ID: 1091119359

View in Genome Browser
Species Human (GRCh38)
Location 11:133043876-133043898
Sequence ATGTATGCACAAATGAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 469}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091119359_1091119362 20 Left 1091119359 11:133043876-133043898 CCTTTATTCATTTGTGCATACAT 0: 1
1: 0
2: 4
3: 43
4: 469
Right 1091119362 11:133043919-133043941 TTGGTGATCTTCCAGGTACCAGG 0: 1
1: 0
2: 1
3: 8
4: 162
1091119359_1091119361 13 Left 1091119359 11:133043876-133043898 CCTTTATTCATTTGTGCATACAT 0: 1
1: 0
2: 4
3: 43
4: 469
Right 1091119361 11:133043912-133043934 ATACTTATTGGTGATCTTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
1091119359_1091119360 1 Left 1091119359 11:133043876-133043898 CCTTTATTCATTTGTGCATACAT 0: 1
1: 0
2: 4
3: 43
4: 469
Right 1091119360 11:133043900-133043922 CACTTAAAATAAATACTTATTGG 0: 1
1: 0
2: 3
3: 59
4: 637

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091119359 Original CRISPR ATGTATGCACAAATGAATAA AGG (reversed) Intronic
900883385 1:5398521-5398543 TTGGCTGCACAAATCAATAAAGG - Intergenic
901001300 1:6150159-6150181 ATGGATGGACAAATGGATGATGG + Intronic
901001319 1:6150278-6150300 ATGGATGGACAAATGGATGATGG + Intronic
901804457 1:11729390-11729412 ATGGAAGCACAAAGGAATTAAGG + Intergenic
903934550 1:26886204-26886226 ATGAGTGCACAAAGGAAAAAAGG - Intronic
904398361 1:30238920-30238942 ATGCATGCTCAGATGAAAAATGG - Intergenic
904747856 1:32721965-32721987 ATGAATGCAGAAATGAGTAGTGG - Intergenic
905907779 1:41631004-41631026 ATGAATACACAAATGAGTATTGG + Intronic
906557558 1:46725676-46725698 ATGAATGAATGAATGAATAAAGG - Intergenic
907114001 1:51952657-51952679 AGGAATGAATAAATGAATAAAGG + Intronic
907482820 1:54756316-54756338 GTGTATGCACAAAACAAGAAGGG + Intergenic
909333307 1:74441401-74441423 CTGTATGCATAAATAAATCATGG - Intronic
909841317 1:80328850-80328872 ATGAATGTAGAAATGAATATGGG + Intergenic
910011581 1:82470290-82470312 ATATGTGCACAGATGAATGATGG + Intergenic
910268982 1:85372178-85372200 ATGTATGAACATATGACAAAGGG - Intronic
910437878 1:87223893-87223915 ATATATGTACAAAATAATAAAGG - Intergenic
910718034 1:90254120-90254142 AATTATGCACAAATTAATATAGG - Intergenic
911272836 1:95824733-95824755 ATGGATACACCAATGACTAAAGG - Intergenic
912465132 1:109867197-109867219 ATGTAGTCACAAATGAACCAAGG - Intergenic
912594007 1:110855965-110855987 AGGTTTGGACAAATGTATAATGG - Intergenic
913623320 1:120633603-120633625 GTGGATTAACAAATGAATAAGGG + Intergenic
915986206 1:160467453-160467475 ATATATACACAAAAGAAGAAAGG - Intergenic
916350030 1:163838521-163838543 ATCTACCCACAAATGAAGAAGGG - Intergenic
917052899 1:170944099-170944121 ATATAAACACAAATGCATAAAGG + Intronic
917334351 1:173912930-173912952 ATGTATACAAAAATGACTGAAGG + Intronic
917783015 1:178419665-178419687 ATAAATGCAAAAATGAATGACGG - Intronic
918637240 1:186792431-186792453 ATGAATGAACAAATATATAATGG + Intergenic
920542429 1:206789379-206789401 ATGGATTCACAAAGGCATAAGGG - Intergenic
922654392 1:227368481-227368503 ATGAATGCACACGTGATTAAAGG + Intergenic
923796469 1:237161666-237161688 ATGTATCCATAAATGAGTAAAGG - Intronic
924386636 1:243504922-243504944 ATTGGTGCACAAATGAACAATGG + Exonic
924668903 1:246103128-246103150 AAGAATGAACAAATGAATATAGG + Intronic
1062769821 10:90668-90690 ATTTATGTCCAAGTGAATAAAGG - Intergenic
1063334727 10:5200369-5200391 ATGTATGCACATGTGTTTAATGG + Intronic
1063443999 10:6096999-6097021 AAGAATGCACAATTCAATAAAGG - Intronic
1063707791 10:8447707-8447729 ATCTATGGATAAATGGATAAAGG + Intergenic
1064633843 10:17344152-17344174 ATATATGCACAAATAAACCATGG + Intronic
1064866821 10:19890029-19890051 ATACATGAACAAATGAATGAAGG - Intronic
1065486427 10:26240390-26240412 AAACATGCACAAATAAATAAGGG - Intronic
1065658671 10:27981784-27981806 ATGAATGAACAATTGAATGAAGG - Intronic
1065775529 10:29116105-29116127 ATATGTGCACAAATGACTACTGG + Intergenic
1066398700 10:35052549-35052571 ATGAATGAATAAATGAATAGTGG + Intronic
1067294307 10:44966061-44966083 ATGTATGCAAAACAGATTAAAGG - Intronic
1068365224 10:56039690-56039712 ATGTAGCTACAAATGAATTATGG + Intergenic
1068528579 10:58159055-58159077 ATGGATGGTCAAATGAATCATGG - Intergenic
1069006581 10:63324083-63324105 ATATCTGCCCAAATGGATAAGGG + Intronic
1069083472 10:64113396-64113418 ATTTATCCTCACATGAATAATGG - Intergenic
1071768459 10:88697202-88697224 AAGGATGTACAAATGAATCATGG + Intergenic
1072667721 10:97406483-97406505 ATGTATAAATAAATAAATAAAGG - Intronic
1073881209 10:107982433-107982455 ATATATGAATAAAGGAATAAAGG + Intergenic
1074066568 10:110020166-110020188 TTGAATGAATAAATGAATAAAGG - Intronic
