ID: 1091121366

View in Genome Browser
Species Human (GRCh38)
Location 11:133060602-133060624
Sequence ATGCAGCCACAGTAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 241}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091121366_1091121374 16 Left 1091121366 11:133060602-133060624 CCCTGCTCCTACTGTGGCTGCAT 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1091121374 11:133060641-133060663 TGAGAAAACAGGCCTCTTATTGG 0: 1
1: 0
2: 0
3: 14
4: 172
1091121366_1091121370 -7 Left 1091121366 11:133060602-133060624 CCCTGCTCCTACTGTGGCTGCAT 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1091121370 11:133060618-133060640 GCTGCATGACAGGACCTGCCAGG 0: 1
1: 0
2: 2
3: 15
4: 182
1091121366_1091121375 17 Left 1091121366 11:133060602-133060624 CCCTGCTCCTACTGTGGCTGCAT 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1091121375 11:133060642-133060664 GAGAAAACAGGCCTCTTATTGGG 0: 1
1: 0
2: 2
3: 21
4: 177
1091121366_1091121371 5 Left 1091121366 11:133060602-133060624 CCCTGCTCCTACTGTGGCTGCAT 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1091121371 11:133060630-133060652 GACCTGCCAGGTGAGAAAACAGG 0: 1
1: 0
2: 2
3: 18
4: 193
1091121366_1091121377 25 Left 1091121366 11:133060602-133060624 CCCTGCTCCTACTGTGGCTGCAT 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1091121377 11:133060650-133060672 AGGCCTCTTATTGGGAAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
1091121366_1091121376 21 Left 1091121366 11:133060602-133060624 CCCTGCTCCTACTGTGGCTGCAT 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1091121376 11:133060646-133060668 AAACAGGCCTCTTATTGGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091121366 Original CRISPR ATGCAGCCACAGTAGGAGCA GGG (reversed) Intronic
900130946 1:1087033-1087055 ACGCAGCCACAGCAGGCTCAGGG - Intronic
905880467 1:41460021-41460043 ATGCAGCCACAGGACAACCAGGG - Intergenic
906188459 1:43879969-43879991 ATGAAGCCACAGTAGCGCCAAGG - Intronic
907250394 1:53134263-53134285 AGCCACCCACAGCAGGAGCAGGG + Intronic
907410001 1:54277107-54277129 ATGAAGTCACAGAAGGAGAAAGG - Intronic
910342478 1:86203435-86203457 CTGCAGTCACAGGACGAGCAGGG - Intergenic
911087316 1:93989761-93989783 ATGCAGCCACTTAAGGAGGACGG + Intergenic
911256268 1:95637074-95637096 ATGCAGGGACAGGAAGAGCATGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913609320 1:120494873-120494895 AGGCAGCCACAGAAGGTGCAGGG + Intergenic
914204501 1:145515580-145515602 AGGCAGCCACAGAAGGTGCAGGG - Intergenic
914371046 1:147024651-147024673 AGGCAGCCACAGAAGGTGCAGGG + Intergenic
914483625 1:148088768-148088790 AGGCAGCCACAGAAGGTGCAGGG - Intergenic
914581871 1:149026966-149026988 AGGCAGCCACAGAAGGTGCAGGG - Intronic
915417643 1:155754374-155754396 CTGTAGCCACTGTAGCAGCAAGG - Exonic
916180658 1:162080680-162080702 ATGCACACACAGAAGTAGCAGGG - Intronic
