ID: 1091107098

View in Genome Browser
Species Human (GRCh38)
Location 11:132932938-132932960
Sequence CTCATTTTGAATCCCAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091107098_1091107100 20 Left 1091107098 11:132932938-132932960 CCAGAGTTGGGATTCAAAATGAG 0: 1
1: 0
2: 3
3: 21
4: 178
Right 1091107100 11:132932981-132933003 TGTTCTTAACCTCTTGATAGAGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091107098 Original CRISPR CTCATTTTGAATCCCAACTC TGG (reversed) Intronic
902177332 1:14660597-14660619 CTGGGTTTGAATCCCAGCTCTGG - Intronic
903292521 1:22323711-22323733 CTGGTTTTGGACCCCAACTCTGG + Intergenic
903305414 1:22409410-22409432 CTCAGTTTTAATCTCAGCTCTGG + Intergenic
903494152 1:23753229-23753251 TTGGGTTTGAATCCCAACTCTGG + Intronic
904351429 1:29909644-29909666 CTCATTTTGATTCCTAATTCTGG + Intergenic
905127999 1:35729419-35729441 CCCATTATGAATCCCACCACAGG + Intronic
907816618 1:57924364-57924386 CTGATTAAGAATTCCAACTCTGG + Intronic
908967366 1:69782005-69782027 CTGATTTTGAATCTTAGCTCTGG + Intronic
909694324 1:78448862-78448884 GTTAGTTTAAATCCCAACTCTGG + Intronic
910694477 1:89996797-89996819 TTTATTTTCACTCCCAACTCTGG - Intronic
914312659 1:146480439-146480461 CTCATTTTAATGCCTAACTCTGG + Intergenic
914501689 1:148252899-148252921 CTCATTTTAATGCCTAACTCTGG - Intergenic
917784156 1:178434435-178434457 CTCATTTTGAGTGACAACTCAGG + Intronic
918015327 1:180628109-180628131 CTGAATTAAAATCCCAACTCTGG - Intergenic
918914508 1:190617160-190617182 CTCATCTTGAATCCCACATGTGG - Intergenic
919134118 1:193487571-193487593 CTCAGTCTAAATCCCAGCTCTGG - Intergenic
920797832 1:209157864-209157886 CACATTTAAAATCCAAACTCAGG - Intergenic
921667441 1:217889648-217889670 CGGGGTTTGAATCCCAACTCTGG + Intergenic
1065441206 10:25755438-25755460 CTGAGTTTGAATCCCAACTCAGG - Intergenic
1065484419 10:26223197-26223219 CTTATTTTAAATCACAACTATGG + Intronic
1065733942 10:28734398-28734420 CTGAGTTTGAATCCCATTTCTGG - Intergenic
1067211654 10:44264641-44264663 CTCCTTTTGACTCGCACCTCTGG - Intergenic
1068920323 10:62476337-62476359 ATCAGTTAGAATCCCAACTGTGG - Intronic
1070245424 10:74726935-74726957 CTCACTTGTAATCCCAACGCTGG + Intergenic
1071390039 10:85164467-85164489 GTCATTTTGAATGAGAACTCAGG + Intergenic
1072440755 10:95452898-95452920 CTCAATTTGAATCCAAACTTTGG + Intronic
1072553096 10:96494023-96494045 CTCACCTTGAATCCCAATGCTGG - Intronic
1076447287 10:130525288-130525310 CTCCTCTTGAATGCCATCTCTGG - Intergenic
1076490685 10:130859282-130859304 CTGACTTCAAATCCCAACTCAGG + Intergenic
1077616159 11:3675618-3675640 CCCATTTTGTTTCCTAACTCAGG + Exonic
1077747027 11:4918190-4918212 CTAAGTTTGAATTCCAGCTCCGG - Intronic
1078921349 11:15833589-15833611 TTGGTTTTGAATCCCAACCCTGG + Intergenic
1079491217 11:20991002-20991024 CTGATCTTGAAAACCAACTCTGG + Intronic
1080545445 11:33312938-33312960 CTAAATTCAAATCCCAACTCTGG - Intronic
1080877492 11:36289791-36289813 CTCATTTTCATTCCAAACACTGG - Intergenic
