ID: 1091127077

View in Genome Browser
Species Human (GRCh38)
Location 11:133110008-133110030
Sequence GTTCGACAGGACTTGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091127073_1091127077 12 Left 1091127073 11:133109973-133109995 CCATAGGACATTTGACAATCTCT 0: 1
1: 0
2: 21
3: 191
4: 800
Right 1091127077 11:133110008-133110030 GTTCGACAGGACTTGGGTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091127077 Original CRISPR GTTCGACAGGACTTGGGTGA AGG Intronic
901284946 1:8070496-8070518 GTTGGACTGGACTTTGGAGATGG + Intergenic
903262175 1:22137222-22137244 GTTTGCCAGGACATGGGGGAGGG + Intronic
904438661 1:30515612-30515634 GGTGGACAGGACTTGGGGGATGG + Intergenic
904586828 1:31585341-31585363 GTAAGTCAGCACTTGGGTGAGGG + Intronic
905466007 1:38153944-38153966 AATCAACAGGACTTGGGGGATGG - Intergenic
908572833 1:65427074-65427096 GTTGGCCAGGACTGCGGTGATGG - Intronic
914386669 1:147175936-147175958 GTTTGCCAGGACTTGGGGGTGGG + Intronic
915318684 1:155044037-155044059 GATGGGCAGGGCTTGGGTGAGGG + Intronic
915911049 1:159915736-159915758 GTTCAACAGGACAGTGGTGAAGG + Intergenic
920227536 1:204449442-204449464 CTTTTACAGGACTTGGGAGAAGG - Intronic
921825702 1:219669660-219669682 GTTTGGCAGGACTTGGATGGGGG + Intergenic
922914344 1:229243579-229243601 ATTTTACAGGACTTGGGAGAGGG - Intergenic
924340051 1:243020986-243021008 GTTGGACAGGAAGTGGGAGAAGG + Intergenic
1063980148 10:11446070-11446092 GGTCGAGAGGACTAGGGTGGTGG - Intergenic
1073103892 10:101021440-101021462 TTTGGACAGGACCTGGGTGATGG - Intronic
1074068569 10:110042294-110042316 GTTCTATACTACTTGGGTGAGGG + Intronic
1076517427 10:131055492-131055514 CTTCGACAGGAGCTGGGTAAGGG + Intergenic
1084456573 11:69271212-69271234 GTCCGAAGGGCCTTGGGTGATGG + Intergenic
1091127077 11:133110008-133110030 GTTCGACAGGACTTGGGTGAAGG + Intronic
1092182861 12:6457989-6458011 GTCCAAAAGGACTGGGGTGATGG - Intronic
1093123028 12:15295558-15295580 ATTCAAAAGGACTTGGGTGTTGG - Intronic
1095988511 12:48017041-48017063 GTTATCCTGGACTTGGGTGATGG + Intergenic
1102209175 12:111112084-111112106 GTTGCTCAGGACTTGGGTGAGGG + Intronic
1106687562 13:32077151-32077173 CATCAGCAGGACTTGGGTGAGGG + Intronic
1115092557 14:29595755-29595777 GTTACACAGGAATTGGGTGTGGG - Intronic
1115345814 14:32342384-32342406 ACTCAACAGGACTTAGGTGAGGG - Intronic
1115472148 14:33779135-33779157 GTTCCCCAGGAGTTGGGGGATGG - Intronic
1119588255 14:75859056-75859078 GTTTGGCTGGACTTGGGTGGAGG + Intronic
1122444471 14:101759386-101759408 AGTCTACAGGACTGGGGTGAGGG - Intergenic
1128089369 15:64908990-64909012 TTTTTACAGGACTTGGGTGGTGG + Intronic
1144712495 17:17411060-17411082 CTTCAACAGGGCTTTGGTGAGGG + Intergenic
1147764427 17:42824171-42824193 GGTAGACCGGACTTGGGTGACGG - Exonic
1150118689 17:62579882-62579904 GAGCCACAGGACTTGGGTGCTGG - Intronic
1152680305 17:81664446-81664468 CTTTGCCAGGACTTGGGGGAAGG + Intergenic
1158889266 18:61858299-61858321 GTTCCAGAGGGCTTGGGGGAGGG - Intronic
1159781044 18:72660771-72660793 GTTCAACAGTAATTGGATGAGGG - Intergenic
1163530094 19:17843785-17843807 GTACAGCAGGACTTGGGTGCTGG + Exonic
1165746255 19:38231473-38231495 GATGGACAGGACTGGGGTGCAGG - Intergenic
925139609 2:1540767-1540789 GTTGGACAGGATCTGGGTGTCGG + Intronic
933974564 2:87497769-87497791 CTTCTCCAGAACTTGGGTGAAGG - Intergenic
936319260 2:111453045-111453067 CTTCTCCAGAACTTGGGTGAAGG + Intergenic