1077280559 11:1743165-1743187 ATGGATGGACAGATGAAGAATGG + Intronic
1077280564 11:1743203-1743225 ATGGATGGACAGATGAAGAATGG + Intronic
1077280579 11:1743297-1743319 ATGGATGGACAGATGAAGAATGG + Intronic
1077445967 11:2591016-2591038 ATGGATGCAGAAATGACCAAAGG - Intronic
1077481951 11:2819094-2819116 ATGAATGAACCAATGAACAAAGG - Intronic
1077821114 11:5741596-5741618 ATGAATGCACAAATGAGTGGGGG + Intronic
1078663910 11:13308858-13308880 ATGAACACACAAATGAATGAAGG - Intronic
1079339653 11:19601521-19601543 ATGGATAAATAAATGAATAAAGG - Intronic
1079436909 11:20464339-20464361 TTTTATGCACAAATGATTATTGG - Intronic
1079554102 11:21738411-21738433 ATGAATGAATAAATGAATGATGG + Intergenic
1079906587 11:26255725-26255747 ATGTATAAACAAATAAATAATGG - Intergenic
1080117295 11:28635254-28635276 CTGAATGAATAAATGAATAAAGG - Intergenic
1080609241 11:33889527-33889549 ATGAATGAACAAATGAGTGAAGG - Intronic
1080942956 11:36939737-36939759 ATTAATGCATAAATGAATGAAGG - Intergenic
1081229523 11:40567851-40567873 AAGTATACATACATGAATAAAGG - Intronic
1081538299 11:44011581-44011603 GTGAATGAATAAATGAATAAAGG + Intergenic
1082219374 11:49615026-49615048 ATGTATGTACACATGTATATGGG - Intergenic
1082580186 11:54856476-54856498 ATGAATGCACATATCAGTAAAGG - Intergenic
1082714270 11:56592961-56592983 ATGTCTGAACAACAGAATAAAGG + Intergenic
1084445084 11:69198955-69198977 ATAAATGGATAAATGAATAAAGG - Intergenic
1085792202 11:79505898-79505920 ATGCATGAACGAATGAATGAGGG - Intergenic
1086401987 11:86468373-86468395 ATGGATGGATAAATGAATGATGG - Intronic
1087454654 11:98368942-98368964 ATATATGCAGAAGTGAAAAAGGG - Intergenic
1087782421 11:102315302-102315324 ATGTCTGTAGAAATGAAAAAAGG + Intergenic
1087910856 11:103751853-103751875 ATGAATGAATACATGAATAATGG - Intergenic
1088120186 11:106360121-106360143 ATGGATTCACAAATTAGTAAGGG + Intergenic
1090410547 11:126506066-126506088 CTGTATGCAAAAATGAATTTAGG + Intronic
1091119359 11:133043876-133043898 ATGTATGCACAAATGAATAAAGG - Intronic
1091782257 12:3221203-3221225 TTGAATGAATAAATGAATAAGGG - Intronic
1091929716 12:4385677-4385699 ATGTATGCACATGTATATAATGG - Intergenic
1092075132 12:5666417-5666439 ATACCTGCCCAAATGAATAAGGG - Intronic
1092871140 12:12806951-12806973 ATGTATGTTCAGATGAAGAAAGG - Intronic
1093133805 12:15424605-15424627 ATGTATACACAAACAAATAATGG + Intronic
1093450125 12:19305014-19305036 ATGTGTCCACACATGAAAAAAGG - Intronic
1093789113 12:23226473-23226495 ATGTGTGAGTAAATGAATAAAGG - Intergenic
1094160483 12:27384565-27384587 ATGTATGCCCCTATGGATAAGGG - Intronic
1094349793 12:29511436-29511458 ATGAATGAATAAATGAATGATGG + Intronic
1095631520 12:44382214-44382236 ATGTATGTACAAATGAAGACAGG - Intronic
1095877982 12:47102874-47102896 ATATATGCAAAAATGGCTAAAGG - Intronic
1096960954 12:55576991-55577013 ATGGATGGACAAATGACTGAGGG + Intergenic
1097448251 12:59703077-59703099 AGGTATACAAAAATGGATAAGGG - Intronic
1097829907 12:64213349-64213371 ATGCATACACAAAAGAATATGGG + Intronic
1098711946 12:73773952-73773974 ATGAATGTAGAACTGAATAAGGG + Intergenic
1098928473 12:76381108-76381130 ATATATGGACATATAAATAAAGG - Intronic
1099666523 12:85637101-85637123 ATGAATCCACAAGTGAATAAAGG - Intergenic
1099788565 12:87299814-87299836 ATATATGAGTAAATGAATAAAGG - Intergenic
1100116781 12:91315378-91315400 ATGTCAGCACAAATGAATTAAGG - Intergenic
1100288998 12:93196017-93196039 AAGTATGCACAAATGCTTAACGG + Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100806333 12:98287937-98287959 ATGTTTCCTGAAATGAATAAAGG + Intergenic
1100866024 12:98857655-98857677 ATGAATGAATAAATGAATGAAGG + Intronic
1101670481 12:106867195-106867217 AGGTATGGACAAATGAACACAGG - Intronic
1102382812 12:112482273-112482295 ATGTATGCAAACATGAGTAACGG - Intronic
1102738432 12:115184063-115184085 ATCAATGAACAAATGGATAAAGG + Intergenic
1104590736 12:130082923-130082945 ATGTGTGCATGAATGTATAATGG + Intergenic
1105529479 13:21204950-21204972 ATGCATCCAAAAATTAATAATGG - Intergenic
1105697828 13:22907821-22907843 ATGTAGGCACAACTCAAAAATGG - Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106631341 13:31477985-31478007 ATGCAAGCAGAAATGTATAAAGG - Intergenic
1107614758 13:42154392-42154414 TTGTATTCACAAATAAATAGGGG + Intronic
1107672662 13:42761916-42761938 ATGAATAGAAAAATGAATAAAGG - Intergenic
1107738389 13:43422468-43422490 ATGTAATCACAAACCAATAATGG - Intronic
1107761086 13:43679603-43679625 ATGTAGCCACAAATGAGTAAAGG - Intronic
1107765821 13:43733417-43733439 CTCTATGCACAAATGAATCTTGG + Intronic
1109427242 13:62180944-62180966 ATGTAAAAATAAATGAATAAGGG + Intergenic
1109673624 13:65642521-65642543 ATGTATCCTAAAAGGAATAAAGG + Intergenic
1109984190 13:69954830-69954852 ATATATGCATAAATGAAACAAGG + Intronic
