ID: 1091118768

View in Genome Browser
Species Human (GRCh38)
Location 11:133039546-133039568
Sequence ACCCATGAACAGGGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091118757_1091118768 30 Left 1091118757 11:133039493-133039515 CCACACTCATTTGAAGAGTGGAG 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1091118768 11:133039546-133039568 ACCCATGAACAGGGGGTGGATGG 0: 1
1: 0
2: 0
3: 16
4: 179
1091118762_1091118768 0 Left 1091118762 11:133039523-133039545 CCATTGGATGGTGGTCATAGTGC 0: 1
1: 0
2: 1
3: 0
4: 91
Right 1091118768 11:133039546-133039568 ACCCATGAACAGGGGGTGGATGG 0: 1
1: 0
2: 0
3: 16
4: 179
1091118761_1091118768 1 Left 1091118761 11:133039522-133039544 CCCATTGGATGGTGGTCATAGTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1091118768 11:133039546-133039568 ACCCATGAACAGGGGGTGGATGG 0: 1
1: 0
2: 0
3: 16
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091118768 Original CRISPR ACCCATGAACAGGGGGTGGA TGG Intronic
900873558 1:5324626-5324648 CCCCGAGAGCAGGGGGTGGAGGG - Intergenic
901641887 1:10696825-10696847 ACCCATGAGGAAGGTGTGGAGGG + Intronic
902513273 1:16977363-16977385 ACCCATGACCAGGGTGGGGAAGG - Intronic
903225913 1:21894226-21894248 AGCCATGCCCAGGGGGAGGAGGG + Intronic
914997611 1:152558682-152558704 ACCCCTGAACTGGGGCTGCAGGG + Intronic
915217500 1:154349829-154349851 ACCCATGAGCAGAGGGTAGTGGG + Exonic
916177685 1:162056219-162056241 ACCCATGAACAGGCGATGTTTGG + Intergenic
922603662 1:226875274-226875296 ACCCAGGGCCAGGGGGAGGAAGG + Intronic
922668265 1:227490881-227490903 ACCCATGTACAGGGGATTGTAGG - Intergenic
923618379 1:235556670-235556692 TTCCATGAACTGGGGGTGGGGGG + Intronic
923807411 1:237273001-237273023 TCCCATGAACCGGGGCTGGAGGG + Intronic
1063322884 10:5068690-5068712 CCCCATGGAGAGGGGGTGGCAGG + Intronic
1065968688 10:30788807-30788829 ACCCATGGGCAGAGGGTAGAGGG + Intergenic
1070989182 10:80716298-80716320 GCTCATGAACAGGGGGAGGGTGG - Intergenic
1074055663 10:109921515-109921537 TCCCATGAACTGGGGGTTGCAGG - Intronic
1074263792 10:111880974-111880996 GCTCATGAACATGGGATGGATGG + Intergenic
1074831791 10:117254664-117254686 AGCCCTGAGCTGGGGGTGGAGGG + Intronic
1075298590 10:121299958-121299980 ACCCATGAACCAGTGGAGGATGG - Intergenic
1076220890 10:128732175-128732197 ACCAATGAACAAGGCCTGGAGGG - Intergenic
1076879179 10:133231507-133231529 ACCCAAGAACGGGGGTGGGAAGG - Exonic
1077484184 11:2831358-2831380 ACCCATGAACAGGGGAGAGAAGG + Intronic
1078105539 11:8356046-8356068 ACCCCGTAACAGGGGGTGCAGGG + Intergenic
1080333524 11:31170264-31170286 ACCCAAGAAGAGTGGGTGGATGG - Intronic
1081572803 11:44302051-44302073 AGCCATGACCAGGGGCAGGAAGG + Intronic
1083378283 11:62243872-62243894 AGCCTTGAACAGGGAGAGGAAGG + Intronic
1084893214 11:72247186-72247208 AGCCAAGAACAGGGGGAGGCAGG - Intergenic
1086397617 11:86433039-86433061 ACCAATCAGCAGGGTGTGGATGG - Intergenic
1091118768 11:133039546-133039568 ACCCATGAACAGGGGGTGGATGG + Intronic
