAGGAGG - Intronic
991065706 5:62422501-62422523 TCAGCTAAGGAGACACCAGAGGG + Intronic
993902137 5:93591659-93591681 TGAGCTGAGGGGATGCCAGATGG + Intronic
993981190 5:94545354-94545376 TGACCTAAGGAGACACCAGCTGG + Intronic
997381889 5:133444316-133444338 TGGGCCCTGGAGAAGCCAGGTGG - Intronic
999016125 5:148107526-148107548 GGAGCTAAGGAGAAGCCAGCTGG + Intronic
1002911154 6:1491746-1491768 TGAGCACAGGAGACACCAAATGG + Intergenic
1003869083 6:10387652-10387674 TTAGCTCAGGTAAAGCCAGGGGG - Intergenic
1006913294 6:37578258-37578280 TCAGCTCTGCAGACGCCTGGGGG + Intergenic
1010771167 6:79832625-79832647 TGGGCTCAAGTGACCCCAGGAGG - Intergenic
1012838526 6:104299877-104299899 TGTGCTCAGGGGCTGCCAGGAGG + Intergenic
1017387313 6:153901177-153901199 TGACCTAAGGAGACACCAGCAGG + Intergenic
1019496134 7:1341450-1341472 GGAGCTGTGGACACGCCAGGTGG - Intergenic
1024019157 7:45349342-45349364 TGAGCTCAGGAGAGGCTCTGAGG + Intergenic
1027155617 7:75765332-75765354 TGATCTCAGGAGACACCACTAGG - Intergenic
1029640273 7:101815962-101815984 GGAGTTCAGGAGCCGCCAGGAGG - Intronic
1032085571 7:128881683-128881705 TGAGCTCAGGACAAGCCTGGTGG + Exonic
1033501045 7:141950066-141950088 TGAGCTGAGGAGAAAGCAGGAGG - Intronic
1033619928 7:143052806-143052828 TGAGCTCGGGAGAGGACAGTGGG - Exonic
1034804121 7:154073392-154073414 GGAGCAAAGGAGACGACAGGAGG - Intronic
1039397558 8:37240164-37240186 TGAGCTCAGGTGCAGTCAGGTGG + Intergenic
1039800141 8:40947155-40947177 TGAGCTATGGAGAGGCAAGGAGG + Intergenic
1040389523 8:46937836-46937858 TGAGCTTAGGTGAGGCCAGTAGG + Intergenic
1040483776 8:47851538-47851560 GAGGCTCAGGAGAAGCCAGGTGG - Intronic
1040549308 8:48426440-48426462 TGAGCTCTGGAGATGGCTGGTGG + Intergenic
1044182907 8:89218039-89218061 TGGGCTGAGGAGAGACCAGGAGG + Intergenic
1047551500 8:125877704-125877726 TGAACTCAGGAAACACCATGGGG - Intergenic
1048327455 8:133450495-133450517 TGAGCTGAGGCGAAGGCAGGAGG - Intergenic
1049325899 8:142021288-142021310 TGTCCTCAGGAGCAGCCAGGGGG + Intergenic
1049496374 8:142936057-142936079 TGAGTCCAGGAGACTCCAGCTGG - Intergenic
1049710903 8:144062904-144062926 TGGGGTCAGGAGAGCCCAGGAGG - Intronic
1049777514 8:144413499-144413521 TGAGCCCAGGTGAGCCCAGGGGG - Exonic
1049954843 9:683051-683073 TGATCTCAGAAAACACCAGGTGG - Intronic
1053368644 9:37542150-37542172 TGGGCTCAGGAGATGGCAGGGGG - Intronic
1056306833 9:85298897-85298919 TGATCTCAGGAAACACCAGCAGG + Intergenic
1056836341 9:89958587-89958609 TGAACTCATGTGAAGCCAGGTGG - Intergenic
1057538379 9:95940031-95940053 TGGTGTCAGGGGACGCCAGGTGG - Intronic
1059267442 9:113048788-113048810 TGAACTCAGGAGTGGCCAGATGG + Intronic
1062342239 9:136098907-136098929 TGGGCTGAGAAGACCCCAGGAGG + Intergenic
1062351632 9:136142502-136142524 CGAGCTCAGGAGAAGCCCGCAGG + Intergenic
1202802917 9_KI270720v1_random:18256-18278 TGTGCTCAGGAGAAGCTTGGAGG + Intergenic
1188946850 X:36315882-36315904 TGACCTCAGGAAATGCCAGTAGG - Intronic
1191995706 X:67093158-67093180 AGGGCTCAGGAGAAGACAGGAGG + Intergenic
1193219727 X:78910178-78910200 TGACCTAATGAGACACCAGGAGG - Intergenic
1195366430 X:104131011-104131033 TGACCTCAGTAGATGCCACGTGG - Intronic
1200064167 X:153496921-153496943 GAAGCACAGGAGACGGCAGGTGG - Intronic