1110083065 13:71342347-71342369 GTGTATCAACAAATGCATAATGG + Intergenic
1110357964 13:74590312-74590334 CTGAATGCATAAATGAAAAAAGG + Intergenic
1110945737 13:81413516-81413538 ATTTATTCACAAATGAATAAAGG + Intergenic
1111366489 13:87252580-87252602 ATGTAATCACAAATGATTATTGG + Intergenic
1111867648 13:93789664-93789686 ATGTAGGCAGAAATGATTAGAGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112980442 13:105377929-105377951 ATGAATGCAGGAATGAATTAAGG - Intergenic
1113237605 13:108297875-108297897 AGGTTAGCACAAATGCATAATGG + Intronic
1113653023 13:112050639-112050661 ATGAATGAAGAAATGAATGAAGG + Intergenic
1115049635 14:29042066-29042088 ATGGATGAATAAATGAATAAAGG + Intergenic
1115794672 14:36921303-36921325 CTGTATGAACAAATGAACTATGG - Intronic
1116068833 14:40016997-40017019 ATGTATGGAGAAAAGAACAATGG + Intergenic
1116648259 14:47557847-47557869 TTGAATGTACAAATTAATAAAGG - Intronic
1117281934 14:54249504-54249526 ATGTACACACAAATGTATATTGG - Intergenic
1119134344 14:72203252-72203274 ATATAGGCACAAATGCATACTGG + Intronic
1119385782 14:74257493-74257515 AGTTATTTACAAATGAATAAAGG + Intronic
1120573177 14:86147320-86147342 ATATTTCCACAAATAAATAATGG - Intergenic
1120600417 14:86498127-86498149 ATGAATGGACAAATGAATTATGG + Intergenic
1120707437 14:87759427-87759449 AAGAATGCAAAAATGAATGAGGG - Intergenic
1121416322 14:93781585-93781607 ATGAAGGCACAGATGTATAAGGG + Intronic
1121899558 14:97681020-97681042 ATGGATGAACAAGTGAATGAAGG - Intergenic
1122877508 14:104675641-104675663 ATGGATGGACAGATGGATAATGG + Intergenic
1123810140 15:23916555-23916577 ATGTATGCACATAACAAAAATGG - Intergenic
1124086589 15:26556601-26556623 TGGTATGCACAAATAAATTAAGG + Intronic
1124805497 15:32877855-32877877 ATGAATGAGCAAATGAACAATGG - Intronic
1125046234 15:35244517-35244539 ATGGATGCATAAATGCATCATGG - Intronic
1125298288 15:38226403-38226425 AATTAGGCAAAAATGAATAAGGG - Intergenic
1125704797 15:41724471-41724493 TTGAATGCATAAATGAATATTGG + Intronic
1126395047 15:48205984-48206006 ATCTATTCCCAAATGACTAATGG + Intronic
1126463126 15:48935188-48935210 ATGTATGAATGGATGAATAATGG + Intronic
1128859724 15:71057590-71057612 ATATATCCACAAATGAATGTGGG - Intergenic
1131792357 15:95978969-95978991 ATGAATAAAGAAATGAATAAAGG - Intergenic
1131858511 15:96625897-96625919 ATGAAAGCACAAATGAGTATGGG + Intergenic
1132319062 15:100911491-100911513 ATGAATGAGCAAATGAATGATGG - Intronic
1133140789 16:3742371-3742393 ATATTTGCACATATGCATAACGG - Intronic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1133772154 16:8873220-8873242 TTGTTTGAACAAATGTATAATGG + Intergenic
1134204921 16:12229309-12229331 ATGTGTGCATGAATGAATAATGG + Intronic
1134231180 16:12431848-12431870 ATGAAAGAACAAATGAATGAAGG - Intronic
1134315366 16:13113926-13113948 ATGAATGAACAAATGAATAATGG - Intronic
1135086461 16:19478491-19478513 ATGGATGGATAAATGAATGATGG - Intronic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1138733130 16:59218122-59218144 ATTTATGTAGAAATGCATAAAGG - Intergenic
1138949692 16:61897215-61897237 ATGTATTTACAAGTGCATAAAGG + Intronic
1139209121 16:65059017-65059039 ATTTATGCACATATCAATATTGG - Intronic
1139610767 16:68056122-68056144 ATGTGTGCACACATCTATAAAGG - Intronic
1140021386 16:71242378-71242400 ATGTTTGCTCACATGAATGAAGG - Intergenic
1140453763 16:75092589-75092611 TTGTATGGACAAATGGATCAGGG + Intronic
1141854953 16:86674403-86674425 ATGGATGGATAAATGAATGAAGG - Intergenic
1143239346 17:5430730-5430752 ATGTTTGTACAAATGAGTTAAGG + Intronic
1143504078 17:7354320-7354342 ATGCACGCACACATGAAGAAAGG - Exonic
1144499904 17:15777351-15777373 ATGTATGCATATGTGAATAATGG + Intergenic
1146086217 17:29832442-29832464 ATGTTTGAATAAATGAATGATGG + Intronic
1146447008 17:32940198-32940220 ATGTATTCTCAAATGCATCATGG + Intronic
1148236049 17:45969896-45969918 ATGTATGATCAAATGGATAATGG - Intronic
1148317858 17:46719677-46719699 ATTGATGCAAAAATGGATAAAGG - Intronic
1149028760 17:52061049-52061071 AAGTATGAAAAAAAGAATAATGG + Intronic
1149382787 17:56110596-56110618 ATGAATGAACAAATGAGTGAAGG + Intergenic
1150584142 17:66502161-66502183 ATCCATGCACAGATGCATAATGG - Intronic
1150688184 17:67337586-67337608 GTGTTTGGACAAATGTATAATGG - Intergenic
1150984622 17:70181923-70181945 ATAAATGCATAAATGAATAAAGG + Intergenic
1151045378 17:70914167-70914189 ATGTATGCACAAATAAAGTAAGG - Intergenic
1152031137 17:77844092-77844114 ATGAATGGACAAATGAATTTTGG + Intergenic
1152314051 17:79569798-79569820 GTGTATGAACAGATGAATTATGG + Intergenic
1152493750 17:80655792-80655814 GTGTATGCACATATGACTGATGG + Intronic
1153714153 18:7828881-7828903 ACGTTTACACAAATGAATGATGG + Intronic
