ID: 1091127482

View in Genome Browser
Species Human (GRCh38)
Location 11:133114020-133114042
Sequence CTGTTTCTGAAGAAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091127482_1091127485 20 Left 1091127482 11:133114020-133114042 CCTCCCTGCTTCTTCAGAAACAG 0: 1
1: 0
2: 1
3: 19
4: 313
Right 1091127485 11:133114063-133114085 AGAATAATCATTCCTGATACTGG 0: 1
1: 0
2: 1
3: 16
4: 149
1091127482_1091127486 29 Left 1091127482 11:133114020-133114042 CCTCCCTGCTTCTTCAGAAACAG 0: 1
1: 0
2: 1
3: 19
4: 313
Right 1091127486 11:133114072-133114094 ATTCCTGATACTGGCAGTTGTGG 0: 1
1: 0
2: 2
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091127482 Original CRISPR CTGTTTCTGAAGAAGCAGGG AGG (reversed) Intronic
900390109 1:2430139-2430161 CTGTGTCTGAAGAGTCAGGTGGG - Intronic
901228304 1:7627674-7627696 CTGATGCTGAGGAAGCAGAGTGG - Intronic
901880766 1:12192542-12192564 TTGGTTCTGGAGGAGCAGGGAGG + Intronic
902257095 1:15196965-15196987 CTGTGTCTGAAGAACCCTGGAGG - Intronic
903196108 1:21689499-21689521 CTGTATCTGGAGAAGAATGGGGG + Intronic
904373521 1:30065871-30065893 CTGTTAGTGAGGAAGCTGGGAGG - Intergenic
906341652 1:44986337-44986359 CTGTGTCCGAAGTAGAAGGGAGG - Intronic
906383619 1:45348371-45348393 GTGTTTCTGAGGAAGGAGGAAGG - Intronic
907629526 1:56066358-56066380 CTGTTTTTGAAGCAGGATGGAGG + Intergenic
907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG + Intergenic
909646837 1:77926864-77926886 GTGCTTTTGAAGAAGCAAGGCGG + Exonic
910393428 1:86767957-86767979 CTGGTTTTGAAGAAGTAGGAAGG - Intergenic
911985685 1:104618931-104618953 CAGTTTCTGTTGAAGCAGGGTGG - Intergenic
912392652 1:109315183-109315205 CTGTGTCAGAAGAACCAGGCAGG + Intronic
912413749 1:109494503-109494525 CTGTTTCTGAGGAAGTAGTTCGG - Exonic
912460749 1:109829362-109829384 TTGTTTCTGGAGAACCAGCGGGG - Intergenic
913529257 1:119721892-119721914 CTGTTTCTGCAGAAACACAGGGG + Intronic
914323149 1:146584706-146584728 GTGTTTCTGCAAAAGCACGGTGG - Intergenic
915594248 1:156887383-156887405 CTTTTTCTTTGGAAGCAGGGAGG + Intergenic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
917367283 1:174246211-174246233 TTGTTTTTGAAGAGGCAGGGAGG - Intronic
918072335 1:181142071-181142093 CTGTTTCTGAGAAAGCCTGGTGG - Intergenic
919322511 1:196061110-196061132 GTGTTTTTGAAGAAGCAAAGTGG - Intergenic
920518857 1:206608105-206608127 CGGTTTTGGAAGAAGCAGAGTGG - Intronic
922249127 1:223831089-223831111 CTCTTTCTCAAAAAGCAGGCAGG + Intronic
1064084924 10:12338298-12338320 GTGTTTCTGAAAAAGGAGGAAGG - Intergenic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1066457606 10:35585519-35585541 CTGTTTCTGAAGGAGAGGCGTGG - Intergenic
1068335335 10:55627658-55627680 CTGCTGCTGAAGGAGCAGAGGGG - Intronic
1069901798 10:71710707-71710729 CAGTACATGAAGAAGCAGGGAGG + Intronic
1069931167 10:71882687-71882709 TTGTTACTGAAGACTCAGGGAGG - Intergenic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1071805928 10:89120878-89120900 CTGAGTCTGGAGAAGCAGGAAGG + Intergenic
1075338966 10:121630259-121630281 CTGTCTCGGAAGAAGGAAGGAGG + Intergenic
1075849268 10:125574115-125574137 CTGGTTTTGAAGATCCAGGGAGG - Intergenic
1076062366 10:127423394-127423416 CTGTTTCTGAGGCAGCAAGCAGG - Intronic
1076768055 10:132647572-132647594 CTCATTCCGAAGAAGCAGTGGGG + Intronic
1077717719 11:4598646-4598668 CTGATTCTCAAGAAGCAGTCTGG + Intergenic
1078221697 11:9356675-9356697 CTGTTTTTAAAAAAGGAGGGAGG + Intergenic
1080387612 11:31819085-31819107 GTGTGTGTGTAGAAGCAGGGAGG + Intronic
1081280206 11:41200552-41200574 CTGTTTTTGCAGAAGTAGGTAGG - Intronic
1083032271 11:59604007-59604029 CTGTTTCTGAGTAAGGAGGATGG - Intronic
1084268713 11:68017962-68017984 CTGTTTAGCAAGAAGCAGAGTGG - Intronic
1084551392 11:69845107-69845129 CTGTTACTAAAGAAGGAAGGGGG - Intergenic
