ID: 1091112232

View in Genome Browser
Species Human (GRCh38)
Location 11:132980441-132980463
Sequence CACTTCCTATTTTAGTTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091112232_1091112236 -9 Left 1091112232 11:132980441-132980463 CCCTAGAACTAAAATAGGAAGTG 0: 1
1: 0
2: 0
3: 18
4: 201
Right 1091112236 11:132980455-132980477 TAGGAAGTGGGAAGAAAGCAAGG 0: 1
1: 0
2: 6
3: 85
4: 756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091112232 Original CRISPR CACTTCCTATTTTAGTTCTA GGG (reversed) Intronic
907837355 1:58123022-58123044 CTATTCCTATTTTATTTATAGGG - Intronic
909033347 1:70567667-70567689 CACTTGATGTTTTAGTTCAAGGG + Intergenic
909116765 1:71547150-71547172 CTCTTCCTACTTTAGCTATATGG - Intronic
909680942 1:78291161-78291183 CACTTTCAATTTTATTTCTCAGG + Intergenic
909991289 1:82225559-82225581 CACTTTCTGTTTTAGTTGGAGGG + Intergenic
910888095 1:91987823-91987845 CAGATCTTTTTTTAGTTCTATGG + Intronic
911269220 1:95780323-95780345 CATTTCCTAATTTACTTCCAGGG + Intergenic
912072455 1:105828816-105828838 AACTTTATGTTTTAGTTCTATGG - Intergenic
912921950 1:113877039-113877061 CACTTCTTATTCTGGTTATATGG + Intergenic
913549994 1:119907837-119907859 AGCTTCCTATGTTAGTTTTAAGG + Intergenic
918578313 1:186092960-186092982 CACTTCCTTTTTTTCTTATAAGG + Intronic
918674147 1:187260788-187260810 CACCACCTATCTTGGTTCTATGG - Intergenic
919051090 1:192512450-192512472 TATTTCCTACGTTAGTTCTAGGG - Intergenic
920449203 1:206045793-206045815 GAATTCCTAATTTAGATCTACGG - Intronic
923150090 1:231225275-231225297 AACTTCCTAATTCAGTTCTCAGG + Intronic
1064414580 10:15137563-15137585 CAATTCCTATTTAAATTGTAAGG - Intronic
1067183752 10:44009732-44009754 CTCTTTCTATTTTAGTCCTCAGG + Intergenic
1068407990 10:56617599-56617621 CATTTCCTATTTTTGATTTATGG + Intergenic
1069221705 10:65891790-65891812 CACTGGCTATTTTAGTCCTGAGG + Intergenic
1071144738 10:82555247-82555269 CTCATTCTATTTTAGTTCCAGGG + Intronic
1073692426 10:105825003-105825025 CACTTTCTGTTTTGTTTCTATGG - Intergenic
1074842162 10:117365653-117365675 CACTTCCTGTATTTGTACTAGGG - Intronic
1077536601 11:3127650-3127672 CACTTTCTCATATAGTTCTAGGG + Intronic
1079548729 11:21668390-21668412 CACTTTTTATTTTATTTCAAAGG - Intergenic
1081350643 11:42047626-42047648 CACTACCTTTCTTAGTCCTATGG - Intergenic
1081877861 11:46422481-46422503 CACTTCCTATTAGAGTTTGAGGG - Intronic
1083555021 11:63619241-63619263 CACTTACTATAATAGTTGTAGGG + Intergenic
1088659456 11:112031148-112031170 CACTTACAATTTTTTTTCTAAGG + Intronic
1090555201 11:127867142-127867164 AACTGCCTATTTTAATACTAAGG - Intergenic
1091112232 11:132980441-132980463 CACTTCCTATTTTAGTTCTAGGG - Intronic