1081826218 11:46055445-46055467 CTCATTCTGAATGCCAGTTCTGG - Intronic
1082011085 11:47449881-47449903 CTCACTTCCAATCCCAACCCCGG + Intergenic
1083583139 11:63838161-63838183 GTCATTTTGAATGTCAACGCAGG + Intergenic
1083644458 11:64164646-64164668 ATCATTTTGATTTCCACCTCTGG + Intronic
1084440660 11:69170957-69170979 CTCCTTTTGAACTCCAACTCTGG - Intergenic
1085143997 11:74175963-74175985 CTAAGTTTGAAGCCCAACTTAGG + Intronic
1085757057 11:79210592-79210614 TGCAGTTTGAATCCCAGCTCTGG + Intronic
1087394875 11:97584721-97584743 ACAATTTTGAATCCCAACTGAGG + Intergenic
1087439066 11:98159647-98159669 ATCATTTTGAATCACAAATGAGG + Intergenic
1090488884 11:127140330-127140352 CTGATTTTCAAACCCAAGTCAGG + Intergenic
1090503333 11:127283243-127283265 CTCACTTTGAATCACATATCAGG - Intergenic
1090521125 11:127480437-127480459 GACATTTTGAGTCCCAACTAGGG + Intergenic
1090667102 11:128921800-128921822 CTCATTTTGAATCAGAGCCCTGG - Intergenic
1091107098 11:132932938-132932960 CTCATTTTGAATCCCAACTCTGG - Intronic
1091528375 12:1329437-1329459 CTCACTTTGCATCCCAAATAGGG - Intronic
1092650884 12:10633796-10633818 CACGTGTTGAATTCCAACTCGGG + Intronic
1094127006 12:27034004-27034026 CTCTTTTTGAATCTCAACTTTGG - Intronic
1096750007 12:53752426-53752448 CTAAGTTTGAATCCCAGCCCTGG + Intergenic
1097413656 12:59286657-59286679 CTCATTTTGAATCTCATGACTGG + Intergenic
1098194338 12:67983824-67983846 CTGATTTTAAAGGCCAACTCTGG + Intergenic
1101808044 12:108082052-108082074 CTTATTTTGCATCCCAAGACTGG + Intergenic
1102563407 12:113778895-113778917 CTCAGTTTGAATCCCGTCCCAGG - Intergenic
1107352224 13:39527585-39527607 CTCAGTTTGATTCCCATATCAGG - Intronic
1108008560 13:45978443-45978465 CTGAGTTTGAATTCCAGCTCTGG + Intronic
1109447562 13:62462692-62462714 CTCAGTTTGGTTGCCAACTCAGG + Intergenic
1109761093 13:66829865-66829887 CTATTTTTGAATCCAAACTTTGG - Intronic
1110923207 13:81115174-81115196 CTCAATTTGACTTTCAACTCTGG - Intergenic
1113385670 13:109845532-109845554 CTGAGTTTGAATTGCAACTCTGG - Intergenic
1114408160 14:22475592-22475614 GTCATTTTTCATCCCACCTCTGG - Intergenic
1115842000 14:37482711-37482733 CTCATCTTGAATTGCAATTCAGG - Intronic
1117673512 14:58132417-58132439 CTGAATTTGAATCGCAACTTTGG - Intronic
1118582719 14:67319402-67319424 CTCATTTTGATTCATGACTCTGG + Intronic
1121275366 14:92663768-92663790 CTGGTTTTGAATCCCAGCTTCGG + Intronic
1122604584 14:102939689-102939711 ATCATTTTGGATCTCAATTCTGG + Exonic
1125223458 15:37367427-37367449 CTCATCTTGAATTGCAACTCCGG - Intergenic
1125898667 15:43325148-43325170 CTTATTTTGAATCTCCACTCTGG - Exonic
1126384231 15:48077273-48077295 CTCTTTTTGAAATCAAACTCTGG + Intergenic
1127463834 15:59224992-59225014 CAAATTTTGATTCCTAACTCTGG + Intronic
1130097898 15:80869895-80869917 CTGGGTTTGAATTCCAACTCTGG - Intronic
1130816814 15:87444776-87444798 GTCATTTTGAATCTCAAGTCTGG + Intergenic
1135653798 16:24229915-24229937 CACACTCTGATTCCCAACTCTGG - Intergenic
1136015813 16:27400141-27400163 CTGAGTTCAAATCCCAACTCTGG + Intergenic