1155062272 18:22239166-22239188 ATGAATGCACTCATGAATGAAGG + Intergenic
1155468649 18:26167670-26167692 ATGTGTGCACACAAGAAGAAAGG + Intronic
1155484835 18:26330358-26330380 ATGGATGGACACATGACTAAGGG - Intronic
1155912356 18:31518583-31518605 ATATATACACAGATGCATAAAGG - Intronic
1157387982 18:47275905-47275927 AAGAATGCACAAATGAACATAGG + Intergenic
1158400054 18:57113842-57113864 ATTGATAGACAAATGAATAATGG - Intergenic
1159097038 18:63914991-63915013 ATGTTTGCATAAATTAAAAATGG + Intronic
1159697659 18:71580725-71580747 ATGTATTCCAAAATGAGTAAGGG - Intergenic
1160671284 19:364953-364975 ACTTCTGCGCAAATGAATAAGGG + Intronic
1161785082 19:6319498-6319520 ATGAATGAACGAATGAATGAAGG - Intronic
1161844673 19:6706065-6706087 ATGCATGCATGAATGAAGAAGGG + Intronic
1162059974 19:8088563-8088585 ATGAATGGTTAAATGAATAAGGG + Intronic
1162362779 19:10229991-10230013 ATGAATGAACCAATGAACAAAGG + Intronic
1162535296 19:11260070-11260092 ATGGATGAACAGATGAATATAGG + Intronic
1163534834 19:17871228-17871250 ATGAAGTGACAAATGAATAAAGG + Intergenic
1164073319 19:21789351-21789373 ATGTATCCCCATATGAACAAAGG + Intergenic
1164366711 19:27591737-27591759 ATGGATGCACAAATCACAAAGGG - Intergenic
1166148587 19:40854035-40854057 ATGTGTGCACACATGATTTAGGG + Intronic
1166152726 19:40885816-40885838 ATGTGTGCACACATGATTTAGGG + Intronic
1166177450 19:41084827-41084849 ATGTGTGCACACATGATTTAGGG - Intergenic
1166497871 19:43317228-43317250 ATGAATGCACACACGAACAAAGG + Intergenic
1166561447 19:43734945-43734967 AGGTTTGGACAAATGTATAAAGG + Intronic
1167077605 19:47258813-47258835 ATGAATGAATGAATGAATAATGG - Intronic
1168555944 19:57339985-57340007 ATGTAGACACAAATGGATTAGGG + Intergenic
925841071 2:7992882-7992904 CTGGATGTACAAGTGAATAAAGG + Intergenic
925985210 2:9209528-9209550 ATGTTTAAACAAATGAATCACGG + Intronic
926378465 2:12259868-12259890 ATGAATGAATAAATGAATGAGGG + Intergenic
926887086 2:17607747-17607769 ATAAATTAACAAATGAATAAAGG + Intronic
927462472 2:23310869-23310891 ATGACTGAACAAATGAATAAGGG + Intergenic
929246108 2:39705551-39705573 ATGTGGACACCAATGAATAAGGG - Intronic
930871564 2:56176151-56176173 CTGTATGCACACAAGAATATGGG + Intergenic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
931858856 2:66332756-66332778 ATGGATGAATAAATGAATGATGG + Intergenic
933486522 2:82931691-82931713 ATGTATGTATAAATGCAAAATGG + Intergenic
936791001 2:116151882-116151904 ATGAAAGCAAAAATGAAAAATGG - Intergenic
936901872 2:117490248-117490270 ATGCATGCACATTTGAATATGGG - Intergenic
937436709 2:121887430-121887452 CTGAATGAACAAATGAATGATGG - Intergenic
937503117 2:122505039-122505061 ATGTAGGTAAAAAGGAATAAAGG - Intergenic
938086560 2:128405826-128405848 ATGTATGCAAGAATGAATTAGGG - Intergenic
938544958 2:132319774-132319796 GTGTACACACAAATGAATGAAGG - Intergenic
939310776 2:140472228-140472250 ATGAATGAATAAATGAATGATGG + Intronic
939884888 2:147670842-147670864 ATGTGTGCAAACATGCATAATGG - Intergenic
941285339 2:163605500-163605522 ATCTCTGCACATATGAAGAAAGG + Exonic
941883983 2:170509607-170509629 TTATATACACAAATGAATCAAGG - Intronic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942287676 2:174437122-174437144 AAGTATGTACAAATAAACAAAGG + Intronic
942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG + Intronic
945801708 2:214440717-214440739 ATGTATGAACAACTGAAGAATGG - Intronic
946095891 2:217273829-217273851 ATGAATGCAGGAATGAATGAAGG + Intergenic
946374607 2:219300429-219300451 GTGGATGCATGAATGAATAAAGG + Intronic
946620551 2:221557456-221557478 ATATATGCATGAATGTATAAAGG - Intronic
946783092 2:223212906-223212928 ATCTAAGGACAAATGACTAAAGG - Intergenic
947062638 2:226183559-226183581 CTGAATGAATAAATGAATAACGG + Intergenic
947558808 2:231126612-231126634 ATCTATAAACAAATCAATAAAGG - Intronic
1168865712 20:1084717-1084739 ATGAATGAATAAATGAATGATGG + Intergenic
1169393223 20:5206916-5206938 ATGTTTGCAGCAATAAATAATGG - Intergenic
1169814767 20:9644988-9645010 ATATATGCATACATGAAAAATGG + Intronic
1170476977 20:16725144-16725166 GTGTAGGCACTAATGATTAAAGG - Intergenic
1172051854 20:32123643-32123665 ATGTATATATAAATGTATAAGGG - Intronic
1172616286 20:36287396-36287418 ACTCATGCACAAATGAATACAGG - Intergenic
1172747818 20:37226528-37226550 ATGTATGTATAAATAAATAAGGG + Intronic
1172899882 20:38327017-38327039 ATGAATGCATAAATCAACAATGG - Intronic
1173057691 20:39632049-39632071 ATTAATGAACAAATGAATGAAGG - Intergenic
1173066276 20:39715496-39715518 CAGTAAGCACAAAGGAATAAGGG - Intergenic
1173129796 20:40380751-40380773 ATGTAAGCAAAAATAAAGAAGGG - Intergenic
1173281521 20:41632417-41632439 ATATACACACAAAAGAATAATGG + Intergenic
