ID: 1091112519

View in Genome Browser
Species Human (GRCh38)
Location 11:132983122-132983144
Sequence GCAACCTTGCAAGCTGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091112519 Original CRISPR GCAACCTTGCAAGCTGGAGG GGG (reversed) Intronic
900543644 1:3216615-3216637 GCATCCTAGCAGGCTGGAGCTGG + Intronic
900880075 1:5374540-5374562 GCATCCATGCAAGCAGGATGAGG - Intergenic
902396599 1:16135262-16135284 GCCACCTTGCTAGCTTGGGGTGG - Intronic
902793693 1:18786303-18786325 GCAACCCAGCAAGCAGGAAGGGG - Intergenic
904208103 1:28868030-28868052 GCTACCATGGAAACTGGAGGAGG + Intergenic
904972211 1:34427837-34427859 TCAAGCAAGCAAGCTGGAGGTGG - Intergenic
906289373 1:44610016-44610038 GTATCCCTGCAAGCAGGAGGAGG - Intronic
908169566 1:61491410-61491432 GCAAACGTGGAAGCTGAAGGGGG - Intergenic
908369477 1:63467500-63467522 GCAAGCAAGCAAGCTGGATGTGG - Intronic
912999966 1:114570480-114570502 GCAGACTTGCAAGCTGCAAGTGG + Intronic
915107270 1:153542320-153542342 CCAATCTTGCCAGCTGGGGGTGG - Intergenic
918082184 1:181216177-181216199 GCATAGTTGCAAGATGGAGGAGG + Intergenic
920726803 1:208444077-208444099 GAAACCCTACAAGCTGGAAGGGG - Intergenic
922958410 1:229625238-229625260 GCAGCTTCGCGAGCTGGAGGTGG + Intronic
1065134501 10:22654680-22654702 GAAGCCCTGCAAGCTGGAGTTGG + Intronic
1067348885 10:45457865-45457887 GGACCACTGCAAGCTGGAGGCGG + Exonic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1067716200 10:48692845-48692867 GCAGCCTTGAAAACTGGAAGGGG + Intronic
1069982165 10:72260438-72260460 GCAACCTTGAAAAGTGCAGGGGG - Intergenic
1069990951 10:72315693-72315715 GCAAGCCTGGGAGCTGGAGGAGG - Intergenic
1072122114 10:92413740-92413762 GCAACCTTCCAAACAGGATGCGG + Intergenic
1075642664 10:124075923-124075945 GCCACCTTGCAAAGTTGAGGGGG - Intronic
1075762859 10:124870044-124870066 GCTACTTTGCAGGCTGGAGCTGG - Intergenic
1076326681 10:129629060-129629082 GCAGCCTTCCCAGCTGGAGCAGG + Intronic
1076680137 10:132167594-132167616 GCCTCCTTCCAAACTGGAGGAGG + Intronic
1079939048 11:26655141-26655163 GCAGCCTGGAAAGCTGGGGGTGG - Intronic
1080540364 11:33258208-33258230 GCAACCTTGGCAGGGGGAGGGGG - Intronic
1080747587 11:35122497-35122519 GCAGCCTTGCAAGGTGCAGAAGG + Intergenic
1083895358 11:65617064-65617086 GGAACCTTGCAGGGTGGAGTAGG + Intronic
1085505240 11:77055069-77055091 GCTGCCTTTCAACCTGGAGGCGG + Intergenic
1086932949 11:92712968-92712990 TCAAGCTTGCAAGCTGGGGCTGG - Intronic
1088579144 11:111299382-111299404 GCGAGCTTTCAAGGTGGAGGTGG - Exonic
1089336762 11:117730282-117730304 GCTAGCTTTAAAGCTGGAGGGGG + Intronic
1090227623 11:125081286-125081308 GCCACCTTAGGAGCTGGAGGCGG + Intronic
1090764894 11:129867887-129867909 GCAGCCTTTCAAGCTAGTGGGGG + Intronic
1091112519 11:132983122-132983144 GCAACCTTGCAAGCTGGAGGGGG - Intronic
1092561487 12:9618741-9618763 GCATCCTTACATGGTGGAGGGGG + Intergenic
1098353215 12:69585326-69585348 GCAGCCTTTCACACTGGAGGGGG - Exonic
1103862756 12:124027501-124027523 GCAGTCCTGCAAGCAGGAGGTGG - Intronic
1103925027 12:124418879-124418901 GCGTCCTTGCAAACTGGGGGTGG - Intronic
1103925606 12:124422142-124422164 GCGTCCTTGCAAACTGGGGGTGG - Intronic
