ID: 1091121128

View in Genome Browser
Species Human (GRCh38)
Location 11:133058530-133058552
Sequence ATAAAACAGAAGTGGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 411}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091121128 Original CRISPR ATAAAACAGAAGTGGACACA GGG (reversed) Intronic
902062053 1:13653310-13653332 AGATAACAGAAGTGGCCAAAAGG + Intergenic
902509440 1:16958207-16958229 TTAGAACAGGACTGGACACATGG + Intronic
902631494 1:17707179-17707201 ACAGAACAGAAGCGGACCCAGGG + Intergenic
903196461 1:21692631-21692653 CTAAAACAGTACTTGACACACGG - Intronic
905970216 1:42136211-42136233 TTAGAACAGGACTGGACACATGG - Intergenic
906042769 1:42801598-42801620 AAAAAAAAGAAGTGTACTCAAGG - Intergenic
907640930 1:56189686-56189708 AGAAAAGAGAAGGGGAGACAGGG - Intergenic
908062520 1:60367481-60367503 ACAAAACAGAAGAGGAGAAATGG + Intergenic
908331874 1:63079053-63079075 TTAAAGCAGGTGTGGACACAGGG + Intergenic
908638255 1:66192161-66192183 ATAGAACAGTTTTGGACACAAGG - Intronic
908711979 1:67025842-67025864 ACAAAACAGCAGTGAACACTTGG - Intronic
911298326 1:96144586-96144608 AAAAAACAGAGGTAGAGACAAGG + Intergenic
913174512 1:116261938-116261960 ATACCACAGAAGAGGATACAGGG + Intergenic
913219176 1:116645735-116645757 AGAAAACAGAAGTGGATATTTGG - Intronic
917144820 1:171878290-171878312 ATACAACAGAATAGGAAACAAGG - Intronic
917618279 1:176768441-176768463 ATAAAACAGAAGTAGAAAACTGG - Intronic
919213008 1:194511951-194511973 ATAAATAAGAAGTGGGCACAAGG - Intergenic
919580071 1:199360449-199360471 ATAAAAAAGAAATGGACTGAAGG - Intergenic
920357612 1:205386295-205386317 AAAAAAAAGAAGGGGGCACAGGG - Intronic
920606108 1:207388193-207388215 TGAAAGCAGAAGTGGACAAATGG + Intergenic
922302409 1:224313507-224313529 TTAAAAAAGAAGTGGCAACATGG + Intronic
924322806 1:242866415-242866437 ATAAAACAGAAAAGCAGACAAGG + Intergenic
1062767830 10:79263-79285 ACGAAACAGAAGTTGATACAAGG - Intergenic
1063096904 10:2916170-2916192 AGTAACCAGAAGTGGAGACAGGG - Intergenic
1063648718 10:7912270-7912292 AAAAAAAAGAAATGGAGACAGGG + Intronic
1064104131 10:12486967-12486989 ATAAAACAAAACTGGGCAAAAGG + Intronic
1064735218 10:18375244-18375266 ATAAAAGAGAAGAAGACACTTGG - Intronic
1064975482 10:21110192-21110214 AGTAAATAGAAGTGGGCACAAGG - Intronic
1066754851 10:38700812-38700834 ATACAAGAGAAGTGGAGGCATGG - Intergenic
1068334702 10:55618947-55618969 ACAAAACAGAAAGGAACACAAGG + Intronic
1068762338 10:60726396-60726418 AAAGTACAAAAGTGGACACAAGG + Intronic
1069627602 10:69877868-69877890 AAAACACAGATGTCGACACATGG - Intronic
1071117733 10:82242806-82242828 ATAAGGCAGAAGTGGTCAGATGG - Intronic
1072525840 10:96270777-96270799 ATAAACCAGAAGCGGCCCCATGG - Intronic
1072841660 10:98781273-98781295 AAAAAAAAGAAGTGGATATATGG - Intronic
1073319580 10:102606636-102606658 AGAAAACATAACTGGAAACAGGG + Intronic
1074012620 10:109498588-109498610 AAAAAACAGTATTGGACACAGGG - Intergenic
1074741435 10:116488160-116488182 TTATAACAGAAGCAGACACAGGG + Intergenic
1074849750 10:117430195-117430217 ATAAAACACAAGTGGCTCCATGG - Intergenic
1075028413 10:119003971-119003993 ATGTCACAGCAGTGGACACAGGG + Intergenic
1075278401 10:121116586-121116608 ATAAAACAAAAATTGACAAATGG + Intergenic
1076510430 10:131010135-131010157 ATAAAACAGGAATGGTTACAAGG + Intergenic
1076565199 10:131393766-131393788 AAAAAAAAGAAATGGAAACAGGG - Intergenic
1076909927 10:133382014-133382036 ATTAAACAGAATTATACACACGG - Intronic
1077021539 11:419272-419294 ATAAATCAGAAGAGGACATGCGG + Intronic
1078995279 11:16691484-16691506 ATAAAACAGAAGTGTAAAGAAGG + Intronic
1079558059 11:21786068-21786090 ACCAAACAAAAGTGGACAAATGG - Intergenic
1080741467 11:35068506-35068528 TTAAAACAGAAGTCTCCACAGGG + Intergenic
1081224874 11:40508353-40508375 AAAAAACAGAGGTAGACAGAAGG + Intronic
1081270711 11:41078950-41078972 AGAAAAAAGTAGTGGAAACAAGG - Intronic
1084566712 11:69932754-69932776 AGGAAACAGAAGTGGACAGGAGG + Intergenic
1085659512 11:78350959-78350981 CCAGGACAGAAGTGGACACAAGG - Intronic
1085916642 11:80897028-80897050 ATGAAAAAGAAGTGGAAACTTGG - Intergenic