1173951056 20:46993532-46993554 ATGAATGAACAAATGAATGAAGG - Intronic
1174481579 20:50834930-50834952 ATGCATGGACAAATGAAGTATGG - Intronic
1175196612 20:57248164-57248186 CTGTATGCACATATAAATAGAGG - Intronic
1175302408 20:57952291-57952313 ATGGATGGATAGATGAATAATGG - Intergenic
1175682859 20:61003994-61004016 GTGTATGCACAAATGAGAACTGG + Intergenic
1175817351 20:61890245-61890267 ATGGATGCATAGATGGATAATGG + Intronic
1175817369 20:61890345-61890367 ATGTATGGATAGATGGATAATGG + Intronic
1177323989 21:19559601-19559623 ATTAATACACAAATGATTAAAGG - Intergenic
1177484745 21:21742764-21742786 ATGTTTGCAAAAAGTAATAAAGG - Intergenic
1177538978 21:22466926-22466948 ATGTATACACAAAAGACTAAAGG + Intergenic
1177711981 21:24788699-24788721 TGGTATGCATAAATGAATATTGG - Intergenic
1177990679 21:28032064-28032086 ATGTTTTCACAAAAGAAAAATGG + Intergenic
1178062481 21:28867254-28867276 AAGTATGAATAAATGAATAGTGG + Intergenic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1181737491 22:24893192-24893214 ATGTATGCATGAATGAATAAAGG + Intronic
1182124041 22:27803844-27803866 ATTTAGGCACAAAGAAATAAAGG + Intergenic
1182140101 22:27947179-27947201 ATATTTGAAGAAATGAATAATGG - Intergenic
1182954415 22:34407935-34407957 ATGAATGGACAAATGAGTATTGG - Intergenic
1183330147 22:37215129-37215151 ATGTATGCACCGAGGCATAAGGG - Intergenic
1184493271 22:44822926-44822948 ATGTAGGCCCAGATGAATAGAGG + Intronic
1184659055 22:45957232-45957254 ATGTATGTAAAAATGCATCAAGG + Intronic
1184996797 22:48213133-48213155 ATGGATGGATGAATGAATAATGG - Intergenic
1185212921 22:49581940-49581962 ATGGATGGACAGATGAATAATGG - Intronic
949104150 3:182957-182979 AAGCATGCATAAAGGAATAAGGG - Intergenic
949691788 3:6648842-6648864 ATGGATGAACGAATGAACAACGG - Intergenic
949783010 3:7711165-7711187 ATGTATGCAGAAAATCATAAGGG + Intronic
949847746 3:8389212-8389234 ATCTAGGCACAAATGGACAAAGG + Intergenic
951820285 3:26801146-26801168 ATGTATAGAAAAATGTATAAAGG - Intergenic
951946140 3:28138609-28138631 ATGTATAAACAAATGAGAAAGGG + Intergenic
952580362 3:34825369-34825391 ATATATGCAAAAATAAATATTGG + Intergenic
953499953 3:43423670-43423692 ATTAATGCACAAATAAATACTGG - Intronic
953677761 3:45016530-45016552 AAGTTTGCACAAAGGGATAAGGG + Intronic
954900037 3:54011225-54011247 ATGAATACATGAATGAATAAAGG - Intergenic
954944576 3:54409025-54409047 AAGAATACATAAATGAATAAAGG - Intronic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
955040134 3:55308377-55308399 AGGTTTTCACAAATGAATTAGGG + Intergenic
955200284 3:56845821-56845843 ATGAATAAAGAAATGAATAAAGG + Intronic
955206596 3:56901218-56901240 ATACATGGATAAATGAATAAAGG + Intronic
955367794 3:58326454-58326476 ATGTATGAACAAACCAAAAAAGG - Intergenic
955452614 3:59086112-59086134 ATAGATGCACGCATGAATAAAGG - Intergenic
956817756 3:72923940-72923962 ATTTATGCAGACATGAATGAAGG + Intronic
956861401 3:73327446-73327468 ATGTGGGCACAGATGAGTAAGGG + Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957178645 3:76847406-76847428 ATGTATGTACAAGAGATTAATGG + Intronic
957461535 3:80527623-80527645 ATGGATCCTCAAATGATTAATGG + Intergenic
957661811 3:83165893-83165915 ATGTACAAACATATGAATAATGG - Intergenic
957795915 3:85006913-85006935 ATCAATGCACGAATGTATAATGG - Intronic
958002595 3:87770074-87770096 ACGTATTCAGAAATGAAAAAAGG - Intergenic
958884882 3:99714632-99714654 ATGGATGGATAAATGAATGATGG - Intronic
959012969 3:101099580-101099602 ATGAATGCATGCATGAATAAAGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959770873 3:110094169-110094191 AGGTTTGAACAAATGTATAATGG + Intergenic
961538732 3:127586336-127586358 ATATATGAATAAATAAATAATGG - Intronic
963565753 3:146928206-146928228 CTGAATGAATAAATGAATAAAGG - Intergenic
963821643 3:149902141-149902163 ATGAATTCACATATGAAAAAGGG + Exonic
964371658 3:156006391-156006413 ATGAATGAACCAATGAAGAAAGG + Intergenic
964590546 3:158358990-158359012 ATGTACTCACAATAGAATAAAGG - Intronic
965337478 3:167444922-167444944 ATCAATGCACAAGTAAATAATGG - Intronic
965482491 3:169236432-169236454 ATGAATACATAAATGAATAAGGG + Intronic
966016317 3:175142194-175142216 TTAGATGCACAAATGAAAAATGG - Intronic
966179211 3:177172415-177172437 ATGCATGTAAAAAGGAATAAGGG + Intronic
967190323 3:186979126-186979148 TTGTGTGAACAAATGAATGAGGG + Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968411336 4:393230-393252 ATGAGAGCACACATGAATAAAGG - Intergenic
968785162 4:2616310-2616332 ATGTACACACTAATGAAAAAAGG - Intronic
969100647 4:4765714-4765736 ATCTGTGCACTAAAGAATAATGG + Intergenic
969389234 4:6878368-6878390 ATGTATGTATGAATGAATGATGG - Intronic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
969931047 4:10630928-10630950 ATGGATGGAGAAATAAATAAGGG + Intronic
