ID: 1091115742

View in Genome Browser
Species Human (GRCh38)
Location 11:133011492-133011514
Sequence GTTTTATAGCATGTCAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091115742_1091115746 8 Left 1091115742 11:133011492-133011514 CCAGAGTTGACATGCTATAAAAC 0: 1
1: 1
2: 0
3: 5
4: 107
Right 1091115746 11:133011523-133011545 GCAGGACTATGCTCAATTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1091115742_1091115744 -10 Left 1091115742 11:133011492-133011514 CCAGAGTTGACATGCTATAAAAC 0: 1
1: 1
2: 0
3: 5
4: 107
Right 1091115744 11:133011505-133011527 GCTATAAAACTCCAGAAGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091115742 Original CRISPR GTTTTATAGCATGTCAACTC TGG (reversed) Intronic
906384461 1:45355436-45355458 GTTTTGCAGTATATCAACTCCGG - Exonic
906836813 1:49092293-49092315 GTTTTAGAGTGTGTAAACTCAGG + Intronic
909477308 1:76095379-76095401 GTATTATAGCATTTCAAACCTGG + Intronic
910513339 1:88030811-88030833 ATTAAATAGCATGTCAACTCTGG - Intergenic
916628291 1:166583443-166583465 GATTTTTAGAAAGTCAACTCTGG - Intergenic
920751466 1:208681803-208681825 GTTTTTCAGCTTGTCAATTCAGG + Intergenic
1063894161 10:10661879-10661901 GTTCTAGAGCATCTCATCTCAGG + Intergenic
1065803053 10:29370047-29370069 GTTTCATAGCCTGCCAAGTCTGG + Intergenic
1066655926 10:37699988-37700010 GTTTTATAAGATGTTACCTCTGG + Intergenic
1067040419 10:42950259-42950281 GTTTTATAAGATGTTACCTCTGG + Intergenic
1068628699 10:59277450-59277472 GTTTTACAGAATGTCACCACTGG - Intronic
1072250327 10:93577263-93577285 GTTTTATAGCATCTCATGTGTGG + Intronic
1078858554 11:15226486-15226508 ATTTTATACCATTTCACCTCTGG + Intronic
1078866205 11:15299814-15299836 CTTTTAAAGCATCTCTACTCAGG - Intergenic
1079175125 11:18133052-18133074 GCTCTATAGCAGTTCAACTCTGG - Intronic
1081561204 11:44218685-44218707 GTTATACAGCATCTCAGCTCTGG - Intronic
1088055767 11:105575005-105575027 GTCCTAAAGCATATCAACTCTGG + Intergenic
1090815614 11:130291674-130291696 GTTTGATAGCATATCAATTTAGG + Intronic
1091115742 11:133011492-133011514 GTTTTATAGCATGTCAACTCTGG - Intronic
1093642776 12:21546771-21546793 GGTTTATTGCATGTCAAAGCTGG - Intronic
1100800111 12:98221991-98222013 TTTTTATAGTATGGCAAATCCGG + Intergenic
1107921967 13:45217905-45217927 CTTTTCTAGCCTGTCAATTCTGG + Intronic
1109356756 13:61239758-61239780 GTTGTATAGAATGACAGCTCTGG + Intergenic
1112427619 13:99318013-99318035 CTTTTATAGCTTTTCACCTCTGG + Exonic
1115554851 14:34536934-34536956 GTTTTGTAGTATGTTAACACTGG + Intronic
1116257896 14:42581188-42581210 GTTTTATTGCATTTCCACTGTGG - Intergenic
1117111062 14:52455043-52455065 GTTATAAAGCATGTCCATTCTGG - Intronic
1117523239 14:56572196-56572218 GAGTTATTTCATGTCAACTCAGG + Intronic
1119751733 14:77083430-77083452 GTTTTTTAGCAAGTCATATCTGG - Intergenic
1121747632 14:96312008-96312030 ATTTTAAAGCATTTTAACTCTGG - Intronic
1122240214 14:100359779-100359801 GTTTTATAGTATGTGAATTAAGG + Intronic