1086029860 11:82341311-82341333 AGAAAAGAGAAGTGGAAATAAGG - Intergenic
1087163581 11:94975079-94975101 ATAAAACAGAAATGCCCACTTGG - Intronic
1087250943 11:95899196-95899218 ATAAAATAGGAGTGGACATATGG + Intronic
1087520713 11:99231661-99231683 ACAAAACAAAAGTTGACAAATGG - Intronic
1088024605 11:105162722-105162744 AAAAAAAAGAAGTGAAAACAGGG - Intergenic
1088171589 11:107003885-107003907 AGAAAGCAGAATTGGGCACAAGG + Intronic
1088440809 11:109867940-109867962 ATAAAACAGTTCTAGACACATGG + Intergenic
1088843505 11:113646163-113646185 ATCTAACAGATGAGGACACAAGG + Intergenic
1088860529 11:113794936-113794958 ATAAATCAGATGTGTTCACAGGG - Intergenic
1089419505 11:118320554-118320576 AGAAAAGAAAAGTGGAGACAAGG - Intergenic
1090916880 11:131172721-131172743 ATAAAACATAAAAGGACATATGG + Intergenic
1091121128 11:133058530-133058552 ATAAAACAGAAGTGGACACAGGG - Intronic
1091142378 11:133246348-133246370 TTAAAGCAGAAGTAGAGACAGGG + Intronic
1091249850 11:134134466-134134488 ATAAAACATAAGAAGACAGAGGG + Intronic
1091254391 11:134171384-134171406 TGAAAACAGAAGTGGACACATGG - Intronic
1092440915 12:8502079-8502101 ATAAAATAGAACAGGACAAATGG - Intergenic
1092529690 12:9334241-9334263 CTAAAACAGAGGAGGAAACAAGG + Intergenic
1092959437 12:13581939-13581961 ATAAAACGTAAGTAAACACATGG + Intronic
1093169794 12:15847187-15847209 AGAAAAAAGAATTGAACACATGG + Intronic
1093924649 12:24897535-24897557 ACAAAACAAAACTGGATACAGGG - Intronic
1093959274 12:25254491-25254513 ATGAAAAAGCAGTGGACAGATGG - Intergenic
1094002779 12:25714163-25714185 ATTAAACAGATGTGTACTCAAGG + Intergenic
1094576123 12:31687342-31687364 ATAAAAGAGAAGTTGTCAAAGGG + Intronic
1094731728 12:33184391-33184413 AGTAAACAGAAGGGGACTCAAGG - Intergenic
1095302703 12:40604469-40604491 AGAAAGCAGAAGGGTACACATGG + Intergenic
1096354846 12:50931727-50931749 AAAAAAAAGAAGTAGAGACAGGG + Exonic
1096534802 12:52264585-52264607 AGAAAACAGAAAGTGACACATGG + Intronic
1098324948 12:69291455-69291477 ATAACAAAGAAATGGAAACATGG + Intergenic
1098902885 12:76131348-76131370 TTAAAACTGAAGTTGGCACAGGG - Intergenic
1098991944 12:77073321-77073343 AAATAGCAGAAGTGGCCACATGG - Intergenic
1100784005 12:98059780-98059802 TCAAACCAGAAGTGGACACATGG - Intergenic
1101414509 12:104497695-104497717 AGAAGACAGATGTGGACATACGG - Intronic
1101752922 12:107597865-107597887 AAAAAACAGAAGGTGACCCAGGG - Intronic
1102717514 12:114986893-114986915 TTGACCCAGAAGTGGACACATGG - Intergenic
1102753292 12:115315069-115315091 AATAGACAGAATTGGACACATGG + Intergenic
1103635501 12:122301772-122301794 GCAAAAGAGAAGCGGACACAAGG - Intronic
1104020375 12:124988355-124988377 ATAAAACAGAAGAGGCCATTGGG - Intronic
1104033942 12:125085413-125085435 ATGAAACAGACGTGGATGCAAGG - Intronic
1104069831 12:125334965-125334987 ACAAAACAGAAGTAGACTGAGGG - Intronic
1104327666 12:127815183-127815205 AAAAAACAGGAGAGGAAACAAGG + Intergenic
1104434494 12:128744998-128745020 ATAAGACAGAAAGGGAGACAAGG + Intergenic
1104646476 12:130501272-130501294 AAAAAACAGGAGTGGAAGCAGGG - Intronic
1105489985 13:20879045-20879067 CTAAAACAGAAGCGAACGCAGGG + Intronic
1107223802 13:38021301-38021323 ATAAAAAAGAAATGAACAAAAGG - Intergenic
1108815996 13:54291013-54291035 CTAAAACAGAAATTGACAAATGG - Intergenic
1109761754 13:66839599-66839621 AAAATGCAGAAGTGGAGACAGGG - Intronic
1110278630 13:73666802-73666824 ATAAAACACAAGTTTACACCCGG - Intergenic
1110564373 13:76943220-76943242 ATAAAACTCAAGTGGAGACAAGG + Intergenic
1110733524 13:78908753-78908775 ATGAGCCAGAAGTGGACATAAGG - Intergenic
1111142623 13:84140594-84140616 ATAAAACCAAACTGGACACTAGG - Intergenic
1111890458 13:94075390-94075412 ATAAAACACAAAGGGACACAAGG - Intronic
1112618393 13:101028997-101029019 CCAAAGCAGAAGTGGACAAATGG - Intergenic
1112821339 13:103339993-103340015 CTAAAACAAAAGTAGACAAATGG - Intergenic
1112969381 13:105241242-105241264 AAAAAACAGAATTAGACACCAGG - Intergenic
1113664271 13:112130455-112130477 ATAAAAAAGAGATGGAAACAAGG + Intergenic
1113898426 13:113781600-113781622 CTTAGACAGAAGTGCACACAAGG + Intronic