1092265466 12:6977415-6977437 ACCCATGAAGAGCCAGTGGATGG + Exonic
1092719954 12:11431762-11431784 ACCCTTGAAAAGAGGGTGGGTGG - Intronic
1101508283 12:105368850-105368872 ACCCATGAACAGAGGGTATTCGG + Intronic
1102339382 12:112109553-112109575 GTCCAGGAACAGGTGGTGGAGGG - Intergenic
1102460224 12:113095274-113095296 GACCATGAACAGGTGGTGGCAGG - Intronic
1102600093 12:114023069-114023091 ACCGAGGAAAAGGGGGTTGAGGG - Intergenic
1103340049 12:120216358-120216380 CCCCATGATGAGGGGGTGCAGGG - Intronic
1103477725 12:121230855-121230877 ACGCATGAGCAGGGGATGGATGG - Intronic
1103923404 12:124411012-124411034 ACCCAGGGACAGGGTGAGGAGGG + Intronic
1105046443 12:133007799-133007821 ACCCATGACCATGGGGAGGACGG - Intronic
1105970758 13:25427477-25427499 TCCCATGACCCGGGCGTGGAGGG - Intronic
1106436075 13:29723878-29723900 AGCCATTTGCAGGGGGTGGAGGG + Intergenic
1107553875 13:41500752-41500774 GGCCATGCAGAGGGGGTGGATGG - Intergenic
1107789900 13:43991298-43991320 ACCCAGGAATAGGGAGTGGGTGG + Intergenic
1110105701 13:71673561-71673583 TCCCATGGACACGGGGTGGGTGG + Intronic
1111890984 13:94082307-94082329 AACTATGAAGAGGTGGTGGAAGG - Intronic
1113398694 13:109972286-109972308 ACCCAAGAGCAGGTGGTGGAAGG - Intergenic
1113896954 13:113770659-113770681 AGCCAACAACAGGGGGTGGGTGG - Intronic
1114791671 14:25666516-25666538 ACACATGAGAAAGGGGTGGAAGG - Intergenic
1114876795 14:26730433-26730455 ATCCATGAAAAGCAGGTGGAGGG - Intergenic
1118151975 14:63199516-63199538 AGCCATGGACAGAAGGTGGATGG - Intergenic
1118684349 14:68276348-68276370 ATCCATGAAAAGAGGATGGATGG - Intronic
1121224501 14:92311340-92311362 ACCCATGACCATGGGGTGGGAGG - Intergenic
1122234329 14:100323398-100323420 ATCCATGAACAAGGTGTGGCGGG - Exonic
1132641289 16:979765-979787 TCCCAGGGGCAGGGGGTGGAAGG + Intronic
1133097033 16:3454342-3454364 ACCCATGGCCAGAGGGTGAAAGG + Intronic
1135823159 16:25702794-25702816 ACCCCTGAATTGGGGGTGTAAGG - Intronic
1141400350 16:83741954-83741976 TTCCATGAACAGGTGGGGGATGG - Intronic
1141763297 16:86043166-86043188 TCCCAAGAACAGGAGGTGGCAGG + Intergenic
1144758938 17:17696402-17696424 CCCCATGAACGGGTGGTGGGGGG - Intronic
1146159203 17:30550833-30550855 ACCCAGGAAGGGTGGGTGGAGGG - Intergenic
1146928065 17:36758544-36758566 CTCCATGAATAGGGGCTGGAGGG + Intergenic
1147125068 17:38361755-38361777 ACCTGTGAACAGGGGGCTGAAGG - Exonic
1147256193 17:39183908-39183930 TCCCAGGAACAGCAGGTGGAGGG + Intronic
1147898611 17:43769102-43769124 GCCTATGCACAGGGTGTGGAAGG + Exonic
1148227326 17:45908059-45908081 ACCCATTCACAGAGGCTGGAGGG - Intronic
1148389656 17:47262242-47262264 ACACATGAGCTGGGGGAGGAAGG + Intronic
1148743979 17:49908283-49908305 ACCCATCAACACTGGGTGGGAGG + Intergenic
1148845804 17:50529139-50529161 CCCCATGACCAGGGGGTCTATGG - Exonic
1150657700 17:67051223-67051245 ACCCAGGAACAGGGCAGGGAGGG + Intronic
1151490766 17:74431314-74431336 ACCCCGGAACAGGGAGTGGGGGG + Exonic
1151965468 17:77429037-77429059 AACCAGGAGCAGGGGGCGGAGGG - Intronic