1104427922 12:128693244-128693266 GCATCCTTGGAGGCTGGATGGGG + Intronic
1104467041 12:128999110-128999132 GCCATCTTGCAAGCATGAGGAGG + Intergenic
1107731762 13:43356000-43356022 GCACCGGCGCAAGCTGGAGGAGG - Exonic
1112225126 13:97532121-97532143 CCAACTTTGCAGGCTGCAGGAGG + Intergenic
1112927437 13:104693870-104693892 GGAACCTTTGAAGCTGGAAGTGG + Intergenic
1115475047 14:33805434-33805456 GCAGCCTTGTGAGCTGGAGGTGG + Intergenic
1116846818 14:49872367-49872389 GCTACCTTGGAGGCTGGAGGTGG - Intergenic
1117965098 14:61198962-61198984 TCAGCCTTGCAAGCTTAAGGGGG - Intronic
1118356149 14:65015517-65015539 GCAGCCTGGCAAGGGGGAGGAGG - Intronic
1119354379 14:73993223-73993245 GCTACTTGGGAAGCTGGAGGTGG + Intronic
1121005479 14:90487977-90487999 GGAAGCTTGCAGGCTGCAGGTGG + Intergenic
1122821967 14:104351889-104351911 GCAACCTTGCATGCTGCTGGTGG - Intergenic
1124406705 15:29399100-29399122 GCTTCCTTGCAAGCTGTGGGTGG - Intronic
1124689467 15:31810068-31810090 ACCACCTTGCAGGCTGAAGGTGG - Intronic
1125405522 15:39349292-39349314 GCAACATTGAAAGATGTAGGAGG + Intergenic
1127360245 15:58238718-58238740 GGACCCTTGCAATCTGGAGAGGG + Intronic
1127367058 15:58300947-58300969 GCAGGCTCGCAAGCTGAAGGAGG - Intronic
1127890825 15:63249476-63249498 GCACATCTGCAAGCTGGAGGTGG - Intronic
1129503353 15:76060343-76060365 TAAAACATGCAAGCTGGAGGGGG + Intronic
1133144118 16:3770859-3770881 GCAGCCGTGGAAGCAGGAGGCGG + Exonic
1135520415 16:23172692-23172714 GCTGCCTTGTGAGCTGGAGGGGG - Intergenic
1136672300 16:31869603-31869625 GCCACATGACAAGCTGGAGGGGG - Intergenic
1142197546 16:88745780-88745802 AGAGCCCTGCAAGCTGGAGGGGG - Intronic
1144325290 17:14173550-14173572 GCAACCTGGCCAGCTGTAGAGGG + Intronic
1144474164 17:15570436-15570458 GCAACCTGGCCAGCTGTAGAGGG + Intronic
1144794149 17:17879731-17879753 GCAGCCTGGCAATCTGGTGGGGG + Exonic
1148238061 17:45982655-45982677 GCCACCTAGCGAGCTGGTGGCGG + Intronic
1148455734 17:47810531-47810553 GCAATCCTTCAGGCTGGAGGGGG - Intronic
1151328200 17:73391613-73391635 GCAGCCTGGCAGGGTGGAGGGGG + Intronic
1152077741 17:78169302-78169324 CCAGCCCTGAAAGCTGGAGGGGG + Intronic
1153262121 18:3234663-3234685 GCAACCGTGCAAGCTGAAGGTGG - Intergenic
1153515361 18:5896041-5896063 GCAAACTCCCAAGCGGGAGGGGG - Intergenic
1155251611 18:23958323-23958345 GCAAACTTCCAAGGTGGAGGAGG - Intergenic
1157172950 18:45424802-45424824 GCAAACTTGGAAGTTGGAGTTGG - Intronic
1159337277 18:67085427-67085449 GCATTTTTGCAAGCTAGAGGGGG + Intergenic
1160340455 18:78084949-78084971 GTAACCTGGAAAGCTAGAGGAGG + Intergenic
1162478680 19:10915686-10915708 CCAGCCTTGCAAGCTGGGGGAGG - Intronic
1163248979 19:16114766-16114788 GTTACCTAGCAAGGTGGAGGTGG + Intronic
1164457540 19:28421187-28421209 ACAACCTCGCAGCCTGGAGGTGG + Intergenic
1166467902 19:43050031-43050053 GAAGCCTTATAAGCTGGAGGTGG - Intronic
1168255571 19:55162914-55162936 GCTAGCTGGGAAGCTGGAGGAGG - Intronic
925048872 2:795878-795900 GCAGCCTTCCCAGCCGGAGGAGG + Intergenic
925493960 2:4425364-4425386 GCTACCTGGGAGGCTGGAGGCGG + Intergenic
932276156 2:70453717-70453739 ACAGCCCTGCCAGCTGGAGGTGG - Intronic