1091112858 11:132986795-132986817 AACTTCCTATTTTAGTTTACTGG - Intronic
1092619088 12:10243730-10243752 CACTTCTTATCCTAGTTCGATGG - Intergenic
1092663642 12:10768747-10768769 TACTTCCTAATTTCCTTCTATGG + Intergenic
1092729944 12:11521688-11521710 CACTTTCTATTTTATTCCTGGGG - Intergenic
1095319510 12:40809160-40809182 CAACTAATATTTTAGTTCTAGGG - Intronic
1095413725 12:41952648-41952670 CACTTACGATGTTATTTCTATGG + Intergenic
1095849826 12:46790101-46790123 TATTTTCTATTTTATTTCTAAGG - Intronic
1096989062 12:55783753-55783775 CTCTTCATATTTTAGATTTATGG - Intronic
1097503608 12:60437673-60437695 AACTTCCTATTTTTATTCTTAGG + Intergenic
1097543083 12:60964376-60964398 TACTTTATATTTTAATTCTATGG - Intergenic
1099265240 12:80438039-80438061 GACTTCCTCTTTTACTTTTATGG + Intronic
1099421746 12:82470275-82470297 TACCTCCTATTTTATTTCCATGG - Intronic
1100120703 12:91366216-91366238 TACTTCCCATTTTATTTGTAGGG - Intergenic
1100944968 12:99771815-99771837 CACTTGCTAATCTAGTTCCATGG - Intronic
1101582180 12:106051270-106051292 CACTTACTCTCTTAGTTCTGTGG + Intergenic
1102980878 12:117240158-117240180 CACTACTTATTTTGGTCCTATGG - Intronic
1106536931 13:30653957-30653979 CACTTCCTATTTTCCTCCTGGGG + Intronic
1108981023 13:56514682-56514704 CACTTCCTATTTTGGCTGCAAGG + Intergenic
1109436528 13:62310924-62310946 CACTGAGTATTTTAGTTCAAAGG + Intergenic
1110164402 13:72421483-72421505 CCTTTCCTACTTTAGTTCTCCGG + Intergenic
1110402921 13:75115251-75115273 CAGCTTCTATTTTAGTTTTAGGG + Intergenic
1110713127 13:78671811-78671833 AAGTTCCTCTTATAGTTCTAGGG + Intergenic
1110811148 13:79811737-79811759 CACTTGTTATTTTAGTTTTGCGG - Intergenic
1112377499 13:98857000-98857022 CACTCCCTATCTTGGTACTATGG + Intronic
1112428126 13:99323574-99323596 CACTTGCTATTTTAATTATAAGG - Intronic
1114222370 14:20708300-20708322 CAATTCCTGTTTCATTTCTATGG + Intergenic
1115152999 14:30306832-30306854 CACTTGCCATGTTACTTCTAAGG - Intergenic
1115223750 14:31082986-31083008 CTCTTCCTGTTTTAGATGTAAGG - Intronic
1115713403 14:36075135-36075157 CATTTCATATTTTAGATCTTAGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118678173 14:68211263-68211285 TACTTCCACTTTTAGTTCAAGGG + Intronic
1118762604 14:68889796-68889818 CACTTTGTTTTTTAGTTTTATGG - Intronic
1121115004 14:91337333-91337355 TAATTCCTATTTTATTTTTAGGG + Intronic
1121262967 14:92579988-92580010 CCCTTCCTAGTCTACTTCTAGGG - Intronic
1122620058 14:103051197-103051219 CACTTCTGATTTTAGATTTAAGG + Intronic
1125099637 15:35896666-35896688 TACTTCCTTTTTTGGTTCTTTGG + Intergenic
1126827845 15:52569150-52569172 CACTTCCTTTTTTCCTTCAAAGG + Exonic
1127480133 15:59371034-59371056 CATTTCCTCTTCTAGTTTTAAGG - Intronic