969962913 4:10964315-10964337 ATGTGTGCACACATGAACACAGG + Intergenic
970326614 4:14931465-14931487 AGGAATGCAAAAATGTATAATGG - Intergenic
970356511 4:15258994-15259016 CTGTATGCACAAATGCATGAAGG - Intergenic
971364290 4:25965139-25965161 ATCTTTGAAGAAATGAATAAGGG - Intergenic
971776950 4:30978091-30978113 ATGTATGCCCCAATTAATAGAGG + Intronic
972012614 4:34203800-34203822 ATGGTTAAACAAATGAATAAGGG - Intergenic
972058102 4:34829242-34829264 ATGAATGAATAAATTAATAATGG - Intergenic
972214106 4:36875534-36875556 ATGAATGAATAAATGAATAGAGG + Intergenic
972752487 4:42005798-42005820 ATTAATGAATAAATGAATAAAGG - Intronic
972919767 4:43924110-43924132 ATATATGAATAAATGAATGAAGG + Intergenic
973569943 4:52228079-52228101 ATCAATGCTTAAATGAATAATGG + Intergenic
973649419 4:52983424-52983446 ATGTATGCACAAATGTTCAAAGG + Intronic
976020192 4:80614103-80614125 ATGTATACAGAAATGAAAAGGGG - Intronic
976256415 4:83105255-83105277 ATCAATGAACAAATGAATGAAGG - Intronic
976335616 4:83882136-83882158 ATGTATGTACATATGAATACAGG + Intergenic
976508348 4:85877259-85877281 AGGAAAGCAAAAATGAATAATGG + Intronic
977484772 4:97629039-97629061 ATGCATATACAAATGAATATGGG - Intronic
978998729 4:115189597-115189619 GGGTATGGACAAATGTATAATGG + Intergenic
979936704 4:126707252-126707274 ATGTTTGTATAAAGGAATAAAGG - Intergenic
980317607 4:131223024-131223046 AGATATGAATAAATGAATAAAGG + Intergenic
981427240 4:144617621-144617643 ATATATGTAGAAATAAATAAAGG + Intergenic
981854186 4:149267917-149267939 ATGCATACATAAATGAATAAGGG + Intergenic
982079286 4:151771972-151771994 ATTAATGCACAAATCAAAAAAGG + Intergenic
982587820 4:157264850-157264872 ATTTATGAACAAATGGCTAAAGG - Intronic
982983924 4:162179536-162179558 ATGAATCCACAACTAAATAATGG - Intergenic
983019246 4:162654677-162654699 ATGGATGAATAAATGAGTAAAGG - Intergenic
983796690 4:171872952-171872974 ATAGATACACAAATGAATTATGG + Intronic
983823214 4:172223616-172223638 AAGTTTGAATAAATGAATAATGG + Intronic
983956084 4:173700140-173700162 ATGTATGAACACATCAGTAATGG - Intergenic
984317890 4:178151333-178151355 ATAAATGAACAAATGAATAGAGG - Intergenic
984602598 4:181745606-181745628 AAGTAAGCACAAATGCAGAAAGG + Intergenic
984674341 4:182529672-182529694 ATAAATGAACAAATGAATGAAGG - Intronic
986551453 5:8960692-8960714 ATGTAAGCACAAATCAAACAAGG + Intergenic
987103508 5:14614050-14614072 ATATATGCAAGCATGAATAAAGG + Intronic
987162553 5:15159205-15159227 ATGAATGTATAAATGAATTAGGG - Intergenic
987273189 5:16334855-16334877 AGGTTTGGACAAATGTATAATGG - Intergenic
987701138 5:21399896-21399918 ATTTATCAACAAATGAAGAAAGG + Intergenic
987729489 5:21750008-21750030 ATGTATTTATAAATGAATAACGG + Intergenic
988434824 5:31161895-31161917 GGGTATGCACAAAAGAACAAAGG + Intergenic
988865929 5:35335050-35335072 ATGAATGAACCAATGAATGAAGG - Intergenic
989264909 5:39462284-39462306 ATGTATGCACACATGAAACATGG - Intronic
990168102 5:53017707-53017729 ATGAATGCACACAGGAATACTGG - Intronic
991152929 5:63393073-63393095 ATTTATGCACAAGTCAAAAAAGG + Intergenic
992117093 5:73549557-73549579 ATTCATGCACAAATAAAAAATGG + Intergenic
993340895 5:86723957-86723979 ATGCATGGATAAATAAATAATGG + Intergenic
993743469 5:91566720-91566742 AAGCATGCAGAATTGAATAATGG + Intergenic
993958129 5:94262737-94262759 ATGTATCCTTAAATTAATAAGGG - Intronic
994964396 5:106649703-106649725 ATGTCTGCACAACTGAAGGAAGG + Intergenic
995273585 5:110251618-110251640 ATGTGTCCACAATTGAATTAGGG + Intergenic
995806873 5:116063215-116063237 ATGAATGAATAAATGAATAATGG - Intergenic
996117466 5:119634139-119634161 ATGCAGGTACAAATGAACAAAGG + Exonic
996125276 5:119718952-119718974 ATCTCTGAATAAATGAATAATGG + Intergenic
996382041 5:122872264-122872286 ATTTAAGAACAAATGAATAATGG + Intronic
996889179 5:128397114-128397136 ATGTATGCACACATAATTAAAGG + Intronic
997729710 5:136159137-136159159 ATGTATGTATATATGAATACTGG + Intronic
998522018 5:142809731-142809753 ATGGATGGACAGATGAATGAAGG - Intronic
998707620 5:144781739-144781761 ATGTATGGATAAATGAGAAAAGG + Intergenic
998985129 5:147748546-147748568 AAGTTTGCACAGATGAATACTGG + Intronic
1000901958 5:166921903-166921925 ATGAATGAACAAATGAATGAAGG + Intergenic
1002598772 5:180341575-180341597 ATGTTTGCACATATGTATTAAGG + Intronic
1002923148 6:1587623-1587645 AGTTATGAACAAGTGAATAAAGG + Intergenic
1002993619 6:2261363-2261385 GGGTATGGACAAATGTATAATGG + Intergenic
1004022129 6:11785680-11785702 AGGTATGCACAAAGTACTAATGG + Intronic
1005113032 6:22306693-22306715 ATGTATACATTATTGAATAAGGG + Intergenic
1005627268 6:27674835-27674857 TTGTATGCACACAAGAAAAAAGG + Intergenic
1006743521 6:36325592-36325614 ATGGAAGCACAAAGGGATAAGGG - Intronic