917508266 1:175648654-175648676 TTGCTGCCACAGAAGGAGAAAGG - Intronic
919451063 1:197774572-197774594 ATGCAGCAACTGTAGATGCATGG - Intronic
919455759 1:197818217-197818239 ATGCAGCCACTGCTGGAGGATGG - Intergenic
920845529 1:209590253-209590275 ATGCAGCCATGGAAGGAACATGG + Intronic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
922341018 1:224655229-224655251 GTGAAGCCACAGTAGCAGGAAGG + Intronic
924481504 1:244439496-244439518 TCCCAGCCACAGTAGGGGCAGGG - Intronic
924728234 1:246689759-246689781 CTGCAGTCACTGTAGGAGCGGGG - Intergenic
1063961122 10:11306111-11306133 TTGCAGCCACTGTGCGAGCAAGG + Intronic
1064446536 10:15398820-15398842 GCTCAGCCACAGTAGGACCAGGG + Intergenic
1068510975 10:57965467-57965489 ATTCAGAAACTGTAGGAGCAGGG + Intergenic
1070311468 10:75276536-75276558 AGGCAGCCTCCGTAGGAGCCCGG - Intergenic
1072695329 10:97599160-97599182 ATGCGGCCACGATAGTAGCAAGG - Exonic
1073026003 10:100487832-100487854 ATGCTGCCAGGGTAGGAGCTGGG - Intronic
1075312472 10:121426202-121426224 ATGCAGGCAGAGGAGGATCATGG + Intergenic
1075654058 10:124149751-124149773 TAGCAGCCACAATAGGAGCTAGG - Intergenic
1075815193 10:125259736-125259758 CTGCACCCACAGGAGGGGCAGGG + Intergenic
1076768917 10:132652355-132652377 CTGCAGCCCCAGGAGGAGCGGGG + Intronic
1077712154 11:4548351-4548373 ATGTGGCCTCGGTAGGAGCATGG - Intergenic
1079137752 11:17785712-17785734 ATTCAGCCAGTGAAGGAGCATGG + Intergenic
1080653725 11:34242430-34242452 ACGCAGCCACAGGAGGGGCAGGG + Intronic
1081194772 11:40148049-40148071 ATGCAGCCATAGTATGGACATGG - Intronic
1081810988 11:45914024-45914046 GGGCAGCAACAGGAGGAGCAGGG + Intronic
1081940212 11:46935307-46935329 ACAGAGCCAAAGTAGGAGCAGGG - Intergenic
1082222651 11:49659028-49659050 ATGCAGTCAGAGAAGTAGCAGGG - Intergenic
1082869853 11:57934240-57934262 ATGCAGACTCAGTAAGTGCAAGG - Intergenic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1083992905 11:66257831-66257853 AGGCAGCCAGAGTCGGAGCCGGG + Intronic
1084106903 11:66986227-66986249 TGGCAGCCACAGTGGGAGTAGGG - Intergenic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1084987395 11:72888003-72888025 ATGGATACACAGTAGTAGCAAGG + Intronic
1087549686 11:99633293-99633315 ATGCAGGCATAGCAGGAGCAAGG - Intronic
1088408297 11:109505108-109505130 ATGCAGAGACAGTATGAGTAGGG + Intergenic
1089037180 11:115406991-115407013 ATGCCCCCACAGTTGAAGCATGG + Intronic
1089460590 11:118650897-118650919 ATCCAGGCACTGCAGGAGCATGG + Intronic
1090834100 11:130441367-130441389 ATGTGGCCAGAGCAGGAGCAAGG + Intergenic
1091121366 11:133060602-133060624 ATGCAGCCACAGTAGGAGCAGGG - Intronic
1091587305 12:1823527-1823549 AGGAGGCCCCAGTAGGAGCAGGG - Intronic
1092855496 12:12669637-12669659 AAGCAGCCATGGTAGGAGTATGG + Intronic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1093025858 12:14244618-14244640 CTGCAGCCACAGCATAAGCATGG - Intergenic