1129049315 15:72765727-72765749 CACTTCTAATTCTAGTTCTCTGG - Intronic
1129942238 15:79508441-79508463 CACTCTCTAATTTAGTTTTATGG + Intergenic
1131331101 15:91500244-91500266 GCCTTCCTATTTTAGTTCAAAGG + Intergenic
1131524396 15:93141436-93141458 CACTTCCTGTTTTTGTTCACAGG + Intergenic
1131823967 15:96301866-96301888 CATCTCCTATTTGAGCTCTATGG + Intergenic
1131933948 15:97480285-97480307 CAATTCTTATTTTAGGTTTAGGG - Intergenic
1134328840 16:13231571-13231593 AACTTCCTCTTTAAATTCTAGGG - Intronic
1135629574 16:24025308-24025330 CACTTCGTCTCTTAGTTCTTCGG + Intronic
1135907522 16:26526697-26526719 CACTCCCTAACTTAGTACTAAGG - Intergenic
1140834227 16:78778682-78778704 CACCTCCTGTTTGAGTTCAAGGG + Intronic
1142421218 16:89971833-89971855 CACTTCCAATTTGAGGTCAAGGG + Exonic
1145260953 17:21354469-21354491 AACTTTATATTTTTGTTCTATGG - Intergenic
1150058133 17:62038669-62038691 CACTTCATTTTTTAATTTTATGG + Intronic
1150468606 17:65416660-65416682 CACTTCCTACTGGAGTTTTATGG - Intergenic
1151111039 17:71678255-71678277 TACTTAGTATTTTAGTTTTAGGG - Intergenic
1151838174 17:76597812-76597834 CACTTCCTTTTTTTATTCCAAGG - Intergenic
1154413139 18:14153610-14153632 AAATTCCAATTTCAGTTCTATGG - Intergenic
1154988144 18:21573815-21573837 CTCTTCCAATTTTATTTCTGTGG + Exonic
1156009666 18:32481763-32481785 TACTGCCTATTATAATTCTAGGG - Intergenic
1156665828 18:39405938-39405960 CACTCCCTCTTTTAGTTCTTGGG + Intergenic
1156759537 18:40570833-40570855 CACTTCTTGATTTTGTTCTAGGG - Intergenic
1157238919 18:45991067-45991089 TACTTCCTATTTTACTTATGAGG - Intronic
1157894225 18:51448660-51448682 CACATCGTATTTTAGTTATCTGG - Intergenic
1157941983 18:51939234-51939256 CACTCCCTATTTTATTGCCATGG - Intergenic
926435359 2:12832064-12832086 TTCTTCCAATTTTAGTTCTGTGG + Intergenic
926505967 2:13716408-13716430 CACATCCAATTTTAGTGCCAGGG - Intergenic
926633883 2:15160694-15160716 CTCTTCCTATTTTCTTTCCAGGG + Intergenic
928648708 2:33382822-33382844 CACCACATATTTTAGTTTTAGGG + Intronic
928726684 2:34182091-34182113 CACTTCTAACTTTAGTTCTCTGG - Intergenic
929543837 2:42842811-42842833 CACTTCCAATCTTACTTTTATGG - Intergenic
931098175 2:58965706-58965728 CAACTCCTATTTTGATTCTATGG - Intergenic
933460039 2:82570878-82570900 CACTTCTTGTTTTAGATCTTGGG - Intergenic
933476797 2:82802165-82802187 CACTTTCTATTTTGTTTCCATGG - Intergenic
933790149 2:85877256-85877278 TTCTTGCTATTTTTGTTCTAAGG - Intronic
936631944 2:114213090-114213112 CACTTCCTATCTTATCTCTCCGG + Intergenic
936652479 2:114444524-114444546 CACTTCCTTTATTAGTGCTCTGG + Intronic
938767905 2:134474000-134474022 CACTTCCCAATTTATTTCTGAGG + Intronic
941265360 2:163354824-163354846 CACTTCCTAGGAGAGTTCTAAGG + Intergenic
