ID: 1091109631

View in Genome Browser
Species Human (GRCh38)
Location 11:132953744-132953766
Sequence GCAGGTCCAGATTTAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091109631_1091109633 -8 Left 1091109631 11:132953744-132953766 CCAGGCTCTAAATCTGGACCTGC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1091109633 11:132953759-132953781 GGACCTGCCCCCTGAGAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 210
1091109631_1091109645 29 Left 1091109631 11:132953744-132953766 CCAGGCTCTAAATCTGGACCTGC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1091109645 11:132953796-132953818 GACCAAGCTTCTCTGAGCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 226
1091109631_1091109632 -9 Left 1091109631 11:132953744-132953766 CCAGGCTCTAAATCTGGACCTGC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1091109632 11:132953758-132953780 TGGACCTGCCCCCTGAGAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 214
1091109631_1091109635 -6 Left 1091109631 11:132953744-132953766 CCAGGCTCTAAATCTGGACCTGC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1091109635 11:132953761-132953783 ACCTGCCCCCTGAGAGCTGGGGG 0: 1
1: 0
2: 1
3: 31
4: 286
1091109631_1091109641 7 Left 1091109631 11:132953744-132953766 CCAGGCTCTAAATCTGGACCTGC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1091109641 11:132953774-132953796 GAGCTGGGGGTCCCCAGCAATGG 0: 1
1: 0
2: 3
3: 31
4: 245
1091109631_1091109634 -7 Left 1091109631 11:132953744-132953766 CCAGGCTCTAAATCTGGACCTGC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1091109634 11:132953760-132953782 GACCTGCCCCCTGAGAGCTGGGG 0: 1
1: 0
2: 1
3: 25
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091109631 Original CRISPR GCAGGTCCAGATTTAGAGCC TGG (reversed) Intronic
900725836 1:4215950-4215972 GCAGGTCGAGATAGAGAGGCAGG - Intergenic
900725887 1:4216164-4216186 GCAGGTCGAGATAGAGAGGCAGG - Intergenic
902086127 1:13864033-13864055 GAAGGACCAGACTTAGAACCTGG + Intergenic
902228073 1:15009212-15009234 GCACGCCCAGGGTTAGAGCCTGG + Intronic
902839585 1:19066623-19066645 ACAGGACCAGAATTAGATCCAGG - Intergenic
904703850 1:32375874-32375896 GGAGGCCCAGATTCAGACCCAGG - Intronic
907744627 1:57200501-57200523 GCAGGTTCAGATTTGAACCCTGG - Intronic
908376540 1:63547941-63547963 GCAAGTCCAGATTCATAGGCTGG + Intronic
909117696 1:71559899-71559921 GCAGGTCCAAACTAAGATCCTGG - Intronic
910446143 1:87300422-87300444 GCAGCGCCAGATTCAGAACCAGG - Intergenic
912752816 1:112299534-112299556 GCAGGGCCAGATTTAGATAGGGG - Intergenic
913479600 1:119274987-119275009 GCAGGTCCAGGTCTGGAACCTGG - Intergenic
916821542 1:168403630-168403652 GGAGATCCAGATTTAGAGAGTGG + Intergenic