1113913331 13:113855100-113855122 ATAAAATAGTCGTGGGCACAGGG + Intronic
1114041397 14:18681808-18681830 AAAAAACAGAAGTATACCCAGGG - Intergenic
1114145491 14:19972007-19972029 ATAAGACAGAAGTGGATTCAGGG - Intergenic
1114583705 14:23789759-23789781 AAAAAACAGAAATGGTCAGATGG + Intergenic
1115109134 14:29800374-29800396 ATGAAGTAGAAGTGGACACAGGG - Intronic
1115282121 14:31675910-31675932 ATGAAACAGAAGGGGACCCAAGG - Intronic
1116392275 14:44407310-44407332 ATAACTCAGAAGTGGAATCATGG - Intergenic
1120100782 14:80443175-80443197 ACAAAACAAAAATGGACAAATGG + Intergenic
1121331127 14:93050455-93050477 ATAGGACAGAAGTTGACACTTGG - Intronic
1122015592 14:98792991-98793013 ATAAGAGAGAAGATGACACAAGG + Intergenic
1122185928 14:99996013-99996035 CTAAGACAGAAGTGGGCACCAGG - Intronic
1123099192 14:105784214-105784236 AGAAAACAGAAGGAAACACACGG - Intergenic
1123141634 14:106085558-106085580 AAAAAACAGAATTGGACAAGTGG + Intergenic
1123195443 14:106611466-106611488 ACAAAATACAAGTGGACACCCGG + Intergenic
1124228193 15:27915339-27915361 CTAAAACAAAAGTTGACAAATGG + Intronic
1124477305 15:30045763-30045785 ATCATACAGCAGTGGACACAGGG - Intergenic
1124634729 15:31357758-31357780 ATAAAGCAGCTGTGGACACAAGG - Intronic
1124715611 15:32058309-32058331 TTAAAACAGCAGTGTACAGATGG + Intronic
1125186991 15:36942222-36942244 ACAAAACAAAACTGGAAACAAGG + Intronic
1125276531 15:37998212-37998234 CTAAAGCAAAAGTGGACAAATGG - Intergenic
1125281025 15:38042873-38042895 ATAAAGCAGAACTGCAGACAGGG - Intergenic
1125323357 15:38511862-38511884 ATAAAGCAGAAGGGGAGACATGG - Intronic
1126486712 15:49189064-49189086 ATAAAAAAGCAGGGGATACATGG - Intronic
1127155382 15:56119199-56119221 CCAAAGCAGAAGTGGACAGATGG - Intronic
1127907631 15:63388005-63388027 AGAAAACAGAAGCAGAAACACGG - Intergenic
1128313691 15:66647057-66647079 ATAACACAGAAGATGACCCATGG + Intronic
1128318574 15:66676998-66677020 ATAAAGCAGGAGTGGGCTCAGGG - Intronic
1128453100 15:67818523-67818545 ATAAAACAGCCATGGACAGAGGG + Intergenic
1130147404 15:81284643-81284665 AGAACACAGCAGGGGACACAGGG + Intronic
1130757217 15:86777756-86777778 AAAAAACAGAAGAGGTAACATGG - Intronic
1132914613 16:2336798-2336820 ATAAATGGGATGTGGACACATGG + Intronic
1133101880 16:3484919-3484941 AGAAAACAGAAGGGGTCAGATGG - Exonic
1133606120 16:7389851-7389873 GGAAAACAGCAGTGGACTCATGG - Intronic
1133731180 16:8579841-8579863 TTACAAAAGAAGTGGACAAAGGG + Intronic
1134125051 16:11610667-11610689 ATAATCTAGAAGTGGAAACAGGG + Intronic
1134897436 16:17901264-17901286 ATTAAACAGAAGCATACACAAGG - Intergenic
1135608703 16:23846029-23846051 ATATATCAGAGATGGACACAGGG - Intronic
1136727835 16:32376026-32376048 ATACAAGAGAAGTGGAGGCATGG + Intergenic
1137650149 16:50112989-50113011 ATAAAAAAGAAATAGAGACAGGG + Intergenic
1138667356 16:58582943-58582965 ATCGACCAGAAGTGAACACATGG - Intronic
1139345114 16:66297764-66297786 ATAGAAGAGAACTGGACTCATGG - Intergenic
1202998600 16_KI270728v1_random:141728-141750 ATACAAGAGAAGTGGAGGCATGG - Intergenic
1203130197 16_KI270728v1_random:1678132-1678154 ATACAAGAGAAGTGGAGGCATGG - Intergenic
1144491433 17:15714439-15714461 ATAAAACATAAATTGACATAAGG - Intronic
1144909052 17:18664767-18664789 ATAAAACATAAATTGACATAAGG + Intronic
1145190543 17:20840168-20840190 ACAAAACAGAAAAGAACACAAGG + Intronic
1145401757 17:22544004-22544026 ACAAAACAGAAAAGAACACAAGG + Intergenic
1146630564 17:34466468-34466490 ATAAAAGAGATGTGCACACTCGG - Intergenic
1147967592 17:44201470-44201492 AGAAAACAGAGGTAGACAAAAGG + Intergenic
1149075239 17:52589044-52589066 CTAACACAGAAGTGGATAAATGG - Intergenic
1149442655 17:56688002-56688024 ATAAATCATTAGTGGACAGAGGG + Intergenic
1150277276 17:63907182-63907204 ATACAACAGCTGTGAACACATGG + Intergenic
1150579376 17:66458373-66458395 GTTAAACAAAAATGGACACAGGG + Intronic
1150895591 17:69206898-69206920 ACAAAACAAAAGTAGACACATGG + Intronic
1151300434 17:73220729-73220751 ATAAAACAGAAGTGGCTGCCGGG - Intronic
1152078468 17:78172404-78172426 ATCATACAGCAGTGGGCACAGGG - Exonic