1093244515 12:16720013-16720035 ATACATCCACTGTGGGAGCAAGG + Intergenic
1095638552 12:44459762-44459784 ATGCATGCTCAGTAGGAACACGG + Intergenic
1096791253 12:54046709-54046731 AGTCAGCCACAGTGGGAGAAGGG + Intronic
1097686508 12:62695965-62695987 ATCCAGGCACAGGAGGAGCCTGG + Intronic
1103794259 12:123492435-123492457 AGGCAGCTACCGCAGGAGCAGGG + Intronic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104690569 12:130822930-130822952 ATCCAGCTACAGAAGCAGCAAGG + Intronic
1105261790 13:18785152-18785174 ATACAGCAGGAGTAGGAGCAAGG + Intergenic
1105264147 13:18801741-18801763 ATACAGCAGGAGTAGGAGCAAGG + Intergenic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1110401054 13:75092621-75092643 CTGAAGCCAGAGCAGGAGCACGG + Intergenic
1111055995 13:82952456-82952478 ATGGAGACAGAGTAGAAGCAGGG + Intergenic
1112163210 13:96890313-96890335 ATGCAGACACACAAGGAGTAAGG + Intergenic
1112779487 13:102883249-102883271 AGGCAGCCTCAGGAGGAACATGG + Intergenic
1116016735 14:39416899-39416921 ATGCAGCCATACAAGGAACATGG - Intronic
1117541817 14:56754798-56754820 ACACAGTTACAGTAGGAGCAAGG - Intergenic
1118973736 14:70659524-70659546 AAGCAGCCGCAGCAGGAGGAGGG + Intronic
1120459991 14:84782733-84782755 GAGCATCCACAGTAGCAGCATGG + Intergenic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1121222995 14:92300393-92300415 ATGCAGCCAGTGTGGGAGGATGG - Intergenic
1122104478 14:99441738-99441760 ATGAGGCCACAGCAGGGGCAGGG + Intronic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1124585691 15:31004397-31004419 AGGTAGCCACAGAAGCAGCAGGG - Intronic
1126938024 15:53733436-53733458 ATGTAGCCACAGGAAGAGCTGGG - Intronic
1127544425 15:59976991-59977013 ATGCAGGTACAGCAAGAGCAAGG + Intergenic
1135194191 16:20381060-20381082 ATGCAGCCACAGTCTGTGCCTGG - Intronic
1136051052 16:27650278-27650300 ATGCAGGCACAGTGTGAACAAGG + Intronic
1137890490 16:52156553-52156575 ATACAGCCACAGTAAGAGTTAGG + Intergenic
1137978169 16:53048288-53048310 CTGCAGCCACTGTAGTAGCTGGG - Intergenic
1138313880 16:56051805-56051827 GTGCAGCCTCACTAGGAGAAGGG + Intergenic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1139296040 16:65901755-65901777 ATGGACACACAGTAGGAGCTGGG + Intergenic
1142274228 16:89107816-89107838 ATGCAGCCACATTTGGGGCTGGG - Intronic
1143019953 17:3912202-3912224 ATGAAGACACAGGAGGAGTAAGG - Intronic
1143642638 17:8207834-8207856 ATGGAGCCTGAGAAGGAGCAGGG + Exonic
1144612054 17:16728769-16728791 ATGCAGACACAGTAGTATAATGG - Intronic
1145821686 17:27841752-27841774 ATGGAGCCCCAGTGGAAGCAAGG - Intronic
1146591073 17:34128400-34128422 AGGCAGGCACAGTGGGACCAGGG - Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1148696159 17:49559983-49560005 ATTCAGCCTCAGTAGGAGTCAGG - Intergenic
1149414239 17:56442329-56442351 ATGCAGACACAAAAAGAGCAAGG + Intronic
