ID: 1091126503

View in Genome Browser
Species Human (GRCh38)
Location 11:133104075-133104097
Sequence CTGCTCAGTCACAGCCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091126503 Original CRISPR CTGCTCAGTCACAGCCCAGT GGG Intronic
900518322 1:3093777-3093799 TTGCTCAGCCACAGCCAGGTGGG - Intronic
900538472 1:3190865-3190887 CTGCCCGGTGACAGCCCAGAGGG + Intronic
900836351 1:5007470-5007492 CTGCTCATTCATAACCCAGGAGG + Intergenic
903012032 1:20338048-20338070 CTGCACACACACTGCCCAGTTGG + Intronic
903223415 1:21881354-21881376 CTGTTCAGGCAGAGCCCAGAAGG + Exonic
903303701 1:22397326-22397348 CTGCTTAGTCCCAGCCCTCTGGG - Intergenic
906212477 1:44019851-44019873 CTTCTCAGTCCCAGCTCAGCGGG - Intronic
907277918 1:53327285-53327307 CTGCTCAGATACAGCCCATAGGG + Intronic
907518077 1:55006032-55006054 GTGCAGAGTCACAGCCCAGGGGG - Intronic
907818260 1:57941292-57941314 CTGCACAGTAGCAGCCCAGCAGG + Intronic
908769580 1:67583791-67583813 CTGCTAAGAAACAGCCCATTGGG - Intergenic
909414913 1:75394938-75394960 CTGCTGAGTCATGGCCCAGGAGG - Intronic
910131119 1:83907600-83907622 CTGCTCAATCACCTTCCAGTGGG - Exonic
910800185 1:91137635-91137657 CTGCTGAGCCACAGCAGAGTGGG + Intergenic
911076161 1:93877776-93877798 CTGCTGAATCACAGACCACTGGG - Exonic
911209506 1:95124566-95124588 CTGCTCAGTGAAAGGTCAGTAGG + Intronic
912459969 1:109823998-109824020 CTGCTGAGTCACAGACCACTGGG - Intergenic
912547456 1:110461162-110461184 CTGCTCAGTCATCAGCCAGTTGG - Intergenic
912583650 1:110742050-110742072 CTGTTCGGTCACAGACCTGTGGG - Intergenic
913447583 1:118966279-118966301 CTGCTGGGTGACAGCCCATTAGG - Intronic
916725397 1:167518216-167518238 CTGCTCCGTCACAGCCGAGTTGG - Intronic
917286837 1:173430050-173430072 CTGCTGAGTCAAACCCCAGCAGG + Intergenic
920494919 1:206447815-206447837 CCCCTGAGTCCCAGCCCAGTGGG + Intronic
922726394 1:227924931-227924953 CTGCACAGGCATAGCCCACTGGG + Intronic
1063333398 10:5185131-5185153 TTCCTCACTGACAGCCCAGTAGG + Intergenic
1063962217 10:11315938-11315960 CTGCAGAGTAACAGGCCAGTGGG + Intronic
1068411423 10:56660570-56660592 CAGCTCAGTCACAGCAAAATAGG - Intergenic
1068613972 10:59091356-59091378 CTACTCAATCCTAGCCCAGTTGG + Intergenic
1069592896 10:69652799-69652821 CGGCGCTGTCACAGCCCAGCTGG + Intergenic
1069927411 10:71860402-71860424 CTGATCACCCACAGCCCAGCGGG - Intergenic
1076000480 10:126908797-126908819 CTTTTCTCTCACAGCCCAGTAGG + Intronic
1076383438 10:130040238-130040260 CTGCTCAGCAACAGGCCAGCTGG - Intergenic
1077050861 11:566188-566210 CTGCCCAGGCACAACCCACTTGG - Intergenic
1077698579 11:4418476-4418498 CTGCTCAGTCACAGCCGAGGTGG + Intergenic
1080209895 11:29773497-29773519 CAGCTCAGTCATTGCCTAGTGGG - Intergenic
1080696254 11:34605515-34605537 TGGCTCAGTCACAGACCAGTGGG - Intergenic
1080749590 11:35139735-35139757 CTGCCTAGACACAGCCCGGTGGG - Intronic
1081855454 11:46300469-46300491 CTGCTGAATCACAACCCTGTGGG + Intronic
1082010853 11:47448802-47448824 CTGCCTGGTCACAGCCCACTCGG - Exonic
1083213299 11:61202828-61202850 CTGCTTATTCACAGCACATTGGG - Intergenic