1124704407 15:31950710-31950732 GTTTTAGAGAATGTCAAATTGGG - Intergenic
1125878660 15:43172394-43172416 GTTTTACAGCATGTGAATTTCGG + Intronic
1129018330 15:72489799-72489821 TTTTTATAAGATGTCAACCCTGG + Intronic
1130346417 15:83050734-83050756 ATTTTAGAGCATGACAGCTCTGG + Intronic
1131642625 15:94308683-94308705 GTTTTAGAGCATTTCAACAGGGG + Intronic
1133838921 16:9391101-9391123 GTCTTATAGTATGTGAACTGTGG + Intergenic
1144388167 17:14769453-14769475 GTTCTACAGCATCACAACTCAGG + Intergenic
1146148932 17:30449761-30449783 CTTTTAAAGCATGTCAACCTCGG - Intronic
1146853670 17:36245836-36245858 GTTTTATTTTATTTCAACTCTGG - Intronic
1146869578 17:36369728-36369750 GTTTTATTTTATTTCAACTCTGG - Intronic
1147072454 17:37970352-37970374 GTTTTATTTTATTTCAACTCTGG - Intergenic
1147083978 17:38049889-38049911 GTTTTATTTTATTTCAACTCTGG - Intronic
1147099925 17:38173856-38173878 GTTTTATTTTATTTCAACTCTGG - Intergenic
1150082929 17:62257146-62257168 GTTTTATTTTATTTCAACTCTGG - Intergenic
1154106900 18:11531405-11531427 GTTGTTTAGCAAGTCAATTCTGG - Intergenic
1156072876 18:33234821-33234843 GCCTTATAGCATGTCGAATCTGG - Intronic
1163528021 19:17832984-17833006 GTTGCACAGCAAGTCAACTCAGG - Intronic
1164791358 19:30986964-30986986 ATATTATAATATGTCAACTCTGG + Intergenic
1168632342 19:57967336-57967358 GTTTTTTAACATGTGAACACTGG + Intronic
927037178 2:19190181-19190203 GTTTTACAGCAAATCAAGTCAGG - Intergenic
928631062 2:33192886-33192908 CTTTTATAACAAGTCCACTCTGG + Intronic
928774372 2:34740865-34740887 GTTTAATAGCATTTCATTTCTGG - Intergenic
929518827 2:42628642-42628664 GTTTTACAGCATCTCAATGCAGG - Intronic
935199841 2:100846827-100846849 ATTTTATAGCTTGTAAACTGAGG + Intronic
935598934 2:104902266-104902288 GTTTTAAAACATGAAAACTCTGG - Intergenic
936598990 2:113877103-113877125 GCTTTACAGCATGTCAAAACAGG - Intergenic
937736762 2:125299962-125299984 CTATTATAACATGTTAACTCTGG - Intergenic
939627502 2:144495951-144495973 TTTGTACAGCATGTCAAATCTGG - Intronic
940334584 2:152512094-152512116 GTTTTCTAGCATCTCAAGTGTGG + Intronic
945324039 2:208462573-208462595 GTTTTAAAACATATCAACTTGGG - Intronic
945932436 2:215868401-215868423 GTTTGTTAGCATCTCAACTAAGG + Intergenic
947109446 2:226703162-226703184 ATTATATAGCATCTCAGCTCTGG + Intergenic
951686880 3:25354326-25354348 GTTTTATAGGATGCTAAATCAGG + Intronic
953736754 3:45500867-45500889 GTTTTATAGCATCTCATGTGAGG + Intronic
954591344 3:51786219-51786241 GTTTTATAACATTTCCTCTCTGG - Intergenic
954722308 3:52575334-52575356 GTATTATAACATGATAACTCTGG - Intronic
957924880 3:86796154-86796176 TTTTTATATCATGTCGACTCCGG + Intergenic
958863909 3:99478586-99478608 GTTCTTTAGCCTGTCAATTCAGG + Intergenic
961426664 3:126853681-126853703 TGTTCATGGCATGTCAACTCTGG - Intronic
962683730 3:137826195-137826217 GTTTTATAACATCTCAAAACTGG + Intergenic
965991858 3:174828724-174828746 GGTTTATAACATGTAAATTCAGG - Intronic
