ID: 1091111604

View in Genome Browser
Species Human (GRCh38)
Location 11:132974055-132974077
Sequence CGCATAATCACTCATGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091111598_1091111604 10 Left 1091111598 11:132974022-132974044 CCCTCCAGCTGCTATGGAGAAGC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1091111604 11:132974055-132974077 CGCATAATCACTCATGTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
1091111600_1091111604 6 Left 1091111600 11:132974026-132974048 CCAGCTGCTATGGAGAAGCTGTC 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1091111604 11:132974055-132974077 CGCATAATCACTCATGTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
1091111599_1091111604 9 Left 1091111599 11:132974023-132974045 CCTCCAGCTGCTATGGAGAAGCT 0: 1
1: 0
2: 2
3: 21
4: 145
Right 1091111604 11:132974055-132974077 CGCATAATCACTCATGTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091111604 Original CRISPR CGCATAATCACTCATGTCTC TGG Intronic
905020039 1:34803426-34803448 TGCATAATCTCTCTTTTCTCTGG - Intronic
908392084 1:63692748-63692770 TGCATAAGCACTCATGTGTTGGG + Intergenic
920247457 1:204599310-204599332 ACCATAATCACACATGACTCCGG - Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1070446449 10:76509325-76509347 CCCTTCATCACTCATGTCTAGGG - Intronic
1071537696 10:86448942-86448964 TGCATAAACACTAATTTCTCAGG + Intronic
1075280872 10:121137200-121137222 CACATAAGCACACATCTCTCCGG + Intergenic
1078369681 11:10734616-10734638 CGCTTCCTCACTCATGTCTGGGG + Intergenic
1087494102 11:98867286-98867308 CTCAAAATCACTCATCTCCCTGG + Intergenic
1090420237 11:126569968-126569990 AGCATAATTACTCATATCCCAGG + Intronic
1091111604 11:132974055-132974077 CGCATAATCACTCATGTCTCTGG + Intronic
1101623143 12:106410301-106410323 GGCATCTTCACTCATATCTCTGG + Intronic
1108437892 13:50419206-50419228 CTATTAATCACTCATGTCTTTGG + Intronic
1110484895 13:76027331-76027353 CTCATGCTCACTCATGCCTCAGG - Intergenic
1111340062 13:86872498-86872520 TGCATTATCACTCCAGTCTCAGG - Intergenic
1112371659 13:98799044-98799066 TACATAATCACTCATGTTGCTGG + Intronic
1113927465 13:113949764-113949786 GGGGTCATCACTCATGTCTCAGG + Intergenic
1121243509 14:92446905-92446927 CGCATATTCAGTCAGCTCTCAGG + Intronic
1128546067 15:68568666-68568688 GGCAAAATCACTCAAGTCTCAGG - Intergenic
1140233708 16:73139855-73139877 CCCATAGCCACTGATGTCTCAGG - Intronic
1150464569 17:65381176-65381198 CACATAATCACTCAGGCCCCAGG + Intergenic
1154376010 18:13810496-13810518 CCCATAAGCTCTCATGGCTCTGG + Intergenic
1156546017 18:37964323-37964345 CGCAGAATCCCTCATCCCTCAGG - Intergenic
1166799511 19:45447696-45447718 CGCAGAATGACTCTTGTCCCTGG + Intronic
1168676014 19:58278693-58278715 CCCACAATCAGTCATCTCTCGGG + Intronic
942772465 2:179538691-179538713 CACATATTTGCTCATGTCTCAGG + Intronic
1175314957 20:58040659-58040681 CGCATCAGCACACATGCCTCAGG - Intergenic
1176270029 20:64231512-64231534 CCCATAATCACTCGTGCCTGAGG - Intronic
1178448294 21:32665624-32665646 CACATACTGACTGATGTCTCAGG + Intronic
1185349723 22:50328155-50328177 CGCCTAATGACACATTTCTCAGG + Intergenic
954428316 3:50455302-50455324 GGCATAATCACTCCGCTCTCTGG + Intronic
958149215 3:89668992-89669014 AGCATAATCACTAATTTCTTAGG - Intergenic
964439692 3:156694594-156694616 GAAACAATCACTCATGTCTCTGG + Intronic
964814688 3:160704221-160704243 CGAATACTCACTCATGACTCAGG + Intergenic
966528229 3:180943747-180943769 AGCATAATCATTCATGAATCTGG - Intronic
989398379 5:40982636-40982658 TGCACAGTCACTCATGCCTCAGG - Exonic
989771853 5:45154901-45154923 TTCATAATCATTCTTGTCTCAGG + Intergenic
990492242 5:56313905-56313927 CTCATAATCCCTCCTGCCTCTGG - Intergenic
993374391 5:87132853-87132875 TGCCTAATGACTCATTTCTCAGG - Intergenic
996518911 5:124404616-124404638 TGCCTAATCACACATTTCTCAGG + Intergenic
1003170044 6:3714013-3714035 CACAGAAACACTCATGCCTCAGG + Intergenic
1007334185 6:41139743-41139765 AGCATATTCACTCATGGCTGGGG - Intergenic
1010885292 6:81230312-81230334 CTCATAATCTGTAATGTCTCTGG + Intergenic
1012502244 6:99901494-99901516 AGCATAATCTCTGATTTCTCAGG + Intergenic
1017976754 6:159364967-159364989 AGCAGATTCACTCCTGTCTCTGG + Intergenic
1024439346 7:49397915-49397937 GGCAGTGTCACTCATGTCTCAGG + Intergenic
1027853137 7:83474246-83474268 CCCATTATTACTCATGTATCAGG - Intronic
1033029279 7:137809293-137809315 CTCATACTCATTGATGTCTCGGG + Intronic
1039419554 8:37424685-37424707 CGCACATTCATTTATGTCTCTGG - Intergenic
1056962290 9:91136258-91136280 CACATAATCACCCAGGGCTCAGG - Intergenic
1057937348 9:99251934-99251956 AGCAAAATCACTCATGTCCTAGG - Intergenic
1058601330 9:106673919-106673941 CCCATAATCACTCATGACAGTGG + Intergenic
1060026201 9:120174044-120174066 CACATACTGGCTCATGTCTCTGG - Intergenic
1192494240 X:71604221-71604243 CGAATCATCACTCTTGTCTTCGG - Exonic
1192734650 X:73838350-73838372 TGCATAACCTCTCATGTTTCCGG + Intergenic
1200694119 Y:6342324-6342346 AGCATAATCCCTCATTTCTTGGG - Intergenic
1201041158 Y:9832395-9832417 AGCATAATCCCTCATTTCTTGGG + Intergenic
1201052943 Y:9958433-9958455 AGCATAATCTCTGGTGTCTCAGG - Intergenic