1136247163 16:28982631-28982653 CTGGTTTTGAATCACAGCTCTGG + Intronic
1136574008 16:31112552-31112574 CACATTTTGAATGCCCTCTCGGG + Exonic
1140224197 16:73065629-73065651 CTCATTTTAAATCCCATTACTGG - Intergenic
1140901393 16:79371250-79371272 CTTATTTTGAAACACTACTCTGG - Intergenic
1140988754 16:80187412-80187434 CTCCTTTTGAGTCCTTACTCAGG + Intergenic
1141518991 16:84565017-84565039 CTCAGTTCAAATCCCAGCTCTGG + Intergenic
1142159449 16:88549249-88549271 CTCATTTTGAAACCCAAGCTTGG - Intergenic
1143283595 17:5772828-5772850 CTCTTTCTGAATCCCAGCTAGGG + Intronic
1143659093 17:8313697-8313719 CTTGTTTCGAATCCCAGCTCTGG + Intronic
1146830870 17:36068482-36068504 CTCATTTAGAATCTCAAAGCTGG - Intronic
1147021947 17:37541791-37541813 CTGATTTTGACTCCCGTCTCAGG + Intronic
1147029643 17:37622051-37622073 CTCATTATTTATCCTAACTCTGG + Intronic
1149519152 17:57305150-57305172 CTCATTCTGAATCCCAACTGAGG - Intronic
1149563109 17:57623463-57623485 CTCATTTTGAGTCCCCATTTTGG - Intronic
1149812493 17:59691093-59691115 CTCATTTTAAATTCTAACTGGGG + Intronic
1150591352 17:66565446-66565468 CTGAATTTTAATCCCAGCTCTGG + Intronic
1152094303 17:78264048-78264070 CTGGGTTTGAATCCCATCTCTGG - Intergenic
1153220160 18:2854101-2854123 TTCACTTTGCCTCCCAACTCAGG + Intronic
1155390390 18:25329581-25329603 CCCATTTTGAATAGCAACACAGG - Intronic
1156904828 18:42340175-42340197 TTATTTCTGAATCCCAACTCAGG - Intergenic
1158487368 18:57879500-57879522 CTCATTTTCAAACTCTACTCAGG - Intergenic
1158831627 18:61285740-61285762 TCCAGTTTGAATCCCAGCTCTGG + Intergenic
1160087503 18:75790379-75790401 TTCACTTTGTCTCCCAACTCAGG - Intergenic
1162062338 19:8103787-8103809 CTGATTTTGAAACCAAACTTAGG - Intronic
1162435544 19:10655685-10655707 CTAAATTTGAATCCTAACTTCGG - Intronic
1164233284 19:23310018-23310040 CTCATTTCTAAACCCAGCTCTGG + Intronic
1164303749 19:23985252-23985274 CTCATTTCTAAACCCAGCTCTGG - Intergenic
1167755097 19:51407805-51407827 CTGAGTTTGAATCCCAGCTCTGG + Intergenic
928125819 2:28615064-28615086 CTCAGTTTAAATCTCACCTCAGG - Intronic
928727136 2:34187417-34187439 CTCAGTTTGAATCCCTTGTCTGG + Intergenic
931325298 2:61215886-61215908 CTGGATTTGAATCCCAGCTCTGG - Intronic
931922139 2:67031871-67031893 TTTATTTTCAAACCCAACTCTGG - Intergenic
934121719 2:88846618-88846640 CTCATTTTGAATCCTGATTTGGG + Intergenic
936645109 2:114359655-114359677 ATCACTTTGGATCCCAATTCTGG + Intergenic
938631052 2:133168152-133168174 CTGAGTTGGAATCCCAGCTCTGG - Intronic
939030367 2:137067657-137067679 CCTATTTTCACTCCCAACTCAGG + Intronic
941147848 2:161874749-161874771 GAGATCTTGAATCCCAACTCTGG + Intronic
941381690 2:164801035-164801057 CACATCTGGAATCCCAACTCTGG + Intronic
941454284 2:165696657-165696679 CTTCTTTTGAATCCCAAATCTGG - Intergenic
943459288 2:188150906-188150928 TGCATTTTGAATCAGAACTCTGG - Intergenic
944591687 2:201223587-201223609 CTCATTTTCATTCTAAACTCCGG + Intronic
945635014 2:212338051-212338073 CTGATCTTGAATCCCAATCCAGG + Intronic