1149620293 17:58039779-58039801 GTGCAGCCACAGAAGAAGGAGGG + Intergenic
1152029808 17:77834963-77834985 ATGCAGCCCCTGTAGGAGGAAGG - Intergenic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1153323354 18:3794233-3794255 ATGCTGCCACAGTTAGAGAAGGG - Intronic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1154105374 18:11518224-11518246 GTGCAGACACAGTAGGGCCATGG + Intergenic
1154272591 18:12932876-12932898 AAGCAGCAACAGTTGGGGCAGGG - Intergenic
1154366591 18:13715878-13715900 ATTGAGCCACAGTAGAAACAAGG - Intronic
1154431925 18:14314902-14314924 ATACAGCAGGAGTAGGAGCAAGG - Intergenic
1155317201 18:24583849-24583871 ATGCAGACAGAGTAGAAGGATGG - Intergenic
1156543069 18:37936159-37936181 ACATAGCCAGAGTAGGAGCAAGG + Intergenic
1156692608 18:39726539-39726561 ATAGAGCCACAGAAGGAGCAGGG - Intergenic
1156855064 18:41772293-41772315 ATGCAGCAGCAGTAGCAGCTGGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159413418 18:68111381-68111403 TTGCAGCCAGAGAAGGGGCAAGG - Intergenic
1159618422 18:70609106-70609128 CAGAATCCACAGTAGGAGCAAGG + Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160764964 19:803469-803491 AGGCAGCCCAAGTGGGAGCAGGG + Intronic
1160827713 19:1088499-1088521 ATGCAGCCTCAGAAGGAACAAGG - Exonic
1162014900 19:7840091-7840113 ATGCACCCGCAGTAGGACAAGGG + Intronic
1165874566 19:38996908-38996930 AATCTGCCACAGTAGGAACAAGG + Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1167049635 19:47070586-47070608 AGGCTGCCACAGTAGGTGCTGGG - Intronic
926249209 2:11144097-11144119 ATGCAGCCCATCTAGGAGCAAGG + Exonic
927895850 2:26781339-26781361 ATGTGGCCAGAGTAGGAGCAAGG + Intronic
928279919 2:29936622-29936644 TTGCACACACAGTAGGAGCTGGG - Intergenic
928979373 2:37122313-37122335 CTGCAGCAAGAGGAGGAGCAAGG + Intronic
933980885 2:87549843-87549865 GTGCAGCCTCAGCAGGAGAATGG + Intergenic
934776293 2:96939730-96939752 TTGCACACACAGTAGGAGCTTGG + Intronic
936039519 2:109139480-109139502 ATTCAGCCACAGAAGGCACAAGG - Intronic
936312945 2:111400942-111400964 GTGCAGCCTCAGCAGGAGAATGG - Intergenic
936618898 2:114074859-114074881 ATGCAGGTACAGAAGGATCAGGG + Intergenic
937530560 2:122822370-122822392 AGGCAGCCACAGCAGGATGAGGG + Intergenic
937920109 2:127122768-127122790 ATCCAGTCAGAGAAGGAGCAAGG - Intergenic
937972780 2:127563585-127563607 TTGCTGCAGCAGTAGGAGCAAGG - Intronic
940288973 2:152059330-152059352 AAGCAGCCAGGGTGGGAGCAGGG + Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941024594 2:160444662-160444684 ATACAGTCATAGTAGGAGTAAGG - Intronic
941643857 2:168018844-168018866 ATCCAACCACACTAAGAGCAAGG + Intronic
944197732 2:197073151-197073173 AGGAAGACACATTAGGAGCAGGG + Intronic
945618258 2:212100747-212100769 ATTCTGCCTGAGTAGGAGCAGGG + Intronic
948300229 2:236900558-236900580 GTGCAGGGAAAGTAGGAGCAGGG + Intergenic
