ID: 1091122016

View in Genome Browser
Species Human (GRCh38)
Location 11:133064742-133064764
Sequence CAGCCACACGGCCCGGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091122007_1091122016 16 Left 1091122007 11:133064703-133064725 CCTGGAGGGAAGGGAAGGCTGAG 0: 1
1: 1
2: 6
3: 68
4: 609
Right 1091122016 11:133064742-133064764 CAGCCACACGGCCCGGCGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091122016 Original CRISPR CAGCCACACGGCCCGGCGCG GGG Intronic
901027953 1:6288928-6288950 CAGCCACAGGGCCTGGCACTTGG + Intronic
901077894 1:6566880-6566902 CAGCTAAAAGGCCAGGCGCGTGG - Intronic
903217224 1:21850040-21850062 CAGCCTCCCGGCCCGGCACCAGG - Exonic
905917625 1:41696591-41696613 CAGCCACCCGGGCAGGAGCGTGG + Intronic
907682703 1:56579068-56579090 CAGCCACACACCCAGGCGCCCGG + Exonic
913186335 1:116373472-116373494 CAGCGACAGGACCCGGCGCCGGG + Intronic
916108662 1:161447962-161447984 GAGGCACAGGGCCCGGCGCCCGG - Intergenic
916110250 1:161455343-161455365 GAGGCACAGGGCCCGGCGCCCGG - Intergenic
916111835 1:161462753-161462775 GAGGCACAGGGCCCGGCGCCCGG - Intergenic
916113422 1:161470134-161470156 GAGGCACAGGGCCCGGCGCCCGG - Intergenic
919726964 1:200891027-200891049 CAGCCAGCGGGCCCGGCGGGAGG + Intronic
1067140037 10:43648907-43648929 GAGACCCACGGCCCGGCGGGCGG - Intergenic
1067406677 10:46030230-46030252 CAGGCCCACGGCCGGGCACGAGG + Intronic
1067806371 10:49395880-49395902 GAGCCCCAAGGCCCGGCGCTCGG + Intronic
1076898536 10:133325798-133325820 CAGCCCCGCAGCCCGGCCCGGGG - Exonic
1077104745 11:837300-837322 CAGCCTCATGGCCCGGCTGGTGG - Exonic
1078191957 11:9098237-9098259 GAGCCACACTGCCCGGCCCCTGG - Intronic
1083426706 11:62591803-62591825 CAGCCACAAAGGCCGGCGCCGGG + Intronic
1083728921 11:64642828-64642850 CAGCCCCATGGCCGGGGGCGGGG + Intronic
1083758376 11:64803141-64803163 CAGCGCCATGGCCCGGCGCCGGG + Exonic
1084758408 11:71252823-71252845 GAGCCACGCAGCCCGGGGCGGGG - Intergenic
1084937283 11:72593757-72593779 CAGCCACACAGCCCTGCACCTGG + Intronic
1090788378 11:130069649-130069671 CGGCCACAGGGTCCGGAGCGGGG + Intergenic
1091122016 11:133064742-133064764 CAGCCACACGGCCCGGCGCGGGG + Intronic
1096981259 12:55729133-55729155 GAGTCACTGGGCCCGGCGCGGGG + Intronic
1097218190 12:57430635-57430657 CGGCCGCACGGGCGGGCGCGAGG - Intronic
1103178568 12:118887271-118887293 CACAAACACGGCCAGGCGCGTGG + Intergenic
1103377772 12:120469864-120469886 CATCCACACGGCCCGGCCCCAGG - Exonic
1105987584 13:25583568-25583590 CATCCACACCGCCCGGCCCCTGG + Intronic
1112091775 13:96090719-96090741 CAGCCACACGCCTCGGCGTCAGG + Intergenic
1119506442 14:75176951-75176973 CAGCCACAAGGCCCTTCGCTGGG + Intergenic
1120744187 14:88139165-88139187 CAGCCACAGGGCCAGGTGAGAGG + Intergenic
1121588218 14:95078639-95078661 CTGCCACACTGCCCGGCACCAGG + Intergenic
1122419260 14:101564904-101564926 CAGGGACGCGGCCCGGCGCCTGG + Intergenic
1122658621 14:103279465-103279487 CGGCCTCACGGCCCGGAACGAGG - Intergenic
1124028516 15:25988913-25988935 GAAACACACGGCCGGGCGCGGGG - Intergenic
1127488157 15:59438123-59438145 CTGCCGCCTGGCCCGGCGCGCGG - Intronic
1128845624 15:70892180-70892202 CAGCCGCACGGCCCGGTCCTTGG + Exonic