947503922 2:230692446-230692468 CACAGTTTGCATCCCAATTCTGG + Intergenic
1169688967 20:8308885-8308907 TTCATTTTGAATCCCAGATAGGG + Intronic
1172116026 20:32574139-32574161 CTGCATTTGGATCCCAACTCTGG - Intronic
1174627959 20:51930940-51930962 CTCAGTTCAAATCCCACCTCAGG + Intergenic
1174927229 20:54773700-54773722 CTCATCTGGAATCTCAACTATGG + Intergenic
1178688602 21:34731742-34731764 GTCATTTTGAGTCCCAGTTCAGG - Intergenic
1183878375 22:40804118-40804140 CTCACTTTCAATCCCAATTCGGG + Intronic
1184767345 22:46578509-46578531 CCCATTTTGAACCCCAACCCAGG - Intronic
949842752 3:8337945-8337967 CTGAGTTTGAATCCTAACCCAGG - Intergenic
951277540 3:20707038-20707060 CCCATATTCAATCCCAACCCAGG + Intergenic
951793044 3:26507488-26507510 CTCATATAGAATACCAACTTTGG - Intergenic
953199607 3:40767183-40767205 CTGATTTTAAATCCAAACTAAGG - Intergenic
955400071 3:58585301-58585323 CTGATTTCCAATCCCAGCTCCGG - Intronic
956161954 3:66364511-66364533 CTCTTTTTGCTCCCCAACTCAGG + Intronic
957867844 3:86047802-86047824 CACATTTCGAGTCCCAAATCTGG + Intronic
959219270 3:103495264-103495286 CTCATTTTGTAACCAAAATCTGG + Intergenic
960589891 3:119355162-119355184 CTGGGTTTGGATCCCAACTCTGG + Intronic
960954749 3:123024311-123024333 CTCTTTTTAGATCCCCACTCAGG + Intronic
964241610 3:154601240-154601262 CTCATATAGAGTCCCAACTGGGG - Intergenic
964705161 3:159610488-159610510 CTCACTTTGAATGCCAAATGTGG + Intronic
964956786 3:162368997-162369019 TGCATTTTGAAGCACAACTCTGG - Intergenic
965162767 3:165155939-165155961 CTGATTTTGAATCCTAACTCTGG + Intergenic
965347888 3:167574896-167574918 CTCATTTTGAATTCCATCTGCGG - Intronic
965614830 3:170584027-170584049 CTGATTTTGAATCCAATCTCTGG + Intronic
967417587 3:189235846-189235868 CTCATTTTGAAGACAAACTAAGG - Intronic
969877150 4:10144181-10144203 CTCAATTTGAATCCCACATTAGG + Intergenic
973077579 4:45948492-45948514 CTCATTTTTAATCAAAAGTCAGG - Intergenic
976032260 4:80770710-80770732 CTCATTTGGAATCATAACTAAGG + Intronic
977227565 4:94411469-94411491 CTACTTCTGAATTCCAACTCAGG - Intergenic
978293122 4:107169969-107169991 TTGATTTTGAATGCCCACTCTGG - Intronic
981809258 4:148754613-148754635 ATCATTTTAAATCTCAGCTCAGG - Intergenic
983151912 4:164294472-164294494 CCCATTTGCTATCCCAACTCTGG + Intronic
986208312 5:5646799-5646821 CTCAGTTTGAATCCTAAATCTGG + Intergenic
987513502 5:18874466-18874488 CTCATCTTTATTACCAACTCTGG - Intergenic
987715280 5:21560609-21560631 CTAATTTTGAAACACAACTGAGG + Intergenic
990476564 5:56166687-56166709 CTCAATTTGTGTCCCACCTCTGG - Intronic
990720033 5:58684434-58684456 CTCAGTTGGAATGCCAACTTAGG + Intronic
992644581 5:78799995-78800017 CTCATTCAGAAAGCCAACTCTGG - Intronic
993535289 5:89076720-89076742 CTGAGTTGGAATCCAAACTCAGG + Intergenic
996503172 5:124239225-124239247 CTGTGTTTGAATCCCAGCTCTGG + Intergenic
996715805 5:126587152-126587174 CTCATTTTCCCTCCCATCTCTGG - Intronic
996894464 5:128463505-128463527 ATCATTTTGAATCCGAACTACGG - Intronic