948732676 2:239977048-239977070 ATCCAGCCACAGGAAGAGCTGGG + Intronic
948812986 2:240494487-240494509 ATGCTCCCACAGTAGGGGCTAGG - Intronic
1169402435 20:5294428-5294450 ATGCAGCCACGGGAGGAGGCAGG - Intergenic
1169663614 20:8007947-8007969 ATGCAGCTCCATGAGGAGCAAGG + Intronic
1170016912 20:11791705-11791727 AGTGAGACACAGTAGGAGCAAGG + Intergenic
1172298444 20:33830708-33830730 ATGCAGCCACACTGGGGCCAGGG + Intronic
1175351357 20:58322035-58322057 GTGAAGCCACAGCAGGAGGATGG - Intronic
1175640399 20:60624797-60624819 GTGCTGCCACTGTAGGAGCCTGG - Intergenic
1175889320 20:62309430-62309452 ATGCAGCCGCAGTAGGCGGGGGG + Exonic
1176121239 20:63455512-63455534 ATGCAGTCACAGACTGAGCATGG + Intronic
1176233149 20:64042124-64042146 AGTCAGCCACAGCTGGAGCAGGG - Intronic
1176845117 21:13870860-13870882 ATACAGCAGGAGTAGGAGCAAGG + Intergenic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1180147817 21:45930999-45931021 ATCCAGCCACAGTGGCAGCATGG - Intronic
1180969325 22:19806894-19806916 ATGCAGCCTAATTAGGAGCCTGG - Intronic
1185228828 22:49668534-49668556 ATGAGGCCACAGCAGCAGCAAGG + Intergenic
949106137 3:202217-202239 ATGCAGACAGATTAGTAGCACGG + Intronic
949490260 3:4582312-4582334 CTACAGACACAGTAGGAACATGG - Intronic
950454611 3:13085257-13085279 GAGCAGCCCCAGTAGCAGCAAGG + Intergenic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
953901046 3:46844601-46844623 CAGCAGCCCCAGAAGGAGCAGGG - Intergenic
954355139 3:50078620-50078642 ATGCAGCACTAGTAGTAGCAAGG - Intronic
954629466 3:52040229-52040251 AACTGGCCACAGTAGGAGCAGGG - Intergenic
954958999 3:54548269-54548291 ATGTAGCCACATTAGGAGCAAGG + Intronic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
960058042 3:113289940-113289962 TTGCAGTCACACTAGGAGCTGGG - Exonic
960079828 3:113529650-113529672 AGGCAGGCTAAGTAGGAGCAGGG + Intergenic
961524775 3:127489749-127489771 ATGCAGTCACAGTGGAGGCAAGG - Intergenic
962912569 3:139866858-139866880 ATGCAGACACAGGAGGACCCAGG + Intergenic
963152879 3:142065263-142065285 GTTCAGCCACACAAGGAGCAAGG + Intronic
963234940 3:142947307-142947329 AAGAAGCCACAGGAGGAGGAAGG + Intergenic
963666335 3:148192455-148192477 AGGAAGCCACAGTATGAGCTGGG + Intergenic
965319955 3:167241130-167241152 ATACAGCCACAGTAGAATCAAGG + Intronic
969455991 4:7299913-7299935 AGGCAGCCGCAGTTGGAGCAGGG - Intronic
970751539 4:19369128-19369150 CAGCTGCCACAATAGGAGCAGGG - Intergenic
972331837 4:38071169-38071191 CAGCTGCCACAGTAAGAGCAGGG - Intronic
976122922 4:81802592-81802614 TTGCAGCTGCAGTAGCAGCAGGG + Intronic
978406250 4:108382192-108382214 ATGCAGCTACAGAAAGAGAATGG + Intergenic
981162633 4:141517033-141517055 ATGCCTCCCCAGCAGGAGCAAGG + Intergenic
984265585 4:177495473-177495495 ATGCCGCCAAAGTGGGAGCCCGG - Intergenic
984596416 4:181673950-181673972 AAGCAACCACAGCAGGAGTATGG + Intergenic