936642067 2:114324425-114324447 TCAACCCAGCAAGCTGGAGCAGG + Intergenic
937858010 2:126686669-126686691 GGGACCTTGCAACCTGGAGGAGG + Intronic
940668761 2:156641252-156641274 GCAACCTTGCAAGCCAGGAGAGG + Intergenic
941454570 2:165700100-165700122 GCAACATTGCAGGCAGGGGGAGG + Intergenic
943379270 2:187122700-187122722 GCAACCTTCCCAGATAGAGGAGG - Intergenic
944175811 2:196828281-196828303 GCAACCTAGCAACCTAGGGGTGG + Intergenic
944437021 2:199701353-199701375 GCAACCTTGCCAGCATGCGGTGG - Intergenic
944530388 2:200662258-200662280 GCTGCCCTGCAACCTGGAGGTGG - Intronic
945683144 2:212937512-212937534 GCACCCTTGTAAGAGGGAGGTGG + Intergenic
946311907 2:218886691-218886713 GCCATCTGGCCAGCTGGAGGGGG - Intronic
946480549 2:220051801-220051823 GCAATACTGCAGGCTGGAGGTGG + Intergenic
948265029 2:236629681-236629703 GCAACCCCGCAAGCTGGAAGGGG - Intergenic
948789626 2:240370519-240370541 GCCACTTTGCAAGCTGTGGGGGG + Intergenic
948944194 2:241211187-241211209 GGGACCTTGCAGCCTGGAGGGGG - Intronic
1174146863 20:48458416-48458438 GCAGCCTTGCAACCTGGCCGCGG + Intergenic
1175440360 20:58986452-58986474 GCCACCTTGCAAGGCTGAGGTGG - Intronic
1176430387 21:6571769-6571791 GCAACCGGGAATGCTGGAGGAGG - Intergenic
1177261328 21:18733413-18733435 GGCACCTTGCAAGCTGTTGGTGG - Intergenic
1177662007 21:24096820-24096842 GTGACCTTGAAAGCTGGAGAAGG - Intergenic
1178426914 21:32485969-32485991 GAAACCTTACAAGGTGGAAGAGG - Intronic
1179705781 21:43179231-43179253 GCAACCGGGAATGCTGGAGGAGG - Intergenic
1183985600 22:41568569-41568591 GCCACCTTGCCTGTTGGAGGAGG + Intronic
951430193 3:22597521-22597543 GCAACAGTGCAAGCTGTTGGTGG - Intergenic
952507925 3:34024444-34024466 TCAAGCTTGCAAGCTGGGGATGG + Intergenic
954573919 3:51664301-51664323 ACAACCTTCCAAGCTGGAAAGGG - Exonic
955138869 3:56249180-56249202 GCATCCTTGTAAGGTTGAGGTGG - Intronic
957546703 3:81647246-81647268 GCTACCTTGCAGGCTGGGCGCGG - Intronic
957674106 3:83345101-83345123 GCAACCTTGCGAGCCAGAGTAGG + Intergenic
960962917 3:123084550-123084572 CTCACCTTGCAACCTGGAGGAGG + Intronic
961779061 3:129310937-129310959 TCACACTTGCAAGCTGGGGGCGG - Intergenic
964402468 3:156313591-156313613 GCAACTATGGAAGCTGGAGAAGG + Intronic
965115329 3:164481126-164481148 GCATCCTTACATGGTGGAGGGGG - Intergenic
965688475 3:171330593-171330615 TCTGCCTTGTAAGCTGGAGGAGG + Intronic
965867744 3:173225959-173225981 TCAACCTTGCAAGTGGGTGGGGG + Intergenic
967421945 3:189282959-189282981 GCAACCTTGCATGCTGGGGCTGG + Intronic
968650856 4:1759743-1759765 TCAGCCTTCCCAGCTGGAGGGGG + Intergenic
969529427 4:7722500-7722522 GGAGCCCTGGAAGCTGGAGGAGG - Intronic
975200958 4:71588972-71588994 GAAACCTTGCAAGCTAGGAGAGG - Intergenic
976852478 4:89563689-89563711 GATACCTTGAAAGCAGGAGGCGG - Intergenic
977556480 4:98492062-98492084 GCATCCTTACAAGGAGGAGGTGG - Intronic
980021936 4:127721304-127721326 GAAACCTTATAAGCTGGAAGAGG - Exonic
981474220 4:145172075-145172097 GCAATCTGGCCAGCTGGAGCAGG + Intronic
982740717 4:159054376-159054398 GCATCCATGCAAGATGGAGGAGG - Intergenic
985359456 4:189155856-189155878 GCAACGTTGCCGGCTGGGGGAGG + Intergenic
986325237 5:6667870-6667892 GAAAGCATGCAGGCTGGAGGAGG - Intronic