1083216179 11:61221574-61221596 CTGCTTATTCACAGCACATTGGG - Intergenic
1083219063 11:61240400-61240422 CTGCTTATTCACAGCACATTGGG - Intergenic
1083419087 11:62543540-62543562 CAGCTCAGCCACAGCCCTGGTGG + Intronic
1084007810 11:66332480-66332502 CTCCTCTGTCACAGCCCCCTGGG + Exonic
1085034034 11:73289542-73289564 CTGCTCAGTGCCAGCCCCGAGGG + Intronic
1086928101 11:92662806-92662828 CTGATCAGTCAGTTCCCAGTGGG - Intronic
1087691085 11:101321123-101321145 CAGCTCAGTCACAGCAGAATAGG - Intergenic
1088371543 11:109093990-109094012 CTGGTAAGTCATAGCCCAGTTGG - Intergenic
1090203315 11:124871006-124871028 CTTCCCAGTCCCACCCCAGTTGG + Exonic
1090228673 11:125086535-125086557 CAGCTCAGTCGCAGCTCAGAGGG - Intronic
1091126503 11:133104075-133104097 CTGCTCAGTCACAGCCCAGTGGG + Intronic
1091243433 11:134069789-134069811 CTGCTTGGTCACAGCCCTCTGGG + Intronic
1092794016 12:12092756-12092778 CTGCAGAGTCACAACCCAGACGG + Intronic
1094063770 12:26342085-26342107 CTGCTCACACACAGCCCAAGTGG + Intronic
1094380805 12:29840925-29840947 CTGCTCAGCCACAGTACAATAGG - Intergenic
1094628073 12:32144822-32144844 CTGATCAGTCACTCTCCAGTGGG - Intronic
1097232889 12:57522961-57522983 CTGCGCAGTCGCGGCCCAGAGGG - Exonic
1099682262 12:85844079-85844101 CGGTGCTGTCACAGCCCAGTCGG + Intergenic
1100897304 12:99198018-99198040 CCGCTCAATCCCAGCCCACTTGG + Intronic
1100924815 12:99532806-99532828 CTGCTTAGTCAAAGATCAGTTGG + Intronic
1101624958 12:106430849-106430871 AGGCTCAGTCACAGCCAATTAGG + Intronic
1103316060 12:120056851-120056873 CTGCTCACTCACTGCCCAGCAGG - Intronic
1104976414 12:132553933-132553955 CTGCCCAGGTACAGCCAAGTGGG - Intronic
1107072164 13:36282471-36282493 CTGCTCAGACACACCCCTCTTGG + Intronic
1109866618 13:68272807-68272829 CCGGTCAGGCACAGCCCCGTGGG - Intergenic
1113014651 13:105814884-105814906 CTCCTAAATCACAGCCCACTAGG - Intergenic
1113638892 13:111943331-111943353 CTGCACAGGCACAGCCCATGTGG - Intergenic
1119387655 14:74267799-74267821 CTGCTTAGTCACAGCTAAGCAGG + Intergenic
1119997383 14:79268462-79268484 TTGCTCAGCCACAGCACATTGGG + Intronic
1122269033 14:100560128-100560150 CTGCTCTGCCACAGGCCACTGGG + Intronic
1122803556 14:104245133-104245155 CTGCTCAGGCCCAGGACAGTGGG + Intergenic
1122961890 14:105097767-105097789 CAGCTCAGTCACAGGTCAGTGGG - Intergenic
1125078391 15:35648293-35648315 CTTCTCAGTCAAAGCTCATTGGG + Intergenic
1128543277 15:68551417-68551439 CTCTTCACCCACAGCCCAGTGGG - Intergenic
1128757929 15:70195957-70195979 CTGCTGAGTCACTGCCCAGCTGG + Intergenic
1130328172 15:82898056-82898078 CTGCCCACTCACAGCCCTGTTGG - Intronic
1132828336 16:1915896-1915918 TAGGTCGGTCACAGCCCAGTGGG + Intronic
1134682140 16:16133757-16133779 CTGCTCTGTGACACCCCTGTAGG + Intronic
1135975051 16:27103237-27103259 ATTCAGAGTCACAGCCCAGTGGG + Intergenic
1136473849 16:30499542-30499564 CAGCTCCGTCACTGTCCAGTGGG + Intronic
1137486085 16:48892489-48892511 GTGCTGAGTCCCATCCCAGTGGG + Intergenic
1139362459 16:66408921-66408943 CTCCTCAGTCCCAGGCCAGGTGG + Intergenic
1141497226 16:84418635-84418657 CTGCGCAGTCACACGGCAGTGGG + Intronic