1007950785 6:45870309-45870331 ATGTTTGCACAAATATATCAGGG + Intergenic
1008424456 6:51340724-51340746 ATATATACACACATGTATAAAGG + Intergenic
1008835515 6:55822545-55822567 ATTAATGAAAAAATGAATAATGG - Intronic
1009784220 6:68311286-68311308 ATTTATGAACAAATGGTTAAAGG + Intergenic
1010175972 6:73028333-73028355 ATGTAAGCACGGATGAAAAAGGG + Intronic
1011227937 6:85128229-85128251 ATGTATGTACATATGTATGAAGG + Intergenic
1011396636 6:86916972-86916994 ATGCATGCACAAAAATATAAGGG + Intergenic
1012071778 6:94629574-94629596 ATGTATATACACATTAATAAAGG + Intergenic
1012442684 6:99276257-99276279 ATGAATGAATAAATGAATACAGG + Exonic
1012552492 6:100476860-100476882 ATGTTTGCAGTATTGAATAAGGG + Intergenic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1013898184 6:115118554-115118576 ATGTTTGAATAAATGAATACTGG + Intergenic
1013934557 6:115578305-115578327 ATGTATGTAAAAATTTATAAAGG + Intergenic
1014731121 6:125032245-125032267 ATCTTTGCACTAATGAATTATGG - Intronic
1014982855 6:127965977-127965999 ATGTAAGTAGAAATGATTAAGGG + Intergenic
1015895408 6:138011998-138012020 ATATATGAAAGAATGAATAAGGG - Intergenic
1017011396 6:150066113-150066135 ATGTCTGGGCAAATGAATGATGG + Exonic
1017506184 6:155070811-155070833 ATGTAGACACACATAAATAAAGG - Intronic
1017937879 6:159023020-159023042 ACATATGCACAACTGTATAAAGG + Intergenic
1020155193 7:5717551-5717573 ATGTATGCACAAACTTATCATGG + Intronic
1021406834 7:20277512-20277534 ATGAATGCATGAATGAATAACGG - Intergenic
1022184931 7:27958081-27958103 ATGTATGAGTAAATTAATAAAGG - Intronic
1024039617 7:45542138-45542160 TTGTCAGCACAAATGAAGAAGGG - Intergenic
1024189550 7:46992228-46992250 ATACATGTACAAATGGATAATGG + Intergenic
1025217324 7:57069801-57069823 ACGTATTCAGAAATGAATACGGG - Intergenic
1025261613 7:57424077-57424099 ATGTATATAAAAATGAATCATGG + Intergenic
1025628242 7:63243453-63243475 ACGTATTCAGAAATGAATACAGG - Intergenic
1025654024 7:63500662-63500684 ACGTATTCAGAAATGAATACGGG + Intergenic
1025818471 7:64942193-64942215 ATGTGTTCCAAAATGAATAAAGG - Intergenic
1027435959 7:78164468-78164490 ATGTCTGCACAAATGCCTATAGG - Intronic
1027760649 7:82274872-82274894 ATGAATGAATGAATGAATAATGG + Intronic
1027941270 7:84683747-84683769 ATGAATGCAACAATGAATACGGG + Intergenic
1030153957 7:106433508-106433530 AGGTATGCACAAATCAATACAGG + Intergenic
1030369481 7:108682169-108682191 AGGTATAAACAAATGAATACAGG + Intergenic
1030576948 7:111299872-111299894 ATACAAGCACAAATGAACAAGGG + Intronic
1031730725 7:125297636-125297658 ATGTATACAAAATTTAATAATGG - Intergenic
1031793312 7:126137911-126137933 ATGCCTGAACAAATGAATGAAGG - Intergenic
1032001391 7:128267730-128267752 GTGTATGCACAAATGCACACTGG + Intergenic
1033870889 7:145752175-145752197 ATGTATGCACCCATGAAGCAGGG + Intergenic
1036374023 8:8184705-8184727 GTGTAAGTACAAATGAAAAATGG - Intergenic
1036540093 8:9698643-9698665 TGGCATGCAAAAATGAATAAAGG - Intronic
1036911580 8:12761754-12761776 TTGTATGAACAAATGAGAAAAGG + Intergenic
1037049509 8:14352898-14352920 ATGTATGCAGAGATCAATTAGGG - Intronic
1037204604 8:16300585-16300607 ATATACACACACATGAATAAAGG + Intronic
1037444587 8:18952070-18952092 ATGCATGAACTAAAGAATAATGG + Intronic
1037512588 8:19598861-19598883 ATGAATGGAAAAGTGAATAAAGG - Intronic
1039603356 8:38860703-38860725 ATGTATACATAGATGAAAAATGG + Intergenic
1039673480 8:39632161-39632183 ATGTATACATAAATGCAAAACGG - Intronic
1041921368 8:63186276-63186298 ACCTATGGACAAATGAGTAATGG + Exonic
1042095043 8:65205562-65205584 TTTTATGCACAATTGAATAGAGG - Intergenic
1042740034 8:72032898-72032920 ATGCGTGCATAAATGGATAAAGG + Intronic
1042755703 8:72208245-72208267 ATGTGTGCATAAATGGATAAAGG + Intergenic
1042990971 8:74639393-74639415 ATGTATGCCCAAATGATGAAAGG - Intronic
1044278426 8:90328859-90328881 CTGTTTCCACAAATCAATAAAGG + Intergenic
1044536934 8:93368179-93368201 ATGTAATCACAAATGAACAAAGG - Intergenic
1045006715 8:97922469-97922491 ACGTCTGAAAAAATGAATAAAGG - Intronic
1045126679 8:99099286-99099308 ATTTATGCTCAAATGGTTAAAGG - Intronic
1045229171 8:100284509-100284531 ATGTATGGCCAAATTAATCACGG + Intronic
1045440607 8:102205333-102205355 ATTCATGCACAAATAAAAAATGG + Exonic
1045692326 8:104772851-104772873 ATGAATGAATAAAGGAATAAAGG + Intronic
1045812245 8:106235755-106235777 ATGTGTGTACACATGAATATAGG + Intergenic
1046542796 8:115608474-115608496 ATGTAAATACAAATAAATAAAGG - Intronic
1046698069 8:117364895-117364917 ACATATGCACAAATTAAAAATGG - Intergenic
1046772039 8:118126023-118126045 GTGAATGAACAAATGAATCAAGG + Intergenic
1046796495 8:118379351-118379373 AAGGATGCACAAATAAGTAATGG - Exonic
1046844346 8:118899353-118899375 ATGACTGAATAAATGAATAAAGG - Intergenic