1152960656 18:78600-78622 ATGAAACAGAAGTTGATACAAGG - Intergenic
1154051313 18:10961877-10961899 ATAACAAAGAAATAGACACAAGG + Intronic
1154462628 18:14609645-14609667 ACAAGACAGAAGTGGATTCAGGG - Intergenic
1155144308 18:23070736-23070758 ATGCAACAGAAGTTGACACAAGG - Intergenic
1156258370 18:35421579-35421601 ATAAAACAGAAATGAAAACGAGG - Intergenic
1156413137 18:36855751-36855773 TTAAAACAGAAGAAAACACAGGG - Intronic
1157512593 18:48288677-48288699 AAAAAACAGAAGAGGCCAGAGGG + Intronic
1158040682 18:53089425-53089447 ATGAGGCAGAAGTAGACACAAGG - Intronic
1158366295 18:56740841-56740863 AGAAAACAGAAGCTGACACAGGG - Intronic
1159209894 18:65305043-65305065 ATAAAACAGAGGTGGGGAAAAGG - Intergenic
1159331128 18:66995189-66995211 ATAAAACAGAAATGATGACATGG + Intergenic
1159830751 18:73275450-73275472 TCAAAAGGGAAGTGGACACATGG - Intergenic
1160900488 19:1425544-1425566 ATAAAACAGCAGCGGAGACAGGG - Intronic
1161758321 19:6151300-6151322 ACAAAACAAAAGTAGCCACACGG - Intronic
1162528365 19:11220643-11220665 AGACAACAGAAGCAGACACATGG + Intronic
1163301080 19:16446786-16446808 ATTAAACAGAAGAGGTCAAAAGG + Intronic
1165189690 19:34052423-34052445 ATAAAACAGAAATGAAGAAAAGG + Intergenic
1165347691 19:35259100-35259122 ACAGAACAGAAGCGGACAAAAGG - Intronic
1165985210 19:39762713-39762735 CTAACACAGATGTGGAAACATGG + Intergenic
1168150205 19:54442831-54442853 AAAAAACAAAAGTGAAGACAAGG + Intergenic
1168568310 19:57442727-57442749 ATCAAACAATAGTGGTCACAAGG - Intronic
925739101 2:6989628-6989650 ATAAAACAGAACTTTACAAAGGG - Intronic
925739440 2:6992811-6992833 ATGAAAGAGGTGTGGACACAAGG - Intronic
926173682 2:10570126-10570148 GGACCACAGAAGTGGACACATGG + Intergenic
926976846 2:18524131-18524153 TTAGAACAGAATTGGACAGAAGG + Intergenic
927679311 2:25129570-25129592 ACAAAACAGAAGTGGAAGAAAGG - Intronic
927778734 2:25922571-25922593 AGAAAACAGAAGAGGAGAAAAGG + Intergenic
928159938 2:28913335-28913357 ACAAAACAGATTTTGACACAGGG + Intronic
928622354 2:33103910-33103932 AAAAAGCAGAAGAGGAAACAGGG - Intronic
929523578 2:42678228-42678250 ATACAACAGAAGACTACACATGG + Intronic
929597600 2:43186172-43186194 ATGAAGCAGATGTGGACACCAGG + Intergenic
930388375 2:50727790-50727812 ATGAATCAGAAGAGGAGACAGGG + Intronic
930945248 2:57066075-57066097 AAAAAATAAAAGTGTACACACGG - Intergenic
930953354 2:57172388-57172410 ATAAAGTAAAAATGGACACATGG + Intergenic
931146909 2:59529216-59529238 ATAATACAGAAGATGTCACAAGG + Intergenic
933083966 2:78031431-78031453 ATAAAACAGAAGGGAAGAGAAGG + Intergenic
933463688 2:82622719-82622741 AGAACATAGAAGGGGACACAGGG + Intergenic
934318133 2:91945047-91945069 ATACAAGAGAAGTGGAGGCATGG - Intergenic
935030973 2:99322561-99322583 AAGAATCAGAAGTGCACACATGG + Exonic
936000978 2:108829996-108830018 ATAAAAAGAAGGTGGACACAAGG + Intronic
937726115 2:125168376-125168398 AGAAAACAGGAGGGGAAACAGGG - Intergenic
938268812 2:129950696-129950718 AGAAAACAGAAGTATACCCAGGG + Intergenic
939713020 2:145546862-145546884 AAAAGTCAGAAGTGGACGCAAGG - Intergenic
939988875 2:148858798-148858820 CTAAAACAGGTGTGGACTCATGG - Intergenic
940334163 2:152507721-152507743 TCAAAACAGTAGTAGACACATGG - Intronic
940415594 2:153416238-153416260 ATAAAACAGAAGCAGTCACATGG - Intergenic
941165701 2:162080845-162080867 GTAAGACAAATGTGGACACAGGG - Intergenic
942384018 2:175422350-175422372 ATTAAACAGAAGAAGGCACAGGG + Intergenic
943500543 2:188683358-188683380 ACAAAACAGAAGTTGACAAATGG - Intergenic
944095560 2:195963622-195963644 ACAAAGCAAAAGTGGACAAATGG - Intronic
944517608 2:200527862-200527884 ATAAAACAGAAGGGGAGAATGGG + Intronic
945258930 2:207826193-207826215 ATAAAACAGATGTGCTCCCATGG - Intergenic
945386324 2:209206029-209206051 ATAAAACTGAATTCGAAACATGG - Intergenic
946458510 2:219849227-219849249 CTAACACAGGAGTGCACACATGG - Intergenic
946702683 2:222428482-222428504 ATCAAAAAGTACTGGACACAGGG - Intronic
947008723 2:225541302-225541324 CTAAAGCAAAAATGGACACATGG - Intronic
947047819 2:226008239-226008261 ATACAACAGAATGTGACACATGG + Intergenic
947071757 2:226295572-226295594 AAAAAAGAGAAGTGAACAGATGG - Intergenic