1131431779 15:92394022-92394044 GACCCACGCGGGCCGGCGCGAGG - Exonic
1132551228 16:554661-554683 CTTCCACAGGGCCCTGCGCGGGG - Intergenic
1132611140 16:816898-816920 GAGCCACAGGGCCCGGCCCGAGG + Intergenic
1133805612 16:9124098-9124120 CACCCACAGGGCCCAGGGCGTGG + Intergenic
1134718042 16:16366702-16366724 CAGCCCCAGCCCCCGGCGCGTGG + Intergenic
1134956710 16:18385457-18385479 CAGCCCCAGCCCCCGGCGCGTGG - Intergenic
1136450956 16:30354027-30354049 CAGCCACACTCCCCAGCGAGGGG - Exonic
1140794487 16:78424406-78424428 CTGACACAGGGCCAGGCGCGGGG - Intronic
1141704876 16:85659249-85659271 CAGGCACACGGCCGGGCTCAGGG - Intronic
1141715520 16:85724699-85724721 CAGCCACCCCGGCCGGCGGGAGG + Intronic
1142883219 17:2896874-2896896 CAGCCACAGGGTCCTGCGCAGGG + Intronic
1143063330 17:4222120-4222142 CAGCCACGCCTCCCGGCGCCTGG - Intronic
1146438878 17:32876740-32876762 CAGCCTCGCGCCCCTGCGCGCGG + Intronic
1148116452 17:45178127-45178149 CAGCCACAGGGCTCGGCTCAAGG - Intergenic
1150643621 17:66965227-66965249 CGCACACACTGCCCGGCGCGCGG + Intronic
1151716747 17:75834970-75834992 CAGCCACACTGCCCGGCAGCTGG - Exonic
1152077625 17:78168939-78168961 CAGCCTCGCGCCCCGACGCGGGG + Intronic
1152552199 17:81035403-81035425 CAGCCTCCTGGCCCGGCGCGCGG - Intronic
1156500406 18:37554047-37554069 CAGCCACAAGGCCTGGCTCTAGG - Intronic
1160782423 19:883761-883783 CAGCCACACGGGGTGGCGCCAGG + Intronic
1168382995 19:55940065-55940087 CACCCACACGGCTCGGCTCGTGG + Intergenic
924987952 2:288322-288344 CGGCCGCCGGGCCCGGCGCGCGG - Intronic
925027234 2:619869-619891 CAGGCACAGGGCCTGGCGAGGGG - Intergenic
929556935 2:42931514-42931536 CAGCCACAGGGCCCAGCCCAGGG + Intergenic
937227721 2:120379255-120379277 CAGCCACACTGCTGGGCCCGGGG - Intergenic
938030906 2:127992254-127992276 CAGCCACAGCGCCCGGCCCCAGG + Intronic
940845706 2:158639836-158639858 CAGCCACGTGGCCAGGCGCATGG + Intronic
942459046 2:176157143-176157165 CGGCCGCCCAGCCCGGCGCGGGG - Intronic
945119595 2:206443832-206443854 CGGCCACACGGAGCGGCGCCCGG + Exonic
949014466 2:241701785-241701807 CGGCCCCACCGCCCGGCGTGCGG - Intergenic
1169132512 20:3173458-3173480 CTGCCTCAGGGTCCGGCGCGGGG + Exonic
1169216250 20:3796379-3796401 GAGCCACAGGGCCAGGCGCGAGG - Exonic
1170524827 20:17227086-17227108 CAGTCAGGCGGCCCGGCGCGCGG - Exonic
1171229978 20:23476169-23476191 CAGCCACAGTGCCCGGGGTGGGG + Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1175853062 20:62104125-62104147 CAGCCACACGGCCCCCGCCGCGG - Intergenic
1175966521 20:62662665-62662687 CAGCCACACACCCCGGAGCCTGG + Intronic
1176127763 20:63483566-63483588 CACCAACCCGGCCGGGCGCGGGG + Intergenic
1176286253 21:5020914-5020936 CAGCCGCCCGCCCCGGGGCGAGG + Intergenic
1178849708 21:36202770-36202792 CAGCCACAGGGCCTGGCGCTGGG - Intronic
1179511846 21:41878893-41878915 CAGCCCCGCGGCCCCGCGCTGGG + Intronic
1179787933 21:43740332-43740354 TAGCCACAGGGCATGGCGCGTGG + Intronic
1179794821 21:43776580-43776602 GAGTCACACGGACCGGGGCGGGG + Intergenic
1179870928 21:44242561-44242583 CAGCCGCCCGCCCCGGGGCGAGG - Intergenic
1180175300 21:46084296-46084318 CAGCCACAGGGCCGGGTGTGGGG - Intergenic