1152085171 17:78213658-78213680 ACAAATGAACAGGGGAGGGATGG - Intergenic
1153765729 18:8373034-8373056 ACCAGTGAAGAGGTGGTGGAGGG + Intronic
1155155610 18:23154926-23154948 TCCCACCAACAGGGGCTGGATGG - Intronic
1156939026 18:42742401-42742423 ACCCATGAAGATGGGCTTGATGG + Intergenic
1157295969 18:46444356-46444378 ACCCAAAAAGAGGGGATGGAAGG - Intronic
1159194863 18:65100480-65100502 ACCTATGACCTGGGGGTGGGGGG - Intergenic
1160379285 18:78439267-78439289 ACTCATTAACATGGGGTGGGGGG - Intergenic
1160715740 19:575821-575843 ACCCATGAGCAGCAGGAGGAGGG - Intronic
1160994091 19:1873771-1873793 TCCCAAGAGCAGGGGGTGGTGGG + Intergenic
1161192787 19:2968410-2968432 TCCCAGGTACAGGGGATGGAGGG - Intergenic
1161221900 19:3121779-3121801 ACTCCTGAAGAGGGGGTGGGGGG + Exonic
1162852674 19:13442807-13442829 ACCCAAGATCAGGGAGGGGAAGG + Intronic
1163218078 19:15895308-15895330 ACACCAGAACAGGGGGTAGATGG + Intronic
1164483408 19:28633358-28633380 ACCCATCCACAGGGGCTGAAAGG + Intergenic
1164505866 19:28860774-28860796 AGCCATGAGAAGGGGGTGCAGGG + Intergenic
1167667756 19:50832653-50832675 ACCCAGGGAGAGGGGCTGGAAGG - Intronic
1168309865 19:55454989-55455011 CTCCTTGAACTGGGGGTGGACGG + Exonic
1168528446 19:57106701-57106723 GACCTTGAACAGGGGGTGGAGGG - Intergenic
925260396 2:2523761-2523783 ATCCATGAACTGAGCGTGGAAGG + Intergenic
929172877 2:38948995-38949017 ATCCAGGCACAGGAGGTGGAGGG + Intronic
929524083 2:42683453-42683475 TTCCATGGACTGGGGGTGGAAGG + Intronic
935402820 2:102678356-102678378 ATGCATGAAAAGGGGGGGGAAGG + Intronic
936151123 2:110023019-110023041 ACCCAAGAACATGTGGAGGATGG - Intergenic
936193552 2:110348350-110348372 ACCCAAGAACATGTGGAGGATGG + Intergenic
939564952 2:143775931-143775953 GCCCATGCACAGGGGGTTCAGGG - Intergenic
940389072 2:153110225-153110247 GCCCAGGAACAGGAAGTGGAGGG - Intergenic
941979710 2:171441478-171441500 TCCCATGAATAGGGGCTGGGTGG + Intronic
1169054975 20:2613161-2613183 ACACAGGAAGAGGGGGTGGTTGG - Intronic
1170353789 20:15470462-15470484 AACCTTCAACAGGGGTTGGAGGG + Intronic
1170470075 20:16659994-16660016 ATTCATGAACAAGGGGTGGAGGG + Intergenic
1170642531 20:18167106-18167128 ACCCAGCAACAGGGAGTGGAAGG + Intronic
1171456050 20:25273027-25273049 TCCCATGAAAAGGGGATGGGAGG - Intronic
1172182492 20:33012039-33012061 ACCCTGGAACAATGGGTGGATGG + Intronic
1172612175 20:36260437-36260459 ACCCAAGAACAGAGGTGGGAGGG + Intronic
1177721627 21:24914788-24914810 ACACATGGACACGTGGTGGAGGG - Intergenic
1178350844 21:31872659-31872681 CCCCCTGGACCGGGGGTGGAAGG - Intergenic
1179250050 21:39664717-39664739 ACCCAGCCACAGGGGGTGGTGGG - Exonic
1180967903 22:19800069-19800091 AACCAGGAACAGGGAGTGGTTGG - Intronic
1180995331 22:19962660-19962682 ACCCATGAGCAGGTTGTGGATGG - Exonic
1182058535 22:27380116-27380138 TCCCATGACCAGTGAGTGGAAGG - Intergenic
1183010421 22:34941862-34941884 ACCCAAGAACAGGGGTTGTTGGG - Intergenic
1183453299 22:37907889-37907911 GCCCAGGAGCAGGGGGTAGAAGG + Intronic