1169964663 20:11202940-11202962 ATAAAACAGAAGTAGAAGCTTGG + Intergenic
1170774968 20:19367189-19367211 ACAGCACAGAAGTGGACAGAAGG + Intronic
1171000547 20:21410983-21411005 AAAAAACAGAAATGGGCAAATGG - Intergenic
1171042172 20:21775126-21775148 ACAAAACAAAAGTAGACAAATGG - Intergenic
1172411475 20:34726789-34726811 AAAAAAAAAAAGTGGACTCAAGG + Intronic
1172929306 20:38573102-38573124 ACAAAACAAAACTGGGCACAAGG + Intronic
1173203776 20:40974784-40974806 AAGAAACTGAAGAGGACACAAGG - Intergenic
1173221030 20:41133402-41133424 AAGAAACAGGAGTGGGCACAGGG - Intergenic
1173274172 20:41565050-41565072 ATAAAACAGAAGAGAAGTCATGG + Intronic
1174051965 20:47773178-47773200 AAGAAACAGCAGTGGCCACAAGG + Intronic
1174218042 20:48932252-48932274 AGAAATTAGAAGTGGGCACAAGG - Intronic
1175406880 20:58740754-58740776 ATCAGACAGACGTGGACTCAAGG + Intergenic
1176262561 20:64190086-64190108 TTAAATCAGAGGTGGACACACGG + Exonic
1176935653 21:14863760-14863782 ATGAAACAGAAGTGTTCTCATGG + Intergenic
1177723587 21:24939045-24939067 ACAAAACAAAAATGGACACTGGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178470943 21:32892083-32892105 ATAAAAGAAAAGTTGACAAATGG + Intergenic
1178557250 21:33603512-33603534 ATAAACCAGAAAAGGTCACATGG - Exonic
1178675673 21:34629616-34629638 ATAAAAGTGAGGTGGCCACAGGG - Intergenic
1178814716 21:35918355-35918377 ATAAAAAAGCAGTGTTCACAGGG + Intronic
1178998893 21:37435457-37435479 TTAGAACAGAAGTGGAAATAAGG + Intronic
1180306311 22:11128731-11128753 ATACAAGAGAAGTGGAGGCATGG - Intergenic
1180544830 22:16490914-16490936 ATACAAGAGAAGTGGAGGCATGG - Intergenic
1181153799 22:20904273-20904295 AAAAAATAAAAGAGGACACAAGG + Intergenic
1182294641 22:29305940-29305962 ATAAAAAAGAAAAGGTCACAAGG + Intergenic
1182995681 22:34809833-34809855 AGAAAACAGAACTGGCGACAGGG + Intergenic
1184073248 22:42159995-42160017 AGTAAACAGAAGAGGAAACAAGG + Exonic
1184766241 22:46573961-46573983 TCAAAGCAGAACTGGACACAGGG - Intergenic
1184842809 22:47062472-47062494 ATAAAACAGAAAGGAACACACGG - Intronic
1185059743 22:48600082-48600104 ATAAAACAGCGGTGGATAGAGGG + Intronic
949720659 3:6986230-6986252 AAAAAACACAAACGGACACAAGG + Intronic
949937893 3:9131180-9131202 ATAAAACAGAATTGTTCCCAAGG + Intronic
951319977 3:21232884-21232906 AGAAAACATAATTGGAAACAGGG - Intergenic
952288289 3:31989318-31989340 GCAATACAGAAGTGGACACAGGG + Exonic
954281871 3:49586113-49586135 CTAAAACAAAAATGGACAAATGG - Intronic
955389743 3:58512633-58512655 AGAACACAGAAGAGGCCACAGGG - Intronic
956339327 3:68204147-68204169 ATAAAACAGATGAGGTCACAGGG - Intronic
957942800 3:87026377-87026399 ATACATAAGAAGTGGACGCATGG + Intergenic
958001225 3:87751439-87751461 ATAAAAAAGAAGGGAAGACATGG + Intergenic
958968382 3:100584611-100584633 ATCAGACAGAAGTGCAGACAAGG + Intergenic
959659425 3:108849549-108849571 ATAATATAGAAGGTGACACACGG + Intronic
960415948 3:117385165-117385187 ATAAAACAAAACTAGACAAAAGG + Intergenic
960640660 3:119819807-119819829 AAAAAAAAAAAGTGGTCACAAGG - Intergenic
961079259 3:124011485-124011507 ATCCAAAAGAAGTGGACTCAAGG + Intergenic
962816831 3:139008109-139008131 CTAAAGCAAAAGTGGACAAATGG - Intronic
964651915 3:159021153-159021175 CAAAAACAGAAGTTGACAAATGG - Intronic
964733190 3:159889441-159889463 CTCTAACAGAAGTGGCCACAGGG + Intronic
965199603 3:165640322-165640344 ATAAAACTGGAGTATACACATGG - Intergenic
965245967 3:166268875-166268897 ATTAAACAGAAGGAGACTCAAGG + Intergenic
965853271 3:173056949-173056971 ATAGAACATATGTGGACTCACGG - Intronic
965869198 3:173246429-173246451 ATCAGACAGAAGTGCAGACAAGG + Intergenic
965928152 3:174008478-174008500 AAAAAACAGAAGAGAACACAGGG - Intronic
966183934 3:177211554-177211576 GTCAAAGGGAAGTGGACACAGGG - Intergenic
966662866 3:182433964-182433986 ATATCACTGAAGTGGATACAAGG - Intergenic
967637042 3:191814639-191814661 ACAAAACAAAAATGGACAAATGG + Intergenic
969292552 4:6249352-6249374 ACAAAACAGAAGTGTACACAGGG + Intergenic
969382275 4:6810558-6810580 CTAAAACAGAAATAGACAAATGG + Intronic
969703736 4:8781215-8781237 ATTTAACAGATGAGGACACAAGG - Intergenic