941683101 2:168420266-168420288 CAATTCCTATCTCAGTTCTGTGG - Intergenic
942082000 2:172409024-172409046 CACTTACTATTTTTGTTTTTAGG + Intergenic
942427972 2:175879316-175879338 TACTTTCTTATTTAGTTCTAAGG - Intergenic
944201562 2:197112907-197112929 TAATTCCTTTTTTATTTCTAAGG - Intronic
1169826285 20:9772253-9772275 CTCATCTTATTTTAGTTCTGAGG - Intronic
1170306271 20:14941610-14941632 CTCCTCATATTTTAGTTCTAGGG + Intronic
1173772921 20:45679195-45679217 CACTTCCCAGTTTAGTCCTGAGG + Intergenic
1176859870 21:14004645-14004667 AAATTCCAATTTCAGTTCTATGG + Intergenic
1177440643 21:21118996-21119018 CACCTCCTCTTTTTGTTTTATGG + Intronic
1177710452 21:24767168-24767190 AACTTCCTATTTTGGTTAAAAGG - Intergenic
1182309216 22:29392838-29392860 CACATGCTATTTAAGTTCTCAGG - Intronic
1185087040 22:48746552-48746574 CACTTCCTGAGTTAGTGCTATGG - Intronic
951571278 3:24065756-24065778 GGCTTCCTATTTTATTTCTAGGG + Intergenic
951885189 3:27517338-27517360 TATTTCCTATTTTGTTTCTACGG + Intergenic
952660185 3:35836493-35836515 CGCTTCTAATTTTAGTTCTCAGG + Intergenic
956124929 3:66002368-66002390 CATTTCCAATTTTATTTGTAAGG + Intronic
956571047 3:70695370-70695392 CACTTCGTAATTTAATTCTAGGG + Intergenic
957602842 3:82360172-82360194 CACTTCCTTTTTTATTGCAATGG - Intergenic
958518014 3:95146011-95146033 AAATTCCTTTTTTAATTCTAAGG - Intergenic
958855207 3:99376644-99376666 CACTCCCTATGTTAGTCTTAGGG - Intergenic
960995986 3:123340582-123340604 AACTTACTATTTTAGCTCTCTGG - Intronic
961254576 3:125537311-125537333 CACTGCCTAGATTAGTCCTAAGG + Intronic
962183685 3:133235560-133235582 CACATCCCATTTTACATCTAGGG - Intronic
963286022 3:143435481-143435503 CACTTCCAGTTATAGTTCTATGG + Intronic
963445707 3:145404704-145404726 AAATTCCTATTTTAGTGCTACGG + Intergenic
964202259 3:154131032-154131054 CACCTCCTAATTTTGTTCTCAGG + Intronic
964799267 3:160535993-160536015 CACTTCATATTTCAGTTTTTAGG - Intronic
967318727 3:188174855-188174877 CACTTCCTCTTATGGTTCCATGG + Intronic
967443454 3:189536691-189536713 CAATTTTTATTTTAGTTCTTGGG + Intergenic
969062921 4:4452961-4452983 CACTTCCAATCTTAGTTCTCTGG - Intronic
970962746 4:21891828-21891850 GAATTCCTAATTTATTTCTAAGG - Intronic
972242961 4:37213762-37213784 CACTTCCTCTTCGAGCTCTAGGG + Intergenic
973185002 4:47316240-47316262 CACTCCCTTTTTTAGGTCTTTGG + Intronic
974423855 4:61714677-61714699 AGCTTCCTATTTCAGTTGTACGG + Intronic
974478619 4:62416768-62416790 CACTTCCTATTTGATTACCATGG - Intergenic
976324533 4:83755809-83755831 TACATCCTATTTTTGTTCCAGGG - Intergenic
976779703 4:88745517-88745539 CATTTCCTCTTTTACTTCTGTGG - Intronic
976871267 4:89796533-89796555 CCCTTCCTATTTTACTTCTCTGG + Intronic