917164495 1:172097104-172097126 GAAGGTGCTGATTTAGGGCCGGG + Intronic
917740674 1:177959272-177959294 GCAGAGCCAGATTTAGATCCAGG - Intronic
918371176 1:183863090-183863112 GCAGGCACAGATTCAGAGGCAGG + Intronic
920854776 1:209653391-209653413 GCAGGTCCAAATTGAGAGGCTGG + Intergenic
1065859484 10:29859464-29859486 GCAGGGCCAGGATTAGAGTCAGG + Intergenic
1068450911 10:57186550-57186572 GCAGATTCATATCTAGAGCCAGG - Intergenic
1068966529 10:62917371-62917393 GCAGGGTCAGGTTAAGAGCCTGG + Intronic
1069710613 10:70486259-70486281 GCAGGTGCAGATCAAGAACCTGG - Intronic
1074010368 10:109472726-109472748 GCAGGTAAAGATTTAGAGAGGGG + Intergenic
1075006612 10:118835215-118835237 GCAGTTCCAGATCCAAAGCCAGG + Intergenic
1075621252 10:123929759-123929781 GCAGGTCCTGTCTTAGAGCGGGG + Intronic
1076555268 10:131317466-131317488 TCAGGTCCAGATTGAGCCCCTGG + Intergenic
1078251495 11:9620271-9620293 ACAGATCCAGATTTAGACCCAGG + Intergenic
1079316042 11:19408758-19408780 GCAGAGCCAGAATTCGAGCCTGG + Intronic
1080396246 11:31892901-31892923 TCAGATTCAGATGTAGAGCCAGG - Intronic
1083949757 11:65947464-65947486 GCAGGTCCAGCTGCAAAGCCTGG + Exonic
1085408936 11:76280392-76280414 GCTGGACCTGATTTAGAGGCAGG - Intergenic
1085453659 11:76654105-76654127 GGAGGTCCAGATTTTGTGCTCGG - Intergenic
1086065247 11:82736869-82736891 GCAGGGCCAGAATTTGAACCTGG - Intergenic
1087155383 11:94896729-94896751 GGAGAACCAGATTTACAGCCGGG - Intergenic
1087584318 11:100098993-100099015 GCAGGTCCAGATTAAAGGGCGGG + Intronic
1089713807 11:120336784-120336806 GCAGCCCCAGATAGAGAGCCGGG + Intergenic
1091109631 11:132953744-132953766 GCAGGTCCAGATTTAGAGCCTGG - Intronic
1091990060 12:4947937-4947959 GCAGGCACAGATTTAGGGACTGG - Intergenic
1094061912 12:26323269-26323291 GAAGGTCCAGATTTGCATCCTGG - Intergenic
1094674892 12:32610160-32610182 GAAGGGCCAGATTTAAACCCAGG - Intronic
1097568921 12:61307542-61307564 GCAGGTCCAGAGATACTGCCTGG + Intergenic
1103455408 12:121061253-121061275 GAATGTCCAGATTTCCAGCCTGG + Intergenic
1103546873 12:121708481-121708503 GCAGTTCCAGCATTAGACCCTGG + Intergenic
1104754672 12:131261710-131261732 GCAGGGCCTGAATTAGGGCCAGG - Intergenic
1105947652 13:25203180-25203202 GCAGGTTCAGTCTTAGAGGCTGG + Intergenic
1107164942 13:37272949-37272971 GCAAGTCTATTTTTAGAGCCTGG + Intergenic
1113922513 13:113921301-113921323 GCAGGACCAGATGTGGACCCTGG + Intergenic
1114413656 14:22524230-22524252 GCAGAGCTAGATTAAGAGCCTGG + Intergenic
1117027310 14:51634755-51634777 GCAGGGCCAGAGTTCAAGCCTGG - Intronic
1117161364 14:52993803-52993825 ACAGGTCCAGATATACTGCCTGG + Intergenic
1117890612 14:60417887-60417909 GCTGGGACAGACTTAGAGCCTGG - Intronic