970090034 4:12395789-12395811 ATAATTCAGAAGTGCACAAACGG + Intergenic
970330615 4:14979702-14979724 AGAGAACAGGAGTGGAAACAAGG + Intergenic
971358005 4:25912359-25912381 AAAAAAGGGAAGTGGCCACAGGG + Intronic
971800346 4:31281909-31281931 ACAAAACAAAAGTAGACAAATGG + Intergenic
972924587 4:43987535-43987557 GAAAAACAGAAGAGAACACAGGG + Intergenic
973248531 4:48036978-48037000 TTAAAACAGAAGTGAAACCACGG + Exonic
974032058 4:56784860-56784882 AAAAAAAAGAAGAGGAGACAGGG + Intergenic
974143358 4:57917375-57917397 ATAAAACAGAGGTTGAGACCTGG + Intergenic
974506006 4:62772872-62772894 ATAAAGCAGAAGTGGCAATAAGG + Intergenic
974587955 4:63904366-63904388 ATAAAACAGAAATGCTCAGAGGG + Intergenic
976489174 4:85647824-85647846 ATAAAGCAAAAATGGACATAGGG - Intronic
976729881 4:88251051-88251073 ATAAAACACACCTGGACACCTGG + Intergenic
977137635 4:93325795-93325817 AAAAAACAAAAGTGAACAAAAGG - Intronic
977417951 4:96758896-96758918 CAAAAACAAAAGTGGACAAATGG - Intergenic
977798169 4:101193483-101193505 AAAAAACAGAACTGGCCTCATGG + Intronic
977916244 4:102597338-102597360 AAAAAGCAGAATTGGACACTGGG - Intronic
978109686 4:104947609-104947631 AGAAAATAGAAGTGGAAAAAGGG - Intergenic
978221461 4:106280439-106280461 CCAAAACAGAACTGGACAAATGG - Intronic
978346565 4:107776367-107776389 ATAAAACAAAAATTGACAAATGG - Intergenic
978431983 4:108642299-108642321 AGAATACAGCAGTGGACACCTGG + Intergenic
978894684 4:113872861-113872883 ATGTAACAGAAGTTAACACAGGG - Intergenic
979082359 4:116360168-116360190 AAAATACAGAAGTGGCCACTTGG + Intergenic
979110536 4:116749053-116749075 ATAAAACAAAAGTGAACAGAGGG + Intergenic
979383316 4:120034516-120034538 ATCAAACATGAGTGGTCACAAGG + Intergenic
981274266 4:142879717-142879739 ATAAAAGAGTTGAGGACACAGGG + Intergenic
981364031 4:143880514-143880536 ATAAAATAGAAGTTGAGAAAGGG + Intronic
981374754 4:144001288-144001310 ATAAAATAGAAGTTGAGAAAGGG + Intronic
981385087 4:144120593-144120615 ATAAAATAGAAGTTGAGAAAGGG + Intronic
981575267 4:146197621-146197643 ATAAAACAGAAGTAGAAAGAGGG - Intronic
981881257 4:149615813-149615835 TTAAAAGAGGAGTGGAAACAAGG - Intergenic
982343476 4:154330678-154330700 ATTAAAAAAAAGTGGAAACAGGG + Intronic
984352063 4:178608191-178608213 AATAAACAGAAGTGAACAAACGG + Intergenic
985608797 5:874481-874503 ATAAAAAAGCACTGGCCACATGG - Intronic
986630733 5:9769926-9769948 ACAAAGCAGAAATGGACAAAGGG - Intergenic
986959408 5:13195663-13195685 ATAAAACAAAAGTTGAAAGATGG + Intergenic
988183053 5:27823221-27823243 ATCAAACAGAAGAGAGCACATGG + Intergenic
988183581 5:27830901-27830923 ATATATCAGAAGTGGAAACATGG - Intergenic
988256524 5:28827394-28827416 AAAAAACAAAAATGGACAAATGG - Intergenic
988529378 5:32014306-32014328 ATAAATCATAAGGGGACGCATGG - Intronic
988882737 5:35521062-35521084 ACAAAACAGAAATTGAGACAAGG + Intergenic
989118302 5:37978140-37978162 AAAAAAAAAAAGTGGAAACATGG - Intergenic
989455536 5:41639242-41639264 ATAAAAAATAAGTGGACTAATGG - Intergenic
989986384 5:50703631-50703653 TTAAAACAGTAGAGAACACATGG - Intronic
990102687 5:52212647-52212669 ATAAACCAGATGTACACACACGG - Intergenic
991658383 5:68926208-68926230 AGAAAACACAATTGGACAAAGGG + Intergenic
993208480 5:84918047-84918069 AAAAAACAGAAATTGACAAATGG + Intergenic
993684224 5:90918361-90918383 ATAAAACAGATCTGGCCACTGGG - Intronic
994130518 5:96222239-96222261 CTAAAACAAAAATAGACACATGG + Intergenic
996108762 5:119539594-119539616 AAAAAGAAGAAGTGGACAAAAGG + Intronic
996165821 5:120221649-120221671 ATAAAACAAAAATAGACAAATGG + Intergenic
996417118 5:123222525-123222547 CTAAAATAGAAATGCACACAGGG - Intergenic
997834540 5:137181637-137181659 ATTAAACAGAGCTGGAAACAGGG + Intronic
998112726 5:139514578-139514600 ATAGAACAGTATTTGACACATGG + Intergenic
999312684 5:150561924-150561946 CTAAAACAGAAGTACAAACAGGG + Intergenic
1000681912 5:164195842-164195864 CTAATACAGAAGTGGAAAAATGG - Intergenic
1000890256 5:166793281-166793303 ATAAAACAAAAGTGATCTCATGG - Intergenic
1001449214 5:171811171-171811193 ATTAAACAGAAGCAGACACACGG - Intergenic