990278742 5:54227321-54227343 GCCACCTTGCTTGCTGCAGGAGG - Intronic
992069821 5:73138058-73138080 GGAACCTTGCCAGGTGGAAGTGG + Intergenic
992772852 5:80064617-80064639 GCAACCTTGGGAGGTTGAGGTGG + Intronic
994550514 5:101229422-101229444 GAAACCTTACAAGCTAGAAGGGG - Intergenic
994692483 5:103035161-103035183 GCCCCCTTCCAAGTTGGAGGGGG - Intergenic
994933797 5:106224387-106224409 GCAACCTAGAAAGTTGCAGGTGG - Intergenic
1001037510 5:168308128-168308150 TGAGCCTTGCAAGCAGGAGGTGG + Intronic
1002042610 5:176525813-176525835 GCAAGGTTGCAGGCTGGACGCGG + Intergenic
1002078196 5:176722128-176722150 ACCACTTTGGAAGCTGGAGGCGG - Intergenic
1006003107 6:30982106-30982128 GGAAGCTGGCAAGCAGGAGGTGG - Intergenic
1006613527 6:35310078-35310100 AGAACCCTGGAAGCTGGAGGAGG - Intronic
1007265084 6:40589704-40589726 GCAACCTTGACAGATGGAGCAGG + Intergenic
1008469481 6:51867417-51867439 GCAACCTTGCAAGTAATAGGAGG + Intronic
1010512642 6:76739499-76739521 GAAACCTTGTAAGCTGTTGGTGG + Intergenic
1014321906 6:119940959-119940981 GCAAACTTACAAGCTAGAAGAGG - Intergenic
1015205097 6:130628729-130628751 GCACACTTGCAGGTTGGAGGCGG - Intergenic
1026958856 7:74395906-74395928 GCCACCTTGCAATCATGAGGCGG - Intronic
1029595770 7:101536978-101537000 GCTCCCTTGCAACCAGGAGGTGG - Intronic
1034479456 7:151308392-151308414 CCAGCCTGGCAAGCAGGAGGCGG - Intergenic
1035022506 7:155807846-155807868 GCATCCTTCCAGACTGGAGGAGG - Intronic
1035241808 7:157537121-157537143 GAAGCCTTGCAAGCTGGAGCTGG + Intergenic
1039371049 8:36984239-36984261 GCAGCCTGACAGGCTGGAGGAGG + Intergenic
1042352738 8:67794194-67794216 GACACCTTGCCAGATGGAGGAGG - Intergenic
1043561762 8:81501569-81501591 ACAAGCTTGCCAGGTGGAGGAGG + Intergenic
1047144992 8:122188524-122188546 GTAAGCTTGCAAGATAGAGGTGG - Intergenic
1048429883 8:134360312-134360334 GCAAGCTTTGAGGCTGGAGGAGG + Intergenic
1050059506 9:1691452-1691474 GCAATCTTGCCAGCTTGAGGTGG - Intergenic
1050185164 9:2965579-2965601 GAAACTTGGCAAGCTGGAGAGGG - Intergenic
1050301410 9:4262391-4262413 GCAAACAAGCAAGCTGGAGAGGG + Intronic
1055829253 9:80359910-80359932 GCGACCTTGCAGCCAGGAGGAGG + Intergenic
1058439944 9:104997495-104997517 GGAACCTTGCATGCTGGGGAAGG + Intergenic
1060356565 9:122913940-122913962 GCCACCTTTCAAGTTGTAGGTGG - Intergenic
1060941261 9:127544363-127544385 GCAACCTTGTGAGGTGGTGGTGG - Intronic
1187109130 X:16277954-16277976 GAAACCCTGCAAGCTAGAAGGGG - Intergenic
1187556508 X:20357165-20357187 GGAACCTGGAAAGCAGGAGGTGG + Intergenic
1190888819 X:54551721-54551743 GCAGCGCTGCAACCTGGAGGAGG + Exonic
1191781126 X:64866903-64866925 GCTATGTTCCAAGCTGGAGGAGG - Intergenic
1192331460 X:70178568-70178590 GCAAGCTTGAAAACTGGATGAGG + Intronic
1194315099 X:92367829-92367851 GAAACCTTACAAGCTAGAAGAGG - Intronic
1195336250 X:103857714-103857736 ACAACCTTGCAAGATAGAGAAGG + Intergenic
1198196115 X:134364351-134364373 GCAAAATTGCAAGCTGGGTGCGG + Intergenic
1198634546 X:138681344-138681366 GAAAAGTTGCAAGCTAGAGGTGG - Intronic
1200623151 Y:5479366-5479388 GAAACCTTACAAGCTAGAAGAGG - Intronic
1202102244 Y:21322076-21322098 CAAACCTTGTAAGCTGAAGGTGG - Intergenic