1141625375 16:85258704-85258726 CTGGTCAGTGACCGCCCAGCGGG + Intergenic
1142979709 17:3664483-3664505 CTGCTCAGACAGAGCCCAGGAGG - Intronic
1143735457 17:8909156-8909178 CAGTTCAGACACAGCCCAGCTGG + Exonic
1145211034 17:21013195-21013217 CTGCTCAGTCACTGGGCATTAGG - Intronic
1145888469 17:28398530-28398552 CTGCTCAGACACAGGTCTGTAGG + Exonic
1145957037 17:28861755-28861777 GTGGTCAGGCACAGCCCAGGTGG + Intergenic
1147685998 17:42287360-42287382 CTGCCCACTCACAGCACAGCTGG - Intergenic
1148070479 17:44905862-44905884 CTGCTCAGTCAAAGCAGAGTGGG + Intronic
1148561727 17:48610362-48610384 CTGCTGGGTCGCGGCCCAGTGGG + Intronic
1148886990 17:50781130-50781152 CTGCTCAGCCACAGCCTCTTGGG + Intergenic
1149866977 17:60156552-60156574 CTGCTCAGTGCCAGTCAAGTGGG + Exonic
1149900134 17:60468668-60468690 CTGCTTAGTGTCAGCCCAGATGG - Intronic
1150284084 17:63945771-63945793 CTGCACACACACAGCCCAGCAGG - Intronic
1151231626 17:72689133-72689155 CTGCACAGTGACAGCCTTGTAGG + Intronic
1151552355 17:74829522-74829544 CTTCTCTGTCAGAGCCCAATGGG + Intronic
1151595701 17:75077049-75077071 CTGCTCAGACACAGCCTGGAGGG - Intergenic
1151687953 17:75660672-75660694 CTGTTCACTCACATCTCAGTAGG - Intronic
1151705541 17:75765162-75765184 CTGCTCCGGCACAGCCCCGTCGG + Exonic
1152532056 17:80924519-80924541 CTGCTCAGCCCCAGCCCACCTGG + Intronic
1152634260 17:81424008-81424030 CAGCTCTGTGCCAGCCCAGTCGG + Intronic
1154146034 18:11866947-11866969 CTCCTCAGTCACCCCACAGTGGG - Intronic
1154177806 18:12097406-12097428 CTGCTATGTCATATCCCAGTGGG + Intronic
1158670411 18:59469032-59469054 CTGCTCAGCTGCAGCCCAGGTGG + Intronic
1162336156 19:10061815-10061837 CTGCTCATCCACTGGCCAGTGGG - Intergenic
1162818790 19:13210648-13210670 CTCCTCTGTCACAGCCCCATGGG + Exonic
1163152824 19:15425052-15425074 CTGCTGAGTCACAGCCCAAAGGG + Intronic
1163548616 19:17952913-17952935 CTGCTCTGCCCCAGCCCAGCTGG - Intronic
1164304161 19:23988829-23988851 CTGCTTTGTCGCTGCCCAGTGGG - Intergenic
925810254 2:7693428-7693450 CTTCTCCGTCACTGCCAAGTGGG + Intergenic
926088887 2:10037404-10037426 CTGCTCAGTCAGCAGCCAGTGGG + Intergenic
929609012 2:43255961-43255983 CAGCTCGGTCACAGACCATTAGG + Intronic
930708361 2:54526290-54526312 CTGCTCACTCTTATCCCAGTTGG + Intronic
934554067 2:95278235-95278257 GTGCTCAGTCTGAGCCCAGAGGG + Intronic
935171603 2:100614719-100614741 CTGCTCTGTCCCACCCCAGCAGG + Intergenic
936664316 2:114576674-114576696 TAGCTCAGTCACAGTCCTGTGGG - Intronic
936867125 2:117087551-117087573 CTGCTCTGTCACAGCCCAGGAGG - Intergenic
939104871 2:137937419-137937441 CTTCTGAGTCACAGCCCCATAGG - Intergenic
942581387 2:177422475-177422497 CTCCTAAGTCAGAGTCCAGTGGG + Intronic
942942371 2:181633209-181633231 CAGCTCAGTTTCAGCCAAGTGGG + Intronic
944640059 2:201715748-201715770 CTGGGCCCTCACAGCCCAGTTGG + Exonic
948864844 2:240770076-240770098 CTTCCCACCCACAGCCCAGTGGG + Intronic
1168963017 20:1881645-1881667 CTGCTGGGACACAGCCCAGGCGG + Intergenic
1171167027 20:22981064-22981086 CTGCCAAATCACAGCTCAGTGGG - Intergenic
1172900906 20:38334303-38334325 CTGCTCAGCAACCGCGCAGTTGG - Intronic