985021845 4:185699969-185699991 TTGCAGACACAGTCGGAACAGGG - Intronic
988074205 5:26332104-26332126 ATACAGGCAGAGGAGGAGCATGG + Intergenic
989678206 5:43997680-43997702 ACTCAGCCAGAGGAGGAGCAAGG + Intergenic
994078411 5:95679532-95679554 CTGCAGGCACAGTAGTAACATGG - Intronic
997650768 5:135517547-135517569 ATACAGCCACATTAGGAGTTAGG - Intergenic
998140525 5:139697280-139697302 CTGCAGTCACAGTGAGAGCAGGG + Intergenic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999459468 5:151745477-151745499 ATCCAGCCACAGTCTCAGCAGGG - Intronic
1000512003 5:162194443-162194465 ATGCATCAACATTAAGAGCAAGG + Intergenic
1002187588 5:177461671-177461693 AGGCAGCAACATTGGGAGCATGG - Intronic
1008172098 6:48220544-48220566 GAGCAGCGACAGTAGCAGCAAGG - Intergenic
1008557933 6:52693443-52693465 ATGCATCACCAGTAGCAGCATGG - Intergenic
1009361838 6:62824464-62824486 ATGCAGACACACCAGGAGTAAGG - Intergenic
1009649173 6:66451339-66451361 ATGCAGACACCGTTGGAGTAGGG - Intergenic
1012012074 6:93801453-93801475 ATGCAGCCACACTGGGAGTTGGG + Intergenic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1013305535 6:108843940-108843962 ATGGAGCCACAGTGAGACCAGGG + Intergenic
1013761972 6:113529434-113529456 ATGCAGCCACATTTGGAAGATGG + Intergenic
1015812878 6:137178921-137178943 ATGGAGACACAGTAGGTGCAGGG + Intergenic
1016252331 6:142058985-142059007 TTCCAGCTACAGTAGAAGCATGG + Intronic
1018018037 6:159729749-159729771 CTGCAGACACTGTAGTAGCAAGG - Intronic
1019657216 7:2202279-2202301 ACTCAGCCACAGGAGGAGCTGGG + Intronic
1020131679 7:5562469-5562491 ACGCAGCCTCAGCGGGAGCAGGG + Intronic
1021278717 7:18689640-18689662 ATGCAACCACAGTAGCAACAAGG + Intronic
1022102240 7:27175438-27175460 ATGCACACACTGCAGGAGCAAGG - Intronic
1022443636 7:30452769-30452791 CTGCAGCCGCTGTAGCAGCATGG + Exonic
1023629368 7:42148393-42148415 ATGCAGCCACAGAATGTCCAGGG - Exonic
1023801498 7:43838962-43838984 TGGCGGCCGCAGTAGGAGCACGG + Intergenic
1027366111 7:77460112-77460134 AAGAGGCCACAGTAGGAGAATGG + Intergenic
1028903662 7:96129130-96129152 TTGCAGTCACAGTAGCAGCCAGG - Intronic
1029747706 7:102525586-102525608 ATGGAGCCACAGTGGGGGCATGG + Intergenic
1029765657 7:102624676-102624698 ATGGAGCCACAGTGGGGGCATGG + Intronic
1030265053 7:107611778-107611800 ATGCAGCTATAGAAGGAACATGG + Intronic
1030630309 7:111888316-111888338 ATGCAGGCACAGTAGAACTAAGG + Intronic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1033410210 7:141110749-141110771 ATACAGCCACACTAGGGTCAGGG - Intronic
1034186269 7:149179574-149179596 CTCCTGCCACAGTAGGAGCAGGG - Exonic
1034946803 7:155267469-155267491 ATGCAGACCCCGTGGGAGCACGG - Intergenic
1035999663 8:4586822-4586844 CTGCACGCACAGTAGGATCATGG + Intronic
1037228751 8:16628440-16628462 ATTCAGCGCCAGTAGCAGCAGGG - Intergenic
1037657505 8:20897962-20897984 AGGCAGCCACTGAAGGAGGAAGG - Intergenic