976901399 4:90181199-90181221 CAATTTCTATTTTAGTTGCAGGG - Intronic
977210631 4:94213817-94213839 CCCATCCTATTTTAGTACCAAGG + Intronic
977242228 4:94586654-94586676 CACTTCTTATTTCAATACTAGGG - Intronic
977722507 4:100256429-100256451 CATTTCCTTTTTTATTTCTTAGG + Intergenic
978506716 4:109465641-109465663 TAATTCCTATCTTAGTTCTGAGG + Intronic
980234957 4:130092824-130092846 GAATTCCTATATTAGTTCTGTGG - Intergenic
981325667 4:143444617-143444639 CAATTTTTATTTTAGTTTTAGGG + Intronic
981433384 4:144689287-144689309 TACTTGCTAGTTTATTTCTAAGG + Intronic
985198164 4:187455539-187455561 CATTTCCCATTTCAGTTTTATGG + Intergenic
985315274 4:188652442-188652464 CACTTTCTATTGTTGTTTTAGGG - Intergenic
986596455 5:9427500-9427522 CATTTCCCATGTTAGTTCTCAGG - Intronic
987189308 5:15457846-15457868 CATTTCTTATTTTATTTATATGG + Intergenic
988833089 5:35005928-35005950 CACTTCCTATCCTATTCCTAGGG + Intronic
992359942 5:76026952-76026974 CTTTTCCTATTTTTTTTCTAAGG + Intergenic
993495888 5:88608417-88608439 CACGACCTCTTTTAGTTATAAGG + Intergenic
993539931 5:89136601-89136623 CACTTACTATTGTATTTCTTAGG + Intergenic
994061703 5:95486053-95486075 TACTCCCTATGTTAGTTTTAGGG - Intronic
994633852 5:102320240-102320262 TACTGCCTATTTTTGTTCAAGGG + Intergenic
994715770 5:103320086-103320108 CACTGATTATTTTATTTCTAAGG + Intergenic
995564551 5:113420252-113420274 CACTTGCTTTTTTTCTTCTATGG - Intronic
997804041 5:136896314-136896336 CACTTCTCATGTTAGTTTTAGGG + Intergenic
999046240 5:148472750-148472772 CACTTCCTATTTCAGCTCTCAGG - Intronic
999442959 5:151616664-151616686 CACTTCTTATTTTCTTACTATGG + Intergenic
1001206589 5:169769230-169769252 CCCTTCCTATTTGAGTTCCTAGG - Intronic
1009620208 6:66065203-66065225 TACTTCCTACTTTAGTTTTGTGG + Intergenic
1011196673 6:84787590-84787612 CACATCTAATTTTAATTCTAAGG + Intergenic
1012457785 6:99426401-99426423 CTCTTACTATTTTGTTTCTACGG - Intergenic
1015753955 6:136589361-136589383 CTCATCCTCTTTTAGTTCAATGG - Intronic
1015882404 6:137882164-137882186 GCCTTCCTATTGTACTTCTAGGG - Exonic
1016429287 6:143965588-143965610 CTCTAGCTATTTTAGTTATAAGG + Exonic
1016606015 6:145927458-145927480 CAGTTCCTTTTTTAATTCCATGG + Intronic
1018218680 6:161557189-161557211 TACTTTCTATTTTATTTCTTTGG + Intronic
1020672787 7:11138507-11138529 TACTTCCTAATTTAGTAGTATGG - Intronic
1021193661 7:17650471-17650493 CACTCCCTATTCAGGTTCTAAGG + Intergenic
1021333054 7:19362873-19362895 CCCTTCCTATTTTATTTAAAGGG + Intergenic
1022789251 7:33670542-33670564 TACTACCTAATTTAGTTTTAGGG + Intergenic
1023926281 7:44672134-44672156 CACTTTCTCTTTTAGTTCCTAGG + Intronic
1024808839 7:53183323-53183345 CACCACCTATCTTAGTTCTATGG - Intergenic