1180847914 22:18994452-18994474 CAGCCACACGGCCAGCTTCGAGG + Intergenic
1180960612 22:19760773-19760795 CCGCCACTCGGCCCGCGGCGCGG + Intronic
1182692799 22:32175723-32175745 CAGCCACATGGTCCTGCGCAGGG + Intergenic
1185236190 22:49714766-49714788 CCCCTACACGGCCGGGCGCGTGG + Intergenic
1185402245 22:50625225-50625247 CAGCCAGGTGGCCCGGGGCGAGG - Exonic
950193408 3:10993013-10993035 CCCCCACCCGGCCCGGCTCGCGG - Intronic
950510042 3:13420429-13420451 CAGCCCCGCGTCCCTGCGCGAGG - Intergenic
950545762 3:13637146-13637168 CAGCCACACGGCCCGGCACTTGG + Intronic
953890878 3:46750790-46750812 CAGCCTCATGGCCGGGCGTGGGG - Intronic
954004278 3:47579060-47579082 CAGGCGCACGGCGCGGCGCGCGG + Exonic
954463374 3:50640377-50640399 CAGCCCCAAGGCCCGGCAGGAGG + Exonic
961539439 3:127590079-127590101 CGGCGACCCGGTCCGGCGCGGGG - Intronic
961545502 3:127629987-127630009 CACCCACACAGCCCGCCGCCCGG - Intronic
968426868 4:529390-529412 CAGCCACACTGCCAGGCACATGG + Intronic
968701403 4:2059695-2059717 CAGCCTCACGGCGGGGCGGGGGG + Exonic
969625327 4:8301998-8302020 CAGCCACAGGGCCTGGCACATGG + Intronic
979455515 4:120922427-120922449 CTGCCGCAGGGCCCGGGGCGCGG - Intronic
981115368 4:140984025-140984047 CAGTCACACGGCTGGGCACGGGG - Intronic
985610930 5:888143-888165 CAGCCCTAGGGCCCGGCCCGAGG + Intronic
992690453 5:79236327-79236349 CAGCTCCACGGCCTCGCGCGGGG + Exonic
1001496141 5:172188581-172188603 GAGCCACGCGGCGCGGCGGGCGG - Intergenic
1007557793 6:42781922-42781944 CGGCGCCCCGGCCCGGCGCGGGG + Intronic
1007821041 6:44561012-44561034 CAGCCCCAGGGCCAGGCGGGTGG + Intergenic
1016864055 6:148748103-148748125 CACCCACACTCCCCGGGGCGCGG - Intronic
1019403040 7:867279-867301 AAGCCACACAGCCCTGCGCTTGG + Intronic
1019453094 7:1109758-1109780 CTGCCCCAGGGCCCGGCGGGCGG - Intronic
1021859245 7:24889867-24889889 CAGCCTCACAGCCAGGCGCTGGG + Intronic
1024948220 7:54833317-54833339 CAGCCGCAGGGCCGGGCGCCTGG - Intergenic
1026084146 7:67249019-67249041 GAGCCACCGCGCCCGGCGCGGGG + Intergenic
1026360951 7:69600042-69600064 CAGACAGACAGCCCGGAGCGCGG - Intronic
1026894122 7:74000273-74000295 CAGCCTCACGGGGCGGCGGGTGG + Intergenic
1027344921 7:77249205-77249227 CAGCCACAGCGCCCGGCCAGTGG - Intronic
1031886902 7:127253043-127253065 CATTCACCCGGCGCGGCGCGGGG + Exonic
1038518436 8:28207025-28207047 CAACCAAAGGGCCTGGCGCGGGG - Intergenic
1047998476 8:130358253-130358275 CCGCCGCCCGGCCTGGCGCGCGG + Intronic
1048574590 8:135680753-135680775 CAGCCACTCGGCCCAGTGCCAGG - Intergenic
1049167360 8:141134950-141134972 CAGCTACTCGGCCGGGCGGGGGG - Intronic
1049686920 8:143942739-143942761 CAGCCTCCCAGCCCGGCCCGTGG - Intronic
1049790912 8:144472384-144472406 CTGCCTCACGGCCAGGCGCTCGG - Exonic
1050617705 9:7419864-7419886 GAGCCACAATGCCCGGCCCGGGG - Intergenic
1053519743 9:38765542-38765564 CAGACAGCCGGCCAGGCGCGGGG + Intergenic
1061128006 9:128689080-128689102 GAGACACAGGGCCCGGCGAGAGG - Intronic
1062216789 9:135393575-135393597 CAGGCACAGGGCCCGGCCCACGG + Intergenic
1062502872 9:136858755-136858777 CAGCCAGGCGGCCCGGCCCCCGG - Exonic
1200128552 X:153829573-153829595 CAGCCCCGCGGCCCGGAACGGGG - Intronic