ID: 1091112675

View in Genome Browser
Species Human (GRCh38)
Location 11:132984748-132984770
Sequence TAGTGTCTTCAAGCTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091112675 Original CRISPR TAGTGTCTTCAAGCTGTTGC TGG (reversed) Intronic
901095401 1:6674988-6675010 TATTCCCTTCATGCTGTTGCTGG - Intronic
901121035 1:6893928-6893950 TAGTGTCTTTCAGCTGTAGATGG + Intronic
902843345 1:19089554-19089576 TAGTGACTTCCAGCTTTTTCAGG - Intronic
908609876 1:65845958-65845980 TAGTATCTTTAAGCTGTGCCTGG + Intronic
1063025494 10:2174717-2174739 TAGTGCCTTCAAGGTTATGCTGG + Intergenic
1063348660 10:5335233-5335255 TAGTGCCTGCAAGGTGATGCGGG + Intergenic
1064477020 10:15701793-15701815 GATTTTCTTAAAGCTGTTGCAGG + Intronic
1067459068 10:46444187-46444209 TATTTTTTTCATGCTGTTGCTGG + Intergenic
1067628129 10:47940443-47940465 TATTTTTTTCATGCTGTTGCTGG - Intergenic
1070739539 10:78893650-78893672 TAATGTCTTCTAGCTGGTGAGGG + Intergenic
1071244721 10:83750395-83750417 AAGTATGCTCAAGCTGTTGCGGG - Intergenic
1074328530 10:112478862-112478884 TAGTGACTTCTAAATGTTGCCGG - Intronic
1076474839 10:130744566-130744588 TCTTGTCTGCAAGCTGTTGATGG - Intergenic
1079079283 11:17402728-17402750 TGGTGTCATCCAGCTGCTGCAGG + Exonic
1089835529 11:121367052-121367074 AAGAGTCTCCAAGCTGTTGATGG - Intergenic
1091112675 11:132984748-132984770 TAGTGTCTTCAAGCTGTTGCTGG - Intronic
1094866471 12:34538131-34538153 CAGTGTTTCCAAGCTGTTGAAGG + Intergenic
1095330426 12:40955147-40955169 TATAGTCTTCAAGCTGGGGCTGG - Intronic
1095829876 12:46573376-46573398 TAGTGTCTTTGGGCTCTTGCAGG - Intergenic
1096929722 12:55194096-55194118 TTGTGTCTTCCAGCTGCTGAAGG + Intergenic
1097509210 12:60515187-60515209 TAGTCTCCTCATGCTTTTGCAGG - Intergenic
1097681392 12:62653032-62653054 TAATGTCTTCAAACTGCTGAGGG - Intronic
1105434249 13:20363281-20363303 TACTGTCTTCAAGCATTTGAGGG - Intergenic
1109305727 13:60638528-60638550 TAGAGTTTTCAAACTGTTACTGG + Intergenic
1109817207 13:67600369-67600391 TGGTCTCTTCATGCTGCTGCCGG + Intergenic
1113810484 13:113139311-113139333 TGGAGTCTGCAAGCTGTTTCCGG - Intronic
1115251607 14:31354442-31354464 TAGTGTATTCAATCTCTTTCAGG - Intronic
1117792446 14:59355199-59355221 TGGTGCCCTCAAGCAGTTGCTGG + Exonic
1118693954 14:68365379-68365401 TAAAGTCTTCAAGCTGCTGAAGG + Intronic
1127322352 15:57859168-57859190 CAGTGTCTTAAAGCAGTTACAGG + Intergenic
1127383315 15:58448037-58448059 TAGGGTCTTCTGGCTGTTTCTGG + Intronic
1138637207 16:58350100-58350122 TAGTTTCTTCTAGCAGTTCCTGG - Intronic
1149852196 17:60044551-60044573 CAGTGTCTGGATGCTGTTGCAGG - Intronic
1150715985 17:67572944-67572966 TTGTCTCTTCCAGCTGTTGGTGG - Intronic
1152513222 17:80804390-80804412 CTGTGTCTTCTAGCTGTTTCTGG + Intronic
1155996282 18:32334301-32334323 GTGTGTTTTAAAGCTGTTGCCGG - Intronic
1157097315 18:44697686-44697708 TATTGTCTTCTAGCTGTTCTGGG - Intronic
1158495594 18:57952541-57952563 AAGTGTTTCCAAGTTGTTGCTGG - Intergenic