1037783738 8:21889387-21889409 ATCCAGGCACAGTGGGAGAAAGG + Intergenic
1038413884 8:27379054-27379076 ATGCAGCCACGTTGGGAACAGGG - Intronic
1039200326 8:35084149-35084171 TAGCAGCCACAGTAGCTGCATGG - Intergenic
1039849235 8:41348042-41348064 ATGCAGCCACGGTGGGAGTGTGG + Intergenic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1044760263 8:95510318-95510340 CTGCAGCCTCAGTAGGATCCAGG + Intergenic
1045527185 8:102951025-102951047 AAACAGCCACAGTGGGAGCTGGG + Intronic
1046961126 8:120114074-120114096 ATACAGTCACAGAGGGAGCAGGG + Intronic
1047775644 8:128068092-128068114 ATGCATGCACAGCAGGAACAGGG - Intergenic
1047834385 8:128672418-128672440 ATGCTGACACACTAGGAGCTAGG - Intergenic
1047911628 8:129536085-129536107 AACCAGCCACTGTAGGAACAGGG + Intergenic
1048943172 8:139420200-139420222 AAGTAGCAAGAGTAGGAGCATGG - Intergenic
1049822963 8:144647294-144647316 ATGTGGCCCCAGTAAGAGCAGGG + Intergenic
1050357404 9:4795802-4795824 ATTGAGCCACAGTATGTGCAAGG + Intronic
1051689075 9:19690262-19690284 ACGGACCCACAGTAGGAGAAAGG - Intronic
1053433659 9:38060729-38060751 ATGGAGCCACAGGAGATGCAGGG - Intronic
1056463370 9:86829637-86829659 ATGCAGTCATTGTATGAGCAGGG + Intergenic
1056906050 9:90648756-90648778 CAGCAGCCCCAGTAGGAGGAGGG - Intergenic
1058038749 9:100281823-100281845 AGGCAGCCACATGAGGAACAGGG - Intronic
1058383266 9:104403331-104403353 ATACAGCCACATTAGGGGCTAGG + Intergenic
1059996785 9:119918333-119918355 ATGAATCAATAGTAGGAGCAGGG - Intergenic
1061873310 9:133531971-133531993 AGGCTGCCGCAGTGGGAGCAGGG - Intergenic
1187296384 X:18005297-18005319 ATGCAGCCACAGATTAAGCATGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1192188662 X:68977065-68977087 ATCCACCGACAGTGGGAGCAGGG + Intergenic
1192594170 X:72388688-72388710 ATGCAGCCACATTAGGGGTTAGG - Intronic
1193694767 X:84695064-84695086 AGGCAGCCATAGTAGGATGAGGG - Intergenic
1197056479 X:122126431-122126453 AGGAACCCACATTAGGAGCATGG - Intergenic
1197922209 X:131607366-131607388 AAGAATCAACAGTAGGAGCAGGG - Intergenic
1199649675 X:149939395-149939417 ACGCAGCCACAGGAGAAACAGGG + Intergenic
1199659553 X:150035205-150035227 ATGTCGCCACAGTAAGAGGAAGG - Intergenic
1200700641 Y:6399415-6399437 ATGCAGCCTCAGTAGCTGCTGGG - Intergenic
1200921952 Y:8621040-8621062 ATGCAGCCTCAGCAGGTGCCAGG + Intergenic
1200930277 Y:8690791-8690813 ATGCAGCCTCAGGAGCAGCCAGG - Intergenic
1201033471 Y:9765283-9765305 ATGCAGCCTCAGTAGCTGCTGGG + Intergenic
1202164720 Y:21975065-21975087 ATGCACACACGGGAGGAGCAAGG + Intergenic
1202175911 Y:22098801-22098823 ATGCAGCCTCAGTAGCTGCCAGG - Intergenic
1202215450 Y:22487583-22487605 ATGCAGCCTCAGTAGCTGCCAGG + Intergenic
1202226636 Y:22611309-22611331 ATGCACACACGGGAGGAGCAAGG - Intergenic
1202316484 Y:23584353-23584375 ATGCACACACAGGAGGAGCAAGG + Intergenic
1202554280 Y:26085705-26085727 ATGCACACACAGGAGGAGCAAGG - Intergenic