1001951506 5:175819887-175819909 ATAGAACAGAAGGGAACAAAAGG + Intronic
1003915847 6:10785630-10785652 ATATAACAGCAGTGGGCTCAGGG - Intronic
1005285244 6:24319452-24319474 ACAAAACAAAAGTAGACAAATGG - Intronic
1005393066 6:25353321-25353343 ATAAAACTGAGGTGCAGACAGGG + Intronic
1005575549 6:27186137-27186159 ATAAAACAGAAGAGGGGAAATGG + Intergenic
1006100914 6:31685806-31685828 ACAAAACAAAAATGGACTCAGGG + Intergenic
1006807232 6:36796556-36796578 TTAACACTGAAGTGGGCACAGGG + Intronic
1007123052 6:39399667-39399689 AAAAACCTGCAGTGGACACAGGG - Intronic
1007783460 6:44267113-44267135 ATAAGACAGAAGTGAGAACAGGG + Intergenic
1008174788 6:48253890-48253912 AAAAAACAGAAATGGACAAGTGG + Intergenic
1008952743 6:57178213-57178235 AAATAACAGAAGGGGAGACAGGG + Intronic
1009005288 6:57778637-57778659 AAAAAACAAAAGTAGACAAATGG + Intergenic
1009671605 6:66760163-66760185 ATAAAACCGAATTGGAAAGAAGG + Intergenic
1010342817 6:74776308-74776330 ATAAAACAGAAGTGAGAACATGG - Intergenic
1011092058 6:83614341-83614363 AATAAACAGCAGTGGACACAAGG + Intronic
1012849115 6:104425750-104425772 AAAAAACAGAAGCAGAAACAAGG - Intergenic
1012935391 6:105362739-105362761 ATGAAACAGTGGTGGACACAAGG + Intronic
1013144812 6:107378275-107378297 ATAAAAGAAAAGAAGACACACGG + Intronic
1013312853 6:108913780-108913802 ATAAACCAGAAGGAGAAACAGGG - Intronic
1013689649 6:112626472-112626494 ATAAAACTGTATTGGCCACACGG - Intergenic
1015704723 6:136075669-136075691 ATAAAAGGGAAGGGGAAACAAGG - Intronic
1015782770 6:136887075-136887097 ATGAAATAGAAGTGGTCACCTGG - Intronic
1016013445 6:139161503-139161525 GTCTAACAGAAGTGCACACATGG - Intronic
1016391074 6:143576527-143576549 TTAAAACAGAAGTTGAAAGAGGG + Intronic
1016835957 6:148477193-148477215 CTAAAACAAAAATGGACAAATGG + Intronic
1017954208 6:159164935-159164957 ATAAATCTGCAGTGGACACGGGG + Intergenic
1018145105 6:160878606-160878628 AAAAACCAAAAGTAGACACATGG + Intergenic
1018881487 6:167886731-167886753 GTAAAACAGCAGTGTACATAGGG + Intronic
1020258747 7:6518293-6518315 AGAAAACAAAAATGGACAAAGGG + Intronic
1020871410 7:13634097-13634119 ATAAATAAGAAGAGGACACCAGG + Intergenic
1021534514 7:21688357-21688379 ATAAAACATAATAGGAAACACGG - Intronic
1022736298 7:33079406-33079428 ATAAAGCAGAAGGAGAGACAAGG + Intergenic
1022858229 7:34338418-34338440 ATGAAACAGGAAAGGACACAGGG - Intergenic
1023198793 7:37670740-37670762 ATGAACCAAAAGTTGACACAAGG - Intergenic
1023325918 7:39056291-39056313 ATAAAATAGGAGTTGACAGAGGG - Intronic
1023519638 7:41037729-41037751 AAAAAAAAAAAGTGCACACATGG - Intergenic
1026544087 7:71306804-71306826 ACAAAACAGAAATGAAAACAGGG - Intronic
1027378607 7:77579759-77579781 ACAAAACAGACGTGGAAAAATGG + Intronic
1027556683 7:79672333-79672355 ATAAAATGGAAGTAGACAAATGG + Intergenic
1027804544 7:82800414-82800436 AGGAAACTGAAGTGCACACATGG - Intronic
1028799601 7:94947970-94947992 ATAAAACAGACTTAGTCACATGG - Intronic
1029122317 7:98277132-98277154 ATAATACAAAAGTGGATAAAAGG + Intronic
1031628493 7:124018317-124018339 ATATAACAGAAGCAGACACTAGG - Intergenic
1032361973 7:131264553-131264575 ATAAAACAAAAGTGTATATATGG - Intronic
1032430887 7:131860522-131860544 ATTCAACAGGAGTGGTCACATGG + Intergenic
1034112276 7:148548512-148548534 AGAAAACAGAAGTGGAGGAAGGG - Intergenic
1034331273 7:150284634-150284656 ATGAAACAGAAGGTGAAACAGGG + Intronic
1034464435 7:151218203-151218225 ATGAGAGAGATGTGGACACAAGG + Intronic
1034666768 7:152825219-152825241 ATGAAACAGAAGGTGAAACAGGG - Intronic
1034952888 7:155312974-155312996 ACAAATCAGAAGGGGACTCAAGG - Intergenic
1039329123 8:36517192-36517214 ATAAAATACAAGTGAACAAACGG + Intergenic
1040077700 8:43256088-43256110 ATATTACAGAAGAGAACACATGG + Intergenic
1041440608 8:57892031-57892053 ATAAATAAAAAGTGGACAGATGG + Intergenic
1042705244 8:71659963-71659985 ATAAAAAAGAAATAGAAACATGG + Intergenic
1043242120 8:77947059-77947081 TTAAAACAGCAGATGACACATGG + Intergenic
1043357948 8:79435843-79435865 AAATAACAGAAGGGGTCACAGGG - Intergenic
1043762810 8:84090446-84090468 CTAAAGCAAAAGTGGACAAATGG - Intergenic