1120648761 14:87105359-87105381 GCAGGCCAAGATTCAAAGCCAGG + Intergenic
1121091619 14:91186944-91186966 ACAGTTCCTGATTTAGAACCAGG - Intronic
1122221185 14:100239868-100239890 GCAGGTGCAGATCAAGACCCTGG + Exonic
1123737159 15:23196384-23196406 GCACGTCCAGATTTAGGGAAGGG + Intergenic
1124288373 15:28425049-28425071 GCACGTCCAGATTTAGGGAAGGG + Intergenic
1124294851 15:28492265-28492287 GCACGTCCAGATTTAGGGAAGGG - Intergenic
1127382118 15:58439014-58439036 GCAGGTTCATATTCAGGGCCTGG + Intronic
1128249588 15:66155126-66155148 GCAGGTCCTGAATGAGACCCTGG + Intronic
1128781747 15:70362951-70362973 GCAGGTCCAGATTCAAAGACAGG + Intergenic
1128815772 15:70607040-70607062 GCAGGTGCAGATTTGGAGGCTGG + Intergenic
1129237221 15:74230885-74230907 GCAGAACCAGGGTTAGAGCCAGG + Intergenic
1131121547 15:89826141-89826163 TCAGGTCCAGAATGGGAGCCAGG - Intergenic
1138115283 16:54356213-54356235 GCAGAAGCAGATTTAGATCCAGG + Intergenic
1138203607 16:55108034-55108056 ACAGCTCCAAAGTTAGAGCCAGG - Intergenic
1138242291 16:55436650-55436672 GCAGGTCCAGATGTCCATCCAGG - Intronic
1139314300 16:66055490-66055512 GCAGCCCCAGATGTAGAGCAGGG - Intergenic
1139779083 16:69335919-69335941 GCAGGTGAAGATGGAGAGCCAGG - Intronic
1141282108 16:82638231-82638253 GCTGGAGCAGAATTAGAGCCTGG + Intronic
1141310670 16:82910776-82910798 GGAGGTGCAGATTTAGAGAATGG + Intronic
1144835756 17:18155929-18155951 GCAAATCTAGATTTAGAGCTTGG + Intronic
1147870811 17:43586179-43586201 GCTGGCCCAGATTTAGAGTGAGG + Intergenic
1147959108 17:44155342-44155364 CCTGGTCCATATTTACAGCCCGG + Exonic
1148726776 17:49797842-49797864 GCAATTCCTGATTTAGAGTCTGG + Intronic
1153327203 18:3832955-3832977 GCAGGTCAAAATTTACATCCAGG - Intronic
1156828753 18:41465590-41465612 GCAGGGCCTGATTTAGAACTAGG - Intergenic
1159511179 18:69400600-69400622 GCGAGTGGAGATTTAGAGCCCGG + Intergenic
1160098079 18:75894122-75894144 GCAGGTCCAGAGGCAGAGCTGGG - Intergenic
1164625197 19:29723258-29723280 GCAGTTCCAGACTCTGAGCCTGG - Intergenic
1164752615 19:30667973-30667995 GCAGGGCTAGATTTGAAGCCAGG + Intronic
1165223762 19:34339369-34339391 GCAGATACAGATTAACAGCCAGG + Intronic
1168596622 19:57682757-57682779 CCTGGTCCAGTTTTGGAGCCAGG - Intronic
925639587 2:5974659-5974681 GCAGGACCAGAGATTGAGCCTGG - Intergenic
929424369 2:41828998-41829020 GCAGAGCCAGAATTTGAGCCCGG - Intergenic
932436219 2:71703898-71703920 CCAGGTCCACATCTAGAGCTGGG + Intergenic
933733592 2:85477160-85477182 GCTGGTGCCGATTTAGGGCCTGG + Intergenic
935914074 2:107929992-107930014 TCAGGTCCAGGTTTTGAGTCTGG - Intergenic
936974777 2:118207962-118207984 GCAGGTCCTGATTGAGGGCTGGG - Intergenic
937305035 2:120865871-120865893 CCAGGTCCAGAGAGAGAGCCTGG - Intronic
