ID: 1091108416

View in Genome Browser
Species Human (GRCh38)
Location 11:132943743-132943765
Sequence CCAGCCGGGGGAGCGCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091108403_1091108416 20 Left 1091108403 11:132943700-132943722 CCGGTCGGTGGCCGTCCTCTGCA 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1091108416 11:132943743-132943765 CCAGCCGGGGGAGCGCCGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 188
1091108409_1091108416 -4 Left 1091108409 11:132943724-132943746 CCCGGTCGGCGACTCGCGGCCAG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1091108416 11:132943743-132943765 CCAGCCGGGGGAGCGCCGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 188
1091108402_1091108416 30 Left 1091108402 11:132943690-132943712 CCAGGGTCGTCCGGTCGGTGGCC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1091108416 11:132943743-132943765 CCAGCCGGGGGAGCGCCGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 188
1091108410_1091108416 -5 Left 1091108410 11:132943725-132943747 CCGGTCGGCGACTCGCGGCCAGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1091108416 11:132943743-132943765 CCAGCCGGGGGAGCGCCGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 188
1091108406_1091108416 9 Left 1091108406 11:132943711-132943733 CCGTCCTCTGCAGCCCGGTCGGC 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1091108416 11:132943743-132943765 CCAGCCGGGGGAGCGCCGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 188
1091108407_1091108416 5 Left 1091108407 11:132943715-132943737 CCTCTGCAGCCCGGTCGGCGACT 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1091108416 11:132943743-132943765 CCAGCCGGGGGAGCGCCGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091108416 Original CRISPR CCAGCCGGGGGAGCGCCGCC CGG Intronic