1046976959 8:120289916-120289938 ATGGATGGATAAATAAATAATGG + Intronic
1047033017 8:120904117-120904139 GAGTATACACAGATGAATAAGGG + Intergenic
1047351654 8:124080110-124080132 ATGAATGACCAAATGAACAATGG + Intronic
1047947437 8:129895714-129895736 ATTTATGAATAAATGAATGAGGG + Intronic
1047952339 8:129945237-129945259 ATGAATGAACAAATGGATTAGGG - Intronic
1048196961 8:132339299-132339321 ATGAATGAATAAATGAGTAACGG - Intronic
1048615835 8:136074717-136074739 ATGCAGGGACAAATGAATATGGG + Intergenic
1049132507 8:140860257-140860279 ATGTATGCATACATGTACAAGGG - Intronic
1049341671 8:142115960-142115982 ATGAATAGATAAATGAATAAGGG - Intergenic
1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG + Intronic
1050111427 9:2220603-2220625 ATGTATGGATAAATAAATCATGG - Intergenic
1050212023 9:3271399-3271421 ATGAAAGCAAAAATGAAAAATGG - Intronic
1050384074 9:5066001-5066023 ATTTATGGATACATGAATAAAGG - Intronic
1051372525 9:16370672-16370694 ATGAATGCACAGTTGAATCATGG - Intergenic
1052287883 9:26807252-26807274 TTGTCTGCAGAAATGGATAAGGG + Intergenic
1052333046 9:27290541-27290563 ATGGATGTACACATGTATAAAGG - Intronic
1052646030 9:31234226-31234248 ATGTATACAAAAATTAGTAAAGG - Intergenic
1052651845 9:31313787-31313809 ATGTATGCAGAAATACAGAATGG - Intergenic
1052756060 9:32542882-32542904 AAGGATGAACAAATAAATAAAGG - Exonic
1052810192 9:33051394-33051416 AGGTTTGGACAAATGTATAATGG - Intronic
1054918877 9:70522019-70522041 ATGAATGAACAAATGAATAATGG - Intergenic
1054987063 9:71274096-71274118 ATGGATGAACTAATGGATAAGGG - Intronic
1055858585 9:80722252-80722274 ATGAATGAACAAAAGAACAAAGG - Intergenic
1056804718 9:89719719-89719741 ATGTATGAACAAAATAAAAATGG + Intergenic
1056830214 9:89910836-89910858 ATGTATACACAATGGAATATTGG - Intergenic
1057789145 9:98111192-98111214 ATGGATGGATGAATGAATAATGG + Intronic
1058756509 9:108087747-108087769 ATGAATGAACAAATTAATTAAGG + Intergenic
1058977809 9:110140947-110140969 AAGTTTCAACAAATGAATAATGG + Intronic
1060399070 9:123337120-123337142 ATGAATGAACAAATGAATGAAGG - Intergenic
1062195930 9:135274095-135274117 ATATATACACCCATGAATAAAGG + Intergenic
1185632753 X:1527364-1527386 ATGAATGGGCAAATGAATAGTGG - Intronic
1185980122 X:4769888-4769910 ATATTTGCAAAAATGAACAATGG + Intergenic
1186559235 X:10592960-10592982 ATTTATGATCAAATGAAAAAAGG - Intronic
1187727410 X:22217862-22217884 ATATATGAAGAAATCAATAATGG - Intronic
1187761215 X:22587887-22587909 ATGAATGTGCAAATGTATAAGGG - Intergenic
1188029951 X:25253202-25253224 ATGAATGAACAAATGAATGAGGG + Intergenic
1188073873 X:25751502-25751524 ATATATGCACAATTTAAAAATGG - Intergenic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1189960978 X:46324528-46324550 ATGTAGGCATAAATGATTACCGG - Intergenic
1190560226 X:51679627-51679649 ATGGATGAACAAGTGAACAACGG + Intergenic
1190564065 X:51713694-51713716 ATGGATGAACAAGTGAACAACGG - Intergenic
1192450986 X:71244752-71244774 CTGTATGTACAAAAGAAGAATGG - Intronic
1192654633 X:72980345-72980367 ATGAATGGACAAATGAAATATGG + Intergenic
1194202346 X:90968931-90968953 ATGCATGCACAAATATACAAAGG + Intergenic
1194871574 X:99139148-99139170 ATGTATTTAAAAATTAATAAAGG + Intergenic
1197001542 X:121445620-121445642 GTGTATAAACAAGTGAATAATGG + Intergenic
1197212218 X:123837442-123837464 GAGTTTGGACAAATGAATAATGG + Intergenic
1197329273 X:125133515-125133537 AAGCATGCACAGAGGAATAATGG + Intergenic
1197677868 X:129349700-129349722 ATGTATGCACAAAAAATAAAAGG + Intergenic
1197763625 X:130044985-130045007 ACGGATGAACGAATGAATAAAGG - Intronic
1198183194 X:134230027-134230049 GTGTATGCACAAATTAAGGAGGG - Intergenic
1198522977 X:137471516-137471538 ATGAATGGACGAATGAATATAGG - Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1199213264 X:145239073-145239095 ATATTTGCACAAACAAATAAGGG - Intergenic
1199255533 X:145714959-145714981 GTGTATATAGAAATGAATAAGGG - Intergenic
1200245203 X:154519968-154519990 ATATTTACACAAATAAATAAAGG + Intergenic
1200548183 Y:4544386-4544408 ATGCATGCACAAATATACAAAGG + Intergenic
1201295289 Y:12457331-12457353 ATGTATGCATAGATACATAAAGG + Intergenic
1202278634 Y:23152536-23152558 CTATATCCACAAATGAAGAAGGG + Intronic
1202286104 Y:23249073-23249095 CTATATCCACAAATGAAGAAGGG - Intronic
1202286569 Y:23256228-23256250 CTATATCCACAAATGAAGAAGGG - Intronic
1202431458 Y:24783876-24783898 CTATATCCACAAATGAAGAAGGG + Intronic
1202431761 Y:24788633-24788655 CTATATCCACAAATGAAGAAGGG + Intronic
1202432064 Y:24793389-24793411 CTATATCCACAAATGAAGAAGGG + Intronic
1202438204 Y:24869529-24869551 CTATATCCACAAATGAAGAAGGG - Intronic
1202438507 Y:24874286-24874308 CTATATCCACAAATGAAGAAGGG - Intronic