937430034 2:121830610-121830632 GATAGACAGGACTTAGGTGATGG + Intergenic
938920663 2:135991730-135991752 GTTGCCCAGGACTTGGGGGAGGG - Intergenic
942798450 2:179848836-179848858 CTTCTTCAGGACTTGGGTGTCGG + Intronic
947142733 2:227034425-227034447 GTGGGACAGGACTTGTGAGAAGG - Intronic
1171300802 20:24058691-24058713 GGTTGCCAGGACTGGGGTGAGGG + Intergenic
1175327656 20:58140909-58140931 GGTGGACAGGAGTTGGGGGAGGG + Intergenic
1175492729 20:59390068-59390090 GTTCGCCAGGACTGGGGTCAGGG - Intergenic
1176022035 20:62966899-62966921 GTTCCACTGGACTTTGCTGACGG + Intronic
1180776162 22:18485623-18485645 GCAAGACAGAACTTGGGTGAGGG - Intergenic
952892044 3:38049818-38049840 GTTCCCAAGGACTTTGGTGATGG - Intronic
954866363 3:53733092-53733114 GTTGGAGGGGACTTGGGTGAGGG - Intronic
967488854 3:190065425-190065447 GTTCAAGAGGTGTTGGGTGATGG - Intronic
973710644 4:53627014-53627036 GTTGGACAGGAGTGGGGTGTGGG + Intronic
974127098 4:57709869-57709891 CCTGGACAGGACTCGGGTGATGG + Intergenic
975617874 4:76265463-76265485 GTTGCTCAGAACTTGGGTGAGGG + Intronic
988533934 5:32049486-32049508 GTTCTAAAGGACCTGGGTCAGGG + Intronic
988970598 5:36463849-36463871 GTTTGCCAGGACTTGGGGGCTGG + Intergenic
997027395 5:130081342-130081364 GTGCTGCAGGACTTGGGGGAGGG + Intronic
998097482 5:139404379-139404401 GTTTAACAGGCCCTGGGTGAAGG - Intergenic
998819753 5:146047882-146047904 TTGTGCCAGGACTTGGGTGAAGG - Intronic
999614741 5:153411103-153411125 GTTCGACAGCACTAGGATAAGGG + Intergenic
1001314100 5:170630518-170630540 GTCCATCAGGACTTGGGGGAGGG + Intronic
1004774746 6:18831004-18831026 CTTGGACAGGACTTGGCTGAAGG - Intergenic
1007967224 6:46014544-46014566 AGTCGCCAGGACTTGGGGGAGGG - Intronic
1019511012 7:1417304-1417326 GGTGGACAAGACTTGGGTGTGGG - Intergenic
1019515750 7:1439145-1439167 GTTGGGCAGGACGTGGGTGTAGG - Intronic
1020342842 7:7131317-7131339 TTTCAAAAGGACTTGTGTGAGGG - Intergenic
1022051236 7:26675337-26675359 ATTGGACAGGATTTGGCTGAGGG - Intronic
1027124188 7:75544298-75544320 GTTAGATAGTACTTGGATGATGG - Intronic
1028266533 7:88733289-88733311 TTGCCACAGGCCTTGGGTGATGG - Intergenic
1034596727 7:152202599-152202621 TTTCAACAGAACTTGGGTGTGGG + Intronic
1035414690 7:158673134-158673156 GAAAGACAGGACTTGGGTGAAGG + Intronic
1036959089 8:13224545-13224567 GTCTGACAGGACTTGGATGTGGG + Intronic
1045523666 8:102925183-102925205 GTTAGACAGCAGTTGGGTGGTGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1051331547 9:16029367-16029389 GTTTTAAAGGACTTGGGTCAGGG + Intronic
1051369838 9:16348962-16348984 GTTAGTCAGGACTTGTGTTATGG - Intergenic
1052938106 9:34110343-34110365 GTTAGGCAGGACTAGGATGATGG - Intronic
1054862700 9:69969792-69969814 GTTGGACAGGAGTTAGGGGAAGG - Intergenic
1056509431 9:87289060-87289082 GTTTGCCAACACTTGGGTGATGG + Intergenic
1059073334 9:111163619-111163641 TTTGGACAGGATTTGGATGAAGG - Intergenic
1059090820 9:111356032-111356054 GATTGACAGGAGTTGGGGGAAGG - Intergenic
1061261156 9:129481858-129481880 GGTCTTCAGGACTTGGGAGATGG - Intergenic
1062190813 9:135246985-135247007 GCTCCACAGGCCTCGGGTGATGG + Intergenic
1186386916 X:9119472-9119494 GATCCACAGGACATAGGTGAAGG + Intronic
1186788270 X:12973483-12973505 TTTCGACAGCAGCTGGGTGAGGG + Intergenic
1190275524 X:48896895-48896917 GTGTGACAGGACCTGGGGGAGGG - Intronic
1200157225 X:153983582-153983604 GTTCGCAAGGACCTGGGTGACGG - Intergenic