1173714506 20:45190612-45190634 CTGCACATTCACAGCTCACTTGG + Intergenic
1174691000 20:52504273-52504295 CAGCTCAGTCACAGTAGAGTAGG + Intergenic
1177276242 21:18916437-18916459 TTCCTCAGTCACAGCACATTTGG + Intergenic
1178135975 21:29627710-29627732 CTGCACATTCACAGGCCAATAGG - Intronic
1179320617 21:40287706-40287728 CTGCTCAGTGTCAGCCCACCTGG - Intronic
1179585210 21:42370247-42370269 CCTCTCAGCCACAGCCCAGGTGG + Intergenic
1180079098 21:45478148-45478170 CTGCTCAGACACAGCCCTTGTGG + Intronic
1183113879 22:35674532-35674554 CTGCTCAACCACATTCCAGTGGG + Intergenic
1183365814 22:37406378-37406400 CAGCTCAATCACACCCCAGAGGG + Intronic
1184340338 22:43882334-43882356 CTGCAGAGCCACAGCCCTGTGGG + Intronic
1184896631 22:47411104-47411126 GAGCCCAGTCACAGCCCAGTGGG + Intergenic
1185104850 22:48861858-48861880 CTGCCCTGCCACAGCCCAGAGGG + Intergenic
1185208381 22:49553194-49553216 CTCCTCGGGCACAGCCCTGTGGG + Intronic
1185324470 22:50218961-50218983 CTGCTCTGGCACAGCCCCATGGG - Intronic
949584417 3:5423825-5423847 CTGCCAAGGCTCAGCCCAGTGGG - Intergenic
949919063 3:8987281-8987303 CAGCTGAGCCACAGCCCAGCTGG + Intronic
950480212 3:13239218-13239240 CGGCTCAGTCCCAGTCCACTGGG + Intergenic
952211173 3:31230986-31231008 CTGCCAAACCACAGCCCAGTAGG + Intergenic
953110884 3:39937019-39937041 CTGCTCTGTCACTGCCAAGCTGG - Intronic
954413858 3:50383355-50383377 CTTTTGAGTCCCAGCCCAGTGGG + Intronic
954485867 3:50850964-50850986 CTGCTCAGTCCCAGGGAAGTGGG + Intronic
954535412 3:51355965-51355987 CTCCTTACTGACAGCCCAGTAGG - Intronic
955361019 3:58275017-58275039 CTGGGCAGACACAGTCCAGTGGG + Intronic
956799744 3:72746259-72746281 CTGCCTAGTCGCAGCTCAGTGGG - Intergenic
958802801 3:98776232-98776254 TTGCTCAGGCACAGCCTGGTTGG - Intronic
961722819 3:128907677-128907699 CTGATCAGTGAGAGGCCAGTGGG - Intronic
964734544 3:159903185-159903207 CTGCTCAGTGAGAGGCCAGGGGG + Intergenic
967218918 3:187233059-187233081 CTGCACTGTCACAGCCCTATGGG + Intronic
968190152 3:196661364-196661386 CTGCTCAGACACAGCCTTCTGGG - Exonic
968814702 4:2815799-2815821 CAGCTCAGACCCAGCCCAGGGGG - Intronic
968968395 4:3781034-3781056 CGGCGAAGTCACAGCCCTGTTGG - Intergenic
970541422 4:17083731-17083753 CTACTCAGTCTCATCACAGTGGG + Intergenic
972579137 4:40379621-40379643 CAGCTCAGCCACAGTCCAGTAGG + Intergenic
978686809 4:111455105-111455127 GTGCCCAGTCCCAGCTCAGTGGG - Intergenic
980014231 4:127630318-127630340 CTCCTGAGTAGCAGCCCAGTAGG + Intronic
981202417 4:141996330-141996352 CTGCTCAGTCTCAGCCCAAGGGG + Intergenic
982199949 4:152950474-152950496 GTGCTCAGTCACAGCCAGCTCGG + Intronic
985080622 4:186260777-186260799 GTGGTCAATCAAAGCCCAGTAGG + Intergenic
985173063 4:187172919-187172941 TTTCTCAGCCACAGCCCAGCCGG - Intergenic
985552714 5:541559-541581 CTGCACAGACACAGCTCTGTGGG + Intergenic
986122411 5:4853757-4853779 CTGCTCAGTCAGTTCCCAATAGG + Intergenic
986166148 5:5273052-5273074 CTGCTGAGAGAGAGCCCAGTGGG + Intronic
986373844 5:7110017-7110039 TAGCTCATTAACAGCCCAGTGGG + Intergenic