997284364 5:132667805-132667827 CTGGTTCTGAATCCCAGCTCTGG - Intergenic
999845270 5:155472413-155472435 CTCATTTTGATTTCCAAATGGGG + Intergenic
1001718102 5:173833799-173833821 CTCAGTTTGAATCGCTACACGGG + Intergenic
1002004314 5:176219695-176219717 CTCAATTCAAGTCCCAACTCCGG + Intergenic
1002592390 5:180299695-180299717 CTCCTCTAAAATCCCAACTCTGG - Intergenic
1006825979 6:36936794-36936816 CTCATTACAAATCCCAGCTCTGG + Intergenic
1008167375 6:48154975-48154997 ATCATTTTGATACCCAAATCTGG + Intergenic
1008676758 6:53827269-53827291 TTCATTTTAAGTTCCAACTCAGG - Intronic
1009001438 6:57721436-57721458 CTAATTTTGAAACACAACTGAGG - Intergenic
1009938480 6:70261243-70261265 GGCATTCTGAATTCCAACTCGGG + Intronic
1010086684 6:71926980-71927002 CTCACTTTGGATCCAGACTCAGG - Intronic
1012058513 6:94446645-94446667 CTTATTTTCCACCCCAACTCAGG + Intergenic
1014536876 6:122624731-122624753 CTGAATTTGAATCCCAGCTCTGG + Intronic
1015529968 6:134211924-134211946 CTCAGTATGAATCCCTTCTCAGG + Intronic
1016031118 6:139339349-139339371 CTCCTTTTGAACCCCAGCGCTGG - Intergenic
1019548173 7:1588460-1588482 CTGAGTTTGAATCACACCTCAGG - Intergenic
1022055040 7:26721870-26721892 CTCATTTTGAATCTCAAAAGGGG - Intronic
1023693976 7:42825727-42825749 CTCATGGTGGATGCCAACTCAGG + Intergenic
1032967321 7:137114172-137114194 CTCATTTTAAATCCCACATACGG - Intergenic
1033383523 7:140847804-140847826 CCATGTTTGAATCCCAACTCTGG - Intronic
1037175430 8:15941381-15941403 TAAATCTTGAATCCCAACTCAGG - Intergenic
1037573628 8:20179975-20179997 CAGGGTTTGAATCCCAACTCTGG + Intronic
1039003005 8:33002420-33002442 TTCCTTTGGAATCCCTACTCTGG - Intergenic
1039286110 8:36042509-36042531 CTTAGTTTGAATCCCAGCTCTGG - Intergenic
1041831572 8:62161160-62161182 CTCAGTTTAAATCCCAGCTCGGG - Intergenic
1043855517 8:85260866-85260888 CTCATTTTCCTTACCAACTCAGG + Intronic
1045418312 8:101988991-101989013 CTCCTTTTCAATCCTGACTCAGG - Intronic
1045749214 8:105461663-105461685 CTCTTTTTCATTCCCATCTCTGG + Intronic
1046350026 8:112996973-112996995 CTGATTATGAATCCCTACTTCGG + Intronic
1046374881 8:113364175-113364197 CTCTTTTTAAAAGCCAACTCTGG - Intronic
1047259854 8:123245856-123245878 CTGGTTTTGAATTCCACCTCAGG + Intronic
1051595688 9:18822525-18822547 CTCAGTTTGAATCCCCACCCTGG + Intronic
1056045277 9:82708368-82708390 CTTGGTTTGAATCACAACTCTGG - Intergenic
1058672286 9:107369902-107369924 CTCATTTGGACTTCCATCTCTGG + Intergenic
1058848126 9:108982189-108982211 CTAGTTTCAAATCCCAACTCTGG + Intronic
1185818966 X:3183566-3183588 CTCATTTTGAATTGTAGCTCCGG + Intergenic
1186079458 X:5914297-5914319 CTCATTTTGAATTACATCACAGG + Intronic
1194528686 X:95015501-95015523 TTCATTTTGAATCCTGGCTCTGG + Intergenic
1195385147 X:104306942-104306964 CTGATTTTGAATCCGAAATGAGG - Intergenic
1197674186 X:129312181-129312203 CTGGGTTTGAATCCCACCTCTGG + Intergenic
1197719727 X:129737097-129737119 CTGAGTTTCAATCCCAGCTCTGG - Intergenic
1197820663 X:130537951-130537973 CCCAATTTAATTCCCAACTCAGG + Intergenic