1164684913 19:30160285-30160307 TGGGGTCTTCAAACTGGTGCTGG - Intergenic
925754078 2:7117080-7117102 GAGTCTCTTCAAGGTGTTTCTGG - Intergenic
926097658 2:10092726-10092748 TAGTGGCTTCATGGTCTTGCTGG - Intergenic
926560248 2:14408845-14408867 TACTGGCTTCAAGCTGGTACTGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
933223513 2:79718004-79718026 TATGGTCTTCAAGAGGTTGCAGG - Intronic
936012214 2:108932179-108932201 TAATGCCTTTAGGCTGTTGCAGG - Intronic
936124448 2:109774653-109774675 TATTGTGTTCAAGCTATTACAGG + Intergenic
936220241 2:110596803-110596825 TATTGTGTTCAAGCTATTACAGG - Intergenic
937268246 2:120630742-120630764 TCATGTGGTCAAGCTGTTGCGGG + Intergenic
937626876 2:124053929-124053951 TAGTTTCTCCAAGTTGTGGCAGG + Intronic
943219873 2:185090820-185090842 TAGTGTCTGTAAGCTTTTCCAGG - Intergenic
945240655 2:207673529-207673551 TAGTATCTTCAAGGTGCTGAGGG - Intergenic
1172270125 20:33650320-33650342 GAGTGTCTGGAAGCTGTTGTTGG - Intergenic
1177108795 21:16997929-16997951 TAATTTGTTAAAGCTGTTGCAGG + Intergenic
1177344906 21:19855520-19855542 TAGTGGCTTCAGGCTGTCCCCGG + Intergenic
1177718770 21:24877026-24877048 AGGTGTCTTCTAGCTGGTGCTGG - Intergenic
1184381816 22:44149502-44149524 TGGGGTCTTCAGGCTGTGGCTGG - Intronic
1185202756 22:49518133-49518155 AAGTGTCTTCAGGCTCTTCCAGG - Intronic
950092445 3:10305414-10305436 TACTGTTTTCAATCTGTTGGAGG - Intronic
953188735 3:40663589-40663611 TAGTGTCGTCAAGGTGCTGCTGG - Intergenic
953204674 3:40814521-40814543 TAATTCCTACAAGCTGTTGCTGG - Intergenic
954058505 3:48049069-48049091 TAGTCTATTCAAGGTGTTGCAGG + Intronic
956117313 3:65931437-65931459 TCCTGTGTTCAAGCTGTTACTGG - Intronic
956639122 3:71398066-71398088 GAGTGTTTTCAAGCTTTTGGAGG - Intronic
956796026 3:72719493-72719515 TAGTGTCTCCATGCTGTTAAAGG + Intergenic
958257248 3:91339475-91339497 TAGTTTCTTCATGGTGTTGATGG + Intergenic
959037871 3:101386882-101386904 AAGTGTCTCCTACCTGTTGCAGG + Intronic
961634809 3:128326517-128326539 TGGTGGCTTCCAGGTGTTGCTGG + Intronic
972045316 4:34658038-34658060 ATGTGTTTTCAAGCTTTTGCTGG + Intergenic
972219528 4:36937683-36937705 TAGTTTCTTCATGGTGTTGATGG - Intergenic
975191415 4:71467155-71467177 TAGTGGCTTCCTGCTGTTGATGG + Intronic
977587140 4:98786335-98786357 TCGTGTCTTCCAGCTGTTCAGGG - Intergenic
977816078 4:101415858-101415880 TATTTTCTTCAAGCTGTAGGGGG - Intronic
977818702 4:101446024-101446046 TAGTATGTACAAGCTGTTACAGG - Intronic
978938672 4:114411275-114411297 TACTATCTTCAAAGTGTTGCTGG - Intergenic
984021298 4:174487436-174487458 TAGAGCCTTCCTGCTGTTGCTGG + Intergenic
987226156 5:15844059-15844081 TAGCGTCTTCAGGCAGTTACTGG - Intronic
988207445 5:28158224-28158246 TTGTATCTTCAAGCTTTTGGTGG + Intergenic
992970686 5:82054179-82054201 TGGAGTTTTCAAACTGTTGCTGG - Intronic
1000995849 5:167958557-167958579 TAGTTTCTTCATGGTGTTGATGG + Intronic
1001021261 5:168184323-168184345 TAGTGTCTGCACGCAGCTGCTGG - Intronic
1003465578 6:6376879-6376901 CAGTGTCTTCAAGATGTGTCTGG - Intergenic