1183563803 22:38598086-38598108 ACCAATCAAGAAGGGGTGGAAGG - Intronic
1185048872 22:48543414-48543436 ACCCAGGAACAGCAGGTGGTGGG + Intronic
949723247 3:7015078-7015100 ACCCATCAGCAGGGTGTGGGCGG + Intronic
949911997 3:8918830-8918852 ACCCATCAACCAGAGGTGGAAGG + Intronic
950357417 3:12423590-12423612 GCAGATGAAGAGGGGGTGGAAGG - Intronic
952840462 3:37641298-37641320 TTCCATGAACGGGCGGTGGAGGG - Intronic
953042419 3:39267188-39267210 AACCATGAGCAGGAGGGGGAGGG + Intronic
953562534 3:44003813-44003835 ACCCTTGAGTAGGGGGTGGGGGG + Intergenic
953904156 3:46859982-46860004 ACCCAATCACAGGTGGTGGAGGG - Intronic
954005073 3:47584084-47584106 ATCCATCAACAGGGGATTGAGGG + Intergenic
956725418 3:72152707-72152729 ACCAATCCACAGGGGGTGAAGGG + Intergenic
960203382 3:114865526-114865548 ATCCATGTATAGGAGGTGGAAGG - Intronic
960629168 3:119711748-119711770 AGCCATGAAAAGGGTGTGGCTGG - Intronic
963087693 3:141453818-141453840 ACCCCTGACCAGGGGGTTAAGGG + Intergenic
964408980 3:156378863-156378885 ACCCAAAAACAGAGGGAGGAGGG + Intronic
964481435 3:157142554-157142576 CACAATTAACAGGGGGTGGAGGG + Intergenic
965274496 3:166663558-166663580 ACACCTGAACAAGGAGTGGAAGG - Intergenic
965807686 3:172558910-172558932 TCTCATGAAAATGGGGTGGATGG - Intergenic
966915696 3:184583160-184583182 ACGCAGGAACAGGCGGGGGAGGG + Intronic
971689222 4:29811411-29811433 ACCCATGAACATGGAGAGGACGG + Intergenic
972667944 4:41184912-41184934 TCCTGTGAACAGGAGGTGGAAGG - Intronic
973312764 4:48727441-48727463 ACCCATGAGCAGAAGGTTGAGGG + Intronic
976239742 4:82942644-82942666 TCCCAGGAGCAGGTGGTGGAGGG - Intronic
976484061 4:85580101-85580123 ACACATACACAGGGTGTGGAGGG - Intronic
978651414 4:111010010-111010032 TCCCATGGACAAGGGGTGCAGGG - Intergenic
980133554 4:128839018-128839040 ACCCATGAACTGAAGGTGGCAGG - Intronic
981129809 4:141145982-141146004 AGCAATGAACAGTAGGTGGAAGG - Intronic
982707246 4:158723507-158723529 AGCCAGGAACAGGTGGCGGAGGG - Intergenic
986171910 5:5321211-5321233 ACACATGGACAGGAGGTGGGGGG - Intergenic
989103658 5:37841175-37841197 AGCCATGCACAGGGTGTGTAAGG - Intergenic
997496058 5:134327180-134327202 TTCCATGAACAGGGGCTGGTTGG - Intronic
998121993 5:139586408-139586430 ACACTTGAAGAGGGGGTGGAGGG - Intronic
999663567 5:153890419-153890441 AGCCATGAAGAGCAGGTGGAAGG + Intergenic
999998260 5:157113051-157113073 ACCAATGGCAAGGGGGTGGAGGG - Intronic
1001205818 5:169762165-169762187 AGCCATGCACAGGGTCTGGAGGG - Intronic
1001566071 5:172700388-172700410 ACCCATGAAGGAGGGGTGGGCGG - Intergenic
1003095227 6:3137442-3137464 ACCTGTGAAAAGTGGGTGGATGG + Exonic
1003830549 6:10005422-10005444 AGCAATGAATAGGGGGTGGCAGG + Intronic
1005087894 6:22025610-22025632 TCCCAAGTGCAGGGGGTGGAGGG - Intergenic
1006928434 6:37672535-37672557 ACCAAAGAACAGGGTGAGGAAGG + Intronic
1008548158 6:52602085-52602107 AATCTTGAACAGCGGGTGGAAGG - Intergenic
1010444673 6:75936778-75936800 TCCCAGGATCAGCGGGTGGAGGG + Intronic