944453656 2:199871254-199871276 GCAGGAGGAGATTTTGAGCCCGG + Intergenic
946187063 2:217987119-217987141 GCAGGGCCAGAAGTAGAGCCTGG + Intronic
1170777547 20:19390842-19390864 GCAGGTGCAGATTTGTAGCTCGG + Intronic
1170906045 20:20515973-20515995 GCAGCACCAGGTTTAGATCCAGG - Intronic
1174305657 20:49612557-49612579 GCAGGGCTAGACTTAGAACCAGG - Intergenic
1174462902 20:50695470-50695492 GAAGCTCCAGGTTTGGAGCCCGG + Intergenic
1175371019 20:58491974-58491996 GCTGGTCAAGAAATAGAGCCAGG + Intronic
1175710646 20:61217847-61217869 GCAGGTGCAGATGTAGATGCAGG + Intergenic
1175739147 20:61408389-61408411 TGAGGTCCAGATCTAGAGCATGG - Intronic
1176151788 20:63595251-63595273 GCGGGTCCAGATTTGGGGCTGGG + Intronic
1179178685 21:39027091-39027113 GCATGTCCACCTTTGGAGCCAGG + Intergenic
1180917525 22:19499426-19499448 GCAGGGCCAGGCTTAGAGGCAGG + Intronic
1184424783 22:44403037-44403059 GCAGGTCCAGGCTCAGATCCTGG + Intergenic
1184522717 22:45004980-45005002 GCAGGTGCAGCTTTACAGTCAGG - Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954369601 3:50163291-50163313 GGAGGGCCGGATTTATAGCCTGG - Intronic
954847610 3:53573514-53573536 GCAGGTGCAGTTTTAGACACTGG - Intronic
955025154 3:55160493-55160515 GCACGGCCAGTTTTACAGCCGGG + Intergenic
960886989 3:122405935-122405957 GCAGGCCCAGCTTAAGTGCCTGG + Intronic
961006475 3:123409126-123409148 GCAGAGCCAGATCAAGAGCCTGG - Intronic
961359588 3:126358391-126358413 GCAGGTAGAGAGGTAGAGCCAGG + Intergenic
964857110 3:161158511-161158533 GCTGGTGCAGATTTGGAGCCTGG - Intronic
967221178 3:187249351-187249373 TGAGGTCAAGAATTAGAGCCTGG - Intronic
968916015 4:3497378-3497400 GCAGGTGCAGTTTTGGGGCCAGG + Intronic
970229918 4:13899240-13899262 CCAGGTCTTGATTTGGAGCCAGG - Intergenic
973175193 4:47197043-47197065 GCAGAAGCAGAATTAGAGCCAGG + Intronic
979851169 4:125573006-125573028 GCAGGTCCAGATTGCCATCCAGG + Intergenic
979860978 4:125693374-125693396 TGAGGGCCAGATTTGGAGCCAGG + Intergenic
981786893 4:148489583-148489605 ACAGATCCAGGTTTAGATCCAGG + Intergenic
986123577 5:4866046-4866068 GCAGGGGCAGATTCAGTGCCTGG + Intergenic
987421742 5:17728867-17728889 CCAGATCCAGACCTAGAGCCTGG - Intergenic
991020679 5:61976995-61977017 GCAGATCCAGATTCATATCCTGG - Intergenic
993226080 5:85168366-85168388 GCAGGTCCAGATCTCCAGCATGG - Intergenic
994218097 5:97161224-97161246 GGAGTTCCAGATTTAAATCCTGG - Exonic
994584314 5:101685738-101685760 GCAGGGGCAGATTTGGAGCCTGG + Intergenic
995138201 5:108703019-108703041 GCAGGCCTAGATTTAAATCCTGG + Intergenic
999546559 5:152635351-152635373 GCAGATACAGATTTAAAGCAGGG + Intergenic
1000556315 5:162730430-162730452 GCAGGTCCAGAACAAAAGCCTGG - Intergenic
1003982657 6:11404034-11404056 GCAGGTCCAGGTTAAAACCCTGG - Intergenic