1027838038 7:83271308-83271330 CACTTCATATTTTGCTTCCAGGG - Intergenic
1028028221 7:85874023-85874045 GACTTTTTATTGTAGTTCTAAGG - Intergenic
1028427183 7:90702693-90702715 TGCTTCCTATTTTATTTCTTAGG + Intronic
1029852407 7:103476856-103476878 CACTTCTTATTTCAGTTATAAGG - Intronic
1029968172 7:104762453-104762475 CTCTTCCGTATTTAGTTCTATGG - Intronic
1031552148 7:123128255-123128277 CACTTTGTTTTTTAATTCTATGG - Intronic
1032064147 7:128752032-128752054 CACATCCTATTTTAGGCATAAGG - Intronic
1032897972 7:136273342-136273364 AACTTCCTATTTGAGCTCTTTGG - Intergenic
1034029021 7:147739511-147739533 AAATTCCTATTTTAGTTTCAAGG - Intronic
1035140021 7:156750613-156750635 CTCTTCCTTTTTCACTTCTATGG + Intronic
1036392753 8:8338755-8338777 GACTTCCTTTTTCAGTCCTATGG - Intronic
1037665715 8:20968053-20968075 CACTTCATTTTTTACTTCTAGGG + Intergenic
1038459168 8:27702220-27702242 CAAGTCCTATTTAAGTTTTATGG + Intergenic
1042516176 8:69661914-69661936 CTCTTCCTCTTTTACGTCTAGGG - Intergenic
1043536624 8:81212258-81212280 TACTTCCTATTTTCATTATAGGG - Intergenic
1044172848 8:89077581-89077603 CACTTCCTATTATATTTATGTGG + Intergenic
1044223237 8:89694432-89694454 CACTTCTAATTCTAGTTCTCTGG - Intergenic
1044885158 8:96769203-96769225 CACTTCCTATTACACTTATAGGG + Intronic
1045945116 8:107786831-107786853 TACTCCCTATGTTAGTTCCAGGG + Intergenic
1045984114 8:108227975-108227997 CAGATTCTAATTTAGTTCTAGGG + Intronic
1051689711 9:19697488-19697510 CAATTCCTAAATTAGTTCTCTGG - Intronic
1052844125 9:33319808-33319830 TACTTACAATTTTAGTTCTTTGG - Intronic
1053031021 9:34777883-34777905 AGCTTCCTACTTTAGTTTTAGGG + Intergenic
1053341651 9:37341048-37341070 CACTTCTTATTTTATTTTAAAGG - Intronic
1055245222 9:74233377-74233399 CAGTTTTTAATTTAGTTCTAAGG + Intergenic
1055761815 9:79617024-79617046 CTTTTCCTATTTTACTTCCAGGG + Intronic
1058999972 9:110338364-110338386 CAGATACTATTTTAGTTTTATGG + Intergenic
1059649342 9:116300905-116300927 CATTTCCTATTAGAGTTCTATGG + Intronic
1187564695 X:20437183-20437205 CATTTCCTAGTTGAGTTTTAGGG + Intergenic
1189020600 X:37334077-37334099 TACTTCCTATTTTTGTTTTATGG - Intergenic
1192202589 X:69076253-69076275 CACTTCCTCTTTTGATGCTAAGG - Intergenic
1194794280 X:98191412-98191434 CACTTCCTTTTTTTGTTCTTAGG + Intergenic
1195355757 X:104038528-104038550 CATATCCTCTTTTAGTTCTCTGG + Intergenic
1195623479 X:106983137-106983159 CACTTCCGATTTTAGATTTTTGG + Intronic
1196608293 X:117681125-117681147 CACTTTTTATTTTAGTTTCAGGG - Intergenic
1197312145 X:124917940-124917962 CCCTTTCTATTTCATTTCTAGGG - Intronic
1200272023 X:154694783-154694805 CACTTCCTTTTTCTGTTCTCTGG + Intronic
1201719705 Y:17083113-17083135 CACTTCCTGTTTTGGCTCTGTGG + Intergenic