1044160477 8:88908124-88908146 ACAAAACAAAAATAGACACATGG + Intergenic
1044621467 8:94194638-94194660 ATAAAGCATAAGAAGACACAGGG + Exonic
1045338483 8:101230872-101230894 ATAAACCAAAGCTGGACACATGG - Intergenic
1045609479 8:103819528-103819550 ATAAAACAGAATTGCAGACCTGG - Exonic
1046098964 8:109592875-109592897 TTAAAACAGGATTTGACACATGG - Intronic
1046187211 8:110736857-110736879 ATAAAACCAAAGTGAACAGAAGG - Intergenic
1046662142 8:116959325-116959347 TTAAAAGATAAGTGGAAACATGG - Intronic
1047552570 8:125891668-125891690 ATAAAACAGAAATAGAGAAATGG - Intergenic
1047684947 8:127295425-127295447 AGAAACCAGAATTGGACCCAAGG - Intergenic
1048117156 8:131537081-131537103 ATAAAACATATGAGGAAACAAGG - Intergenic
1048307311 8:133293261-133293283 ATAAAAAGCAAGTGGACACGCGG + Intronic
1048716439 8:137276143-137276165 ATAAAACAGAAGTATAGACAAGG + Intergenic
1051126919 9:13815056-13815078 ATAAAAAGGAAGTGAACTCAGGG + Intergenic
1051212017 9:14754961-14754983 ATAACACAGACATGCACACAAGG + Intronic
1051368546 9:16338941-16338963 TAACAACAGAAGTAGACACAGGG + Intergenic
1051465605 9:17374094-17374116 CCAAAGCAGAAATGGACACATGG + Intronic
1051820437 9:21159868-21159890 ATAGAATATAATTGGACACAAGG + Intergenic
1051914595 9:22193125-22193147 ATACAAAAGAAGTCTACACAAGG - Intergenic
1052024805 9:23562643-23562665 ATAAAGGAGGAGTGGACAGAAGG + Intergenic
1052134841 9:24897357-24897379 ATGATACAGAAGTGGAGACATGG + Intergenic
1052510809 9:29417431-29417453 AAAGAACAGAATAGGACACAGGG - Intergenic
1054264382 9:62904278-62904300 TTAACAAAGGAGTGGACACAGGG - Intergenic
1055482427 9:76722845-76722867 ATAAAACAGGAGTGAAAACATGG - Intronic
1056871310 9:90282896-90282918 ATAAAAAAGAATTGAAAACAGGG + Intergenic
1057095495 9:92304401-92304423 ATCAAACAGAACTGCACTCAAGG + Intronic
1057270775 9:93649939-93649961 ATGACACACTAGTGGACACATGG + Intronic
1058017849 9:100056042-100056064 AAAAAACTGAATTGGAAACATGG - Intronic
1059087654 9:111321520-111321542 AGAGAATAGAAGTGGACACAGGG - Intergenic
1059480494 9:114585693-114585715 ATAAAACAGAATAGAGCACATGG - Intergenic
1060558325 9:124521723-124521745 ATAAATCAGTAGTGGGCACCAGG + Exonic
1060731641 9:126040579-126040601 ATAAATCAGAAGTGAACAGCTGG + Intergenic
1060885886 9:127151878-127151900 AAAGAACATAAGGGGACACAGGG - Intronic
1062737441 9:138145147-138145169 ATGAAACAGAAGTTGATACAAGG + Intergenic
1187797455 X:23019911-23019933 CTCAAACAGAAGGGGAAACAGGG + Intergenic
1188424899 X:30035565-30035587 CTAAAGCAAAAGTGGACAAACGG - Intergenic
1189062300 X:37767667-37767689 AGAAAGCAGAAGTGGGCAGAAGG - Intronic
1189168978 X:38890756-38890778 AGAAAGCAGGAGTGGACAGATGG - Intergenic
1189575260 X:42344415-42344437 ACAAAACAAAAGTTGACAAATGG + Intergenic
1189987823 X:46569833-46569855 GTCAAAGAGAAGTGGCCACATGG - Intergenic
1190413402 X:50158939-50158961 ATAAAAAAGAAGAGGACACATGG + Intergenic
1191100173 X:56718311-56718333 ATAAAACAAAAATTGACAAATGG + Intergenic
1191131455 X:57016225-57016247 ATAAAACAAAAATTGACAAATGG - Intergenic
1191152653 X:57236867-57236889 ATAAAACAAAAATAGACAGATGG - Intergenic
1191593893 X:62921190-62921212 AAAAAACTAAAGTGGACAAAGGG + Intergenic
1192097909 X:68232816-68232838 AAAAAACAAAAGTGGGCAAAAGG + Intronic
1192821102 X:74646618-74646640 CTAAAGCAAAAATGGACACATGG - Intergenic
1193609853 X:83617681-83617703 ACAAAACAAAAATGGACAAATGG - Intergenic
1194405228 X:93488486-93488508 ACAAAACACACATGGACACAGGG - Intergenic
1195047207 X:101064985-101065007 AAAAAAAAGAAGTGGAGATATGG - Intergenic
1195688393 X:107604736-107604758 ATGAAACAGAGGCAGACACAGGG - Exonic
1195863540 X:109406548-109406570 ATATAACAGATATGGACAAAAGG + Intronic
1197599584 X:128512313-128512335 CAAAAACAGAAGTGAACAAATGG + Intergenic
1198812977 X:140554471-140554493 ACAAAACAAGAGTGTACACATGG + Intergenic
1199313244 X:146345951-146345973 AAAAAAAAGATATGGACACAAGG + Intergenic
1199492094 X:148411479-148411501 ATAAAACAATCCTGGACACATGG + Intergenic
1201185691 Y:11400129-11400151 ATACAAGAGAAGTGGAGGCATGG - Intergenic
1201891260 Y:18946280-18946302 GTAAACCAGCAGTGGAAACAAGG + Intergenic