1006257772 6:32844819-32844841 CCAGGTGCAGCTTCAGAGCCAGG + Intronic
1006446528 6:34082855-34082877 GCAGAGCCAGATTTGAAGCCAGG + Intronic
1007239385 6:40414096-40414118 GCAGGGCCAGATTCAAACCCAGG - Intronic
1012372453 6:98524115-98524137 GCAGGGACAGATGTAGAGCATGG + Intergenic
1013270657 6:108542796-108542818 GGAGGGACAGATTTGGAGCCAGG + Intergenic
1018745504 6:166758526-166758548 GCAGGTTCAGAGTCAGACCCAGG + Intronic
1021676508 7:23085491-23085513 GCAGTTCCAGATCAAGATCCAGG - Intergenic
1023343224 7:39244708-39244730 GAAGGTCCACATTCTGAGCCAGG + Intronic
1023966786 7:44967013-44967035 GCAAGGCCAGGTTCAGAGCCAGG + Intronic
1025482168 7:60994364-60994386 GCAGGTAGAGATGTAGAGACAGG + Intergenic
1028144930 7:87311019-87311041 GCAGGTACAGCATCAGAGCCTGG + Intergenic
1028846430 7:95485990-95486012 GCAGCTCCAGATTTAGTGACAGG - Exonic
1031710175 7:125035093-125035115 GCAGCTCCATTTCTAGAGCCTGG + Intergenic
1032073914 7:128827335-128827357 GCAGGACCAGGTGAAGAGCCAGG + Intergenic
1032500836 7:132398567-132398589 GCTGGCCCAGTTTAAGAGCCTGG + Intronic
1034069055 7:148164941-148164963 GAAAGTACAGAGTTAGAGCCAGG - Intronic
1034426982 7:151019131-151019153 GCAGGTCGACATTGAGCGCCAGG + Exonic
1037466239 8:19163312-19163334 GTAGGTCCAGATGTAGCACCCGG - Intergenic
1038688108 8:29737196-29737218 ACAGGGCCAGACTTACAGCCTGG + Intergenic
1040594167 8:48821710-48821732 GCAGGTCCAGATTTTCAGGTGGG - Intergenic
1040941981 8:52843604-52843626 GCAGGGCAAGATATGGAGCCGGG - Intergenic
1042751604 8:72163609-72163631 GCAGCTTCAGTTTAAGAGCCTGG + Intergenic
1047834143 8:128669784-128669806 GCAGGCACATATCTAGAGCCTGG - Intergenic
1050150490 9:2614949-2614971 GGAGGCCCAGTTTTTGAGCCTGG - Intergenic
1053160725 9:35811609-35811631 ACAGGCCCAGAGCTAGAGCCTGG + Exonic
1056003887 9:82246883-82246905 GCAGGTCCAGAGGTACAGTCTGG + Intergenic
1060694006 9:125690449-125690471 CCAGGTCCAGGTTTGAAGCCAGG - Intronic
1061621888 9:131815983-131816005 GGAGGACCAGATTTAGAATCAGG - Intergenic
1061814688 9:133187662-133187684 TCAGCTCCAGAGGTAGAGCCCGG - Intergenic
1061890411 9:133616329-133616351 GGAGGTCCAGATTTGGGGCCTGG + Intergenic
1187099412 X:16177433-16177455 ACAGCTCTAGTTTTAGAGCCCGG - Intergenic
1188816224 X:34718045-34718067 GCATGTCCAGAATTTTAGCCAGG - Intergenic
1189330069 X:40138985-40139007 GCTGGTCAAGTTGTAGAGCCAGG + Intronic
1190788408 X:53676346-53676368 GCAGTTCCGGATTTGGGGCCTGG - Intronic
1191959061 X:66679567-66679589 GCAGAGCCAGATTTAAACCCAGG + Intergenic
1192185635 X:68945071-68945093 GCAGGTGGAGATTTAGAGAGAGG - Intergenic
1193835706 X:86341021-86341043 GCAGGTGCTGATTTAGAATCTGG + Intronic
1196983689 X:121243796-121243818 GCAGCTCCAGATTTACAGTCTGG + Intergenic