967389287 3:188939646-188939668 GTTTCTTAGCATGTCATTTCTGG + Intergenic
971380617 4:26094050-26094072 TTTTTATAGAATGTTAACTTTGG - Intergenic
971474563 4:27060140-27060162 ATTTTATAGCATGTGACCTGGGG + Intergenic
972663277 4:41138771-41138793 GTTTTATTTCATGTCCAATCTGG - Intronic
977726183 4:100299585-100299607 GTTTGATGGCATGTCATCTAAGG - Intergenic
978119856 4:105065433-105065455 GGTTTCTGCCATGTCAACTCAGG + Intergenic
978749368 4:112230253-112230275 GTTTTGTAACATGTCACCACTGG - Intergenic
978890459 4:113820382-113820404 TTTTTATTGCATGAGAACTCTGG - Intergenic
981115970 4:140992077-140992099 GTTTTATATAAAGACAACTCAGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
987964880 5:24859525-24859547 GTTTTAAATCAAGTCAACTAAGG - Intergenic
989259310 5:39401425-39401447 GTTTGATAGAATCTTAACTCTGG - Intronic
995403950 5:111772853-111772875 GTTTCATAGCATGACAGCTTTGG + Intronic
997969394 5:138388154-138388176 CTTTTATAGCATGTAAAACCTGG - Intronic
1000043766 5:157504756-157504778 GTCTTCTAGCATCTGAACTCAGG - Intronic
1002318880 5:178363232-178363254 GTTTTATCACATGTTAATTCTGG + Intronic
1008448858 6:51625817-51625839 ATATTATTGCATGTAAACTCAGG - Intronic
1009855612 6:69259021-69259043 GTTTTACTGCATGTCAAATAAGG + Intronic
1016617977 6:146075030-146075052 GTTTCATAGCATATGAACTCTGG - Intronic
1018511851 6:164532836-164532858 GATTTATAGCAGGTCATTTCAGG + Intergenic
1024344494 7:48299280-48299302 GTTTAATATCATGTCAATTCTGG + Intronic
1030443763 7:109623568-109623590 GTTTTATAGCATGCCAACTCTGG + Intergenic
1030546226 7:110899520-110899542 GTTTTATAGAATATCAAATAAGG + Intronic
1032249309 7:130240602-130240624 TTTTCATATCATGCCAACTCAGG + Intergenic
1033946996 7:146731302-146731324 GTTTCATAGCCTAGCAACTCTGG - Intronic
1034837306 7:154364464-154364486 GTTTTACAGCTTGTTAACTGGGG - Intronic
1034889315 7:154825904-154825926 GTTTTATAGCTTCTCAAACCAGG + Intronic
1037107229 8:15124090-15124112 GTATTTTAGAATGACAACTCCGG + Intronic
1042609544 8:70582588-70582610 TTTTTAGAGTATGTCCACTCTGG - Intronic
1042912062 8:73837984-73838006 GTTTTGAAGCATCTCAAATCTGG + Intronic
1042955141 8:74241948-74241970 GTTTTGCAACATGACAACTCTGG - Intronic
1055981479 9:82006905-82006927 GTTTTATAACTTTTCATCTCTGG - Intergenic
1058173157 9:101706884-101706906 GTTTTATAGTCTCTCAAGTCAGG + Intronic
1061635112 9:131902984-131903006 GTTTTCTTGCCTGTCAACCCTGG + Intronic
1187537138 X:20152140-20152162 GCTTCATAGCATCTCAACTTTGG + Exonic
1187541794 X:20203815-20203837 CTTTTATAACGTGGCAACTCTGG + Intronic
1189709900 X:43798876-43798898 GTTTTCTAGCATGTGAACTGTGG - Intronic
1192791451 X:74385776-74385798 GTATTATAAAATGACAACTCTGG - Intergenic
1194479515 X:94402569-94402591 GTTCTATAGCTTTTCAAGTCAGG + Intergenic
1196710983 X:118762523-118762545 GAATTATAGCCTGTCAACACTGG - Intronic
1197254565 X:124249204-124249226 ATTTTATAGCATAGCAATTCTGG + Intronic
1198888443 X:141365549-141365571 ATTTTACAGCATGGCAACTGGGG - Intergenic