1003668478 6:8133203-8133225 TTTTGTCTTCAGGCTTTTGCTGG + Intergenic
1005224969 6:23632164-23632186 TGGTGTCTTCACACTGTTGTTGG - Intergenic
1005655782 6:27935938-27935960 TAAAATCTTAAAGCTGTTGCTGG + Intergenic
1006506644 6:34493236-34493258 GAGTGTCTTCACCCTGATGCTGG + Intronic
1010672945 6:78708506-78708528 TATTGTTTTTAATCTGTTGCTGG - Intergenic
1010761611 6:79729911-79729933 TAATGTCTTCAAAATGCTGCGGG + Intergenic
1013290899 6:108717786-108717808 TGGTGGCTTCCTGCTGTTGCTGG + Intergenic
1021398264 7:20178410-20178432 TAATGTCTTCAAAATGTTGAAGG - Intronic
1028845829 7:95478928-95478950 TTCTGTCTTCAAGCAGTTGGGGG - Intronic
1030721919 7:112881338-112881360 TTGAGTCTTCAAGCTGTCCCTGG - Intronic
1031638570 7:124133109-124133131 TAATGTCTTCCAGTTGTTGCTGG - Intergenic
1032099664 7:128963423-128963445 TTCTGTCTACAAGCTGTTTCAGG - Intronic
1035253215 7:157610746-157610768 TTCTGTCATCACGCTGTTGCTGG - Intronic
1035548480 8:501968-501990 CAGTGTCTTAAAGCTGTTCTGGG + Intronic
1036501137 8:9315087-9315109 TAGTGTTTTCTTGCTGTAGCTGG + Intergenic
1036849302 8:12190565-12190587 CAGGCTCTTCATGCTGTTGCTGG + Intronic
1037403169 8:18514188-18514210 TAGTCTCTTCCAACTGGTGCTGG - Intergenic
1038053067 8:23831458-23831480 TGGTGTATTCCAGCTGTTGTAGG + Intergenic
1042712619 8:71735053-71735075 TAATGGCTTCCTGCTGTTGCTGG - Intergenic
1046036338 8:108846191-108846213 CAGTGTCTTCAGGCTGCTCCTGG + Intergenic
1052094919 9:24372193-24372215 TAATGTCCTCCAGTTGTTGCAGG - Intergenic
1053562721 9:39212384-39212406 TTCTGTCTCCAAGCTGTTGATGG + Intronic
1053828523 9:42050357-42050379 TTCTGTCTCCAAGCTGTTGATGG + Intronic
1054134429 9:61406658-61406680 TTCTGTCTCCAAGCTGTTGATGG - Intergenic
1054602038 9:67137097-67137119 TTCTGTCTCCAAGCTGTTGATGG - Intergenic
1059010144 9:110449030-110449052 TATTGTCCTCAAGATGCTGCTGG - Intronic
1059440645 9:114304933-114304955 CAGAGTCTCCAAGCTCTTGCTGG + Intronic
1203787569 EBV:136497-136519 CAGTGTCATAAAGGTGTTGCGGG - Intergenic
1186124945 X:6402976-6402998 GAATGTCTTCAAGCAGTTTCAGG + Intergenic
1186978352 X:14932640-14932662 TAATGTCTTCAAGATGATGCAGG - Intergenic
1187739169 X:22336669-22336691 AAATGTCTTCCAGCTGTTGAAGG - Intergenic
1189223663 X:39394883-39394905 TATTGTCATCCAGCTGGTGCTGG + Intergenic
1189952010 X:46242040-46242062 TAGTGTTTTTAATATGTTGCTGG - Intergenic
1192383966 X:70646418-70646440 TTGTGTCTTCACTCTGTTGATGG - Intronic
1193067530 X:77275495-77275517 TATTGTCCTCAAGCTGGTGGAGG + Intergenic
1195102037 X:101564528-101564550 AGGTGACTTCAAGCTGTGGCTGG + Intergenic
1198645942 X:138806695-138806717 GAGTATCTTCCAGCTTTTGCAGG - Intronic
1199495629 X:148449279-148449301 CTGTGTCAACAAGCTGTTGCTGG - Intergenic
1200283428 X:154798591-154798613 TAGTGACTGCAAGGAGTTGCGGG + Intronic
1200708053 Y:6459488-6459510 GAGGGTCTTTCAGCTGTTGCTGG - Intergenic
1201026059 Y:9705220-9705242 GAGGGTCTTTCAGCTGTTGCTGG + Intergenic
1201884938 Y:18870935-18870957 TTGTGTCTTAAAGCTTGTGCTGG + Intergenic