1011653209 6:89526067-89526089 ACCCATGGGCAGAGGGTAGAGGG - Intronic
1015549877 6:134401239-134401261 ACCCACAATCAGGGAGTGGAGGG + Intergenic
1015919488 6:138252612-138252634 CCCCAGGAGAAGGGGGTGGAAGG - Intronic
1015995447 6:138991599-138991621 ACCCAATAACAAGGGGTGAAAGG - Intergenic
1019180429 6:170184211-170184233 ACTCATGAAAAGGGGGTCGCAGG - Intergenic
1021909948 7:25375545-25375567 TCCCATGAACAGGGCTTGCAAGG - Intergenic
1023609638 7:41959919-41959941 CCACATGAGCTGGGGGTGGATGG - Intergenic
1029448531 7:100627875-100627897 CCCCAGGAATAGGGGGTGAAGGG - Intronic
1029649430 7:101880847-101880869 ACCCAGGACCTGGGGGTGGGGGG - Intronic
1031124068 7:117753709-117753731 ACACATGAACACATGGTGGAGGG + Intronic
1031158852 7:118142431-118142453 ACCCATATACAGAGGGTGGCTGG - Intergenic
1031915103 7:127555663-127555685 ACCCATGAGCACAGGGAGGAAGG + Intergenic
1032192531 7:129772982-129773004 ACCCAGCAAGGGGGGGTGGAAGG - Intergenic
1032990619 7:137390856-137390878 ACCAATGCATAGGGGGAGGATGG + Exonic
1033335214 7:140446520-140446542 TTCCATGGACAGGGGGTGGCAGG + Intergenic
1033348918 7:140546080-140546102 AGCCATGCAAAGGGGGTGGGAGG + Intronic
1034019332 7:147625066-147625088 ACTCATGGACATAGGGTGGAAGG + Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035065464 7:156101059-156101081 ACCCAAGACCGGGGGGTGGAGGG + Intergenic
1035084707 7:156248114-156248136 ACCCATGGACTGGGAGTGGTGGG + Intergenic
1036392448 8:8335710-8335732 AGCCAGGAACAGGGTGGGGAGGG - Intronic
1040531158 8:48267439-48267461 ACCCATGCACTGAGGGTGCATGG - Intergenic
1041893789 8:62901197-62901219 ACCCTTGATCATGGAGTGGATGG + Intronic
1043502547 8:80872824-80872846 AACCAGGAAAAGGGGGTGGGGGG - Intronic
1044000625 8:86875319-86875341 ATCCAAGACCAGGGTGTGGAGGG - Intronic
1045848096 8:106660624-106660646 ACGCATCAAGAAGGGGTGGAGGG + Intronic
1048960083 8:139569147-139569169 GCCCAAGGACATGGGGTGGAGGG + Intergenic
1053202958 9:36165189-36165211 ACCCGGGAGCAGGGGGTGGGTGG - Intergenic
1055466827 9:76574388-76574410 TCCCCTGAACAGGGTGAGGAGGG - Intergenic
1057485345 9:95478554-95478576 GCAAATGAACAGGGGGAGGAGGG - Intronic
1186129577 X:6452113-6452135 TCCCAAGGACAGGGTGTGGAGGG - Intergenic
1187050255 X:15688713-15688735 ACCCATCAACATTCGGTGGAGGG + Intergenic
1187058668 X:15764630-15764652 ACCCATCAACATTCGGTGGAGGG + Exonic
1187127672 X:16469301-16469323 ACCCAAGCAGAGGGGGAGGAGGG + Intergenic
1189200715 X:39193607-39193629 TCCCATGAACAGTGGATGGATGG + Intergenic
1190297871 X:49039124-49039146 GCACCTGAGCAGGGGGTGGACGG + Exonic
1191911599 X:66157442-66157464 ACCAATGAACAGAAGGTAGAAGG + Intergenic
1191948509 X:66562443-66562465 ACACATGGACACGGGGTGGGGGG + Intergenic
1192797957 X:74440140-74440162 AGCCATGACCAGGGTGAGGAGGG + Intronic
1196000297 X:110776597-110776619 ACCCATAAACTGTGGGGGGAGGG + Intronic
1200071299 X:153530773-153530795 TACCAGGAACAGGGGGAGGAAGG + Intronic
1201580608 Y:15508083-15508105 CCCCATGAACAGGTGGGGAAAGG + Intergenic