987277599 5:16378070-16378092 CAGTGCAGTCACAGCCCAGAGGG - Intergenic
994088582 5:95787156-95787178 CTTCTCAGTCACAGCCCTTAAGG + Intronic
995262555 5:110122571-110122593 CAGCTCAGTCACAGCAGTGTAGG - Intergenic
996594481 5:125185363-125185385 CTGCACAGCCACAGCGCAGTAGG + Intergenic
998199433 5:140107891-140107913 CCGCTCACTCACAGCCCCCTTGG - Intronic
998560841 5:143170286-143170308 CTCCTCAGACACAGGCCACTGGG + Intronic
1006523202 6:34583928-34583950 CTTCTCCCTCACAGCCCAGCAGG + Intergenic
1010067956 6:71708249-71708271 GAGCTCACTCACAGACCAGTAGG + Intergenic
1011847496 6:91584623-91584645 CTTCTCAGCCACAGAACAGTGGG - Intergenic
1012215298 6:96575490-96575512 CTGCTCAGTCCCAGCTCATGAGG - Intronic
1019009712 6:168834267-168834289 CTGCACATTCAGAGGCCAGTTGG + Intergenic
1019544211 7:1565380-1565402 CTGCGGGTTCACAGCCCAGTTGG - Intergenic
1019852403 7:3573042-3573064 CAGCCCAGGCACAGCCAAGTGGG + Intronic
1022589779 7:31650635-31650657 CTGCTTAGTCACAGTCCTGGAGG - Intronic
1023921874 7:44636180-44636202 GTGCCCACTCACAGACCAGTAGG - Intronic
1024891634 7:54210680-54210702 CAGCTCAGTCACAGCAGAATAGG + Intergenic
1025142860 7:56479902-56479924 CTGCTGAGCCCCATCCCAGTAGG + Intergenic
1025258515 7:57400916-57400938 CTGCTGAGCCCCATCCCAGTAGG + Intergenic
1025709277 7:63892016-63892038 CTGCTGAGCCCCATCCCAGTAGG + Intergenic
1026812807 7:73482913-73482935 CTGGGCAGTCACAGCCAAATGGG + Intronic
1028652282 7:93162780-93162802 CTGGACAGCCACAGCACAGTAGG + Intergenic
1028732927 7:94173662-94173684 CTGCACATACACAGCCCACTTGG - Intergenic
1030113578 7:106046713-106046735 CTGCCCAGTCACAGCCCCCAAGG - Intergenic
1032122583 7:129167974-129167996 CCCCCCAGTGACAGCCCAGTGGG + Exonic
1035317467 7:158005674-158005696 CTGGTCAGTCACTGCACAGCTGG + Intronic
1037780964 8:21868821-21868843 CTCCTAAGTCACAGCACAGGCGG - Intergenic
1038863234 8:31410507-31410529 TTGCTTATTCACAGCACAGTAGG + Intergenic
1041395362 8:57384660-57384682 ATGCTTGGTCACAGGCCAGTTGG + Intergenic
1043158498 8:76816540-76816562 CAGCTCAGTCACAGCTCCCTAGG - Intronic
1045010054 8:97951093-97951115 CAGCTCAGCCACAGCTCAGGTGG - Intronic
1053279456 9:36808408-36808430 CTGTGCAGACACAGCCCAGGAGG + Intergenic
1057314170 9:93958390-93958412 CTGCTCAGGCACTGCCGCGTTGG + Intergenic
1057888348 9:98848522-98848544 CAGCTCAGCCACAGACCAGATGG - Intronic
1060342374 9:122788910-122788932 CTTCTCAGTCTCTGTCCAGTAGG + Intergenic
1060380874 9:123170549-123170571 CTGCACAGTCACTGACCAGGAGG + Intronic
1062378853 9:136277154-136277176 CTTGTCAGTCAGAGCCCAGTGGG + Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1185830639 X:3299597-3299619 CAGGTCAGTTACAGCTCAGTTGG + Intergenic
1189770114 X:44417020-44417042 CAGCTCAGTCACAGCAGAATAGG - Intergenic
1190280278 X:48924623-48924645 CAACTCAGGCACAGCCCAGAGGG - Intronic
1194889777 X:99364372-99364394 CAGCTCAGCCACAGCACAATAGG + Intergenic
1195860347 X:109376280-109376302 CTGCTCTGGCTCAGCCCCGTAGG - Intronic
1196247341 X:113415406-113415428 CTGCTCAGCCACAGCAAAATAGG + Intergenic
1200895051 Y:8366821-8366843 TTGCTCAATCACAACCCTGTGGG + Intergenic