1085634664 11:78149276-78149298 CTGTCTCTGGGGGAGCAGGGAGG - Intergenic
1085879524 11:80449382-80449404 CTGTTTCTGCAGCAGCATAGTGG - Intergenic
1087434855 11:98101881-98101903 CTGTTGGTGAAGATGCAGGTTGG + Intergenic
1088439661 11:109855706-109855728 CTGTGTCTCAGGAAGTAGGGAGG - Intergenic
1088598995 11:111459412-111459434 CTGTTTTGGAAGAAGCAAGTGGG - Intergenic
1088618618 11:111659521-111659543 ATGTGTCTCAAGAAGCAGAGAGG - Intronic
1088967620 11:114739454-114739476 GTTTTACTGAAGAAGGAGGGAGG - Intergenic
1089021514 11:115220285-115220307 GTGGTACTGAAGAAGCAGGGTGG - Intronic
1089830565 11:121324043-121324065 CAGTTCCTGAGGAACCAGGGTGG - Intergenic
1089841632 11:121423818-121423840 TTGTTCCTGGAGCAGCAGGGAGG - Intergenic
1091127482 11:133114020-133114042 CTGTTTCTGAAGAAGCAGGGAGG - Intronic
1093719186 12:22418678-22418700 CTGGTTTTGAAGATGGAGGGAGG + Intronic
1093719685 12:22425318-22425340 CTGGTTTTGAAGACGGAGGGAGG + Intronic
1094383685 12:29870693-29870715 ATGCTTCTTAAGAAGGAGGGTGG + Intergenic
1096245418 12:49982355-49982377 CTGGTTCTGGAGCAGCAGGCTGG + Intronic
1096514532 12:52148669-52148691 CAGCTTCTGACAAAGCAGGGTGG - Intergenic
1096862327 12:54538753-54538775 ATGTTCCTGAAGACTCAGGGTGG - Intronic
1098323715 12:69278630-69278652 CTGTCTCTTAAGAAATAGGGAGG - Intergenic
1098530347 12:71534643-71534665 CTGTTTCTGAGGAATGAGTGAGG - Intronic
1098997417 12:77136684-77136706 CTGTATGTGAGGAAGCATGGTGG + Intergenic
1099047282 12:77737312-77737334 GTGTTTCTTAAAAAGGAGGGTGG + Intergenic
1099370721 12:81826436-81826458 ATCTTTCTGAAGAAAGAGGGAGG + Intergenic
1099832649 12:87865043-87865065 TTGTTTCTGAGGAAGAAAGGAGG - Intergenic
1100401612 12:94235213-94235235 ATGTTTTTGAAGTAGCAAGGCGG + Intronic
1101803523 12:108043456-108043478 CTGTTCAGGAAAAAGCAGGGAGG + Intergenic
1103027727 12:117587395-117587417 CTGGTTTTGAAGGAGGAGGGGGG + Intronic
1105393010 13:19999527-19999549 CTGTGTCTCAAGGAACAGGGAGG - Intronic
1105814795 13:24025008-24025030 CTGTTTCTTAAGATGTATGGGGG - Intronic
1106169037 13:27272879-27272901 CTGCTTCTGCAGAAGCTGGGTGG + Intronic
1106393696 13:29359997-29360019 ATTTTTCTGAAAATGCAGGGAGG + Intronic
1113045334 13:106148724-106148746 CTGTGTATGAAAAAGCAGTGTGG - Intergenic
1113987034 13:114325456-114325478 GTGCTTCTGGAGAAGCAGGAGGG - Exonic
1117420517 14:55540312-55540334 CTGGCTCTGAAGATGAAGGGAGG + Intergenic
1117647867 14:57871167-57871189 CTGCTTCTGGACAAGCTGGGAGG - Intronic
1117898703 14:60511719-60511741 CTGTTTCTAAACATGCAGGCTGG + Exonic
1118436195 14:65772859-65772881 TTCTTTTTGAAGAAGCAGGAGGG + Intergenic
1118487089 14:66224524-66224546 CTGTCTTTGAAGAGGCAGAGGGG + Intergenic
1119607939 14:76036830-76036852 CTGTTTCTAAAAAAGAAGGAGGG - Intronic
1125564672 15:40667588-40667610 CTGTTTCAGAAGAGGAAGAGAGG + Intergenic
1126346623 15:47701825-47701847 CTGTGCCTGAAGAACCAGGTGGG - Intronic
1127288522 15:57550851-57550873 CGGTTTCTGAAACAGAAGGGTGG + Intergenic
1129002733 15:72347602-72347624 CAGTCTCTGTAGAGGCAGGGAGG + Intronic
1129058215 15:72837326-72837348 CTGGTTCTTAAGAAGAAGGAAGG + Intergenic
1130217751 15:81988189-81988211 CTGTTTCAGAAAGAGCAGGAAGG + Intergenic
1130334946 15:82950776-82950798 TTGTTTGTGGAGAAGCAGGGAGG - Intronic
1131551323 15:93359619-93359641 CTGTTTGTGGAAGAGCAGGGTGG + Intergenic
1131764365 15:95659322-95659344 GTGTCCCTGAAAAAGCAGGGAGG - Intergenic
1134916242 16:18073403-18073425 ATGTTGCTGAAGAAGCAGCCAGG + Intergenic
1136461716 16:30415332-30415354 CTGTTTCTGAAGCTGCAGGAGGG - Intronic
1136530835 16:30867887-30867909 CTGACTCTGAAGATGGAGGGAGG + Intronic
1136576075 16:31126199-31126221 CTGTTTGTGCAGAAGCATGAAGG + Intronic
1136774589 16:32865010-32865032 CTTGTTCTCAAGAAGAAGGGAGG + Intergenic
1136896023 16:33996504-33996526 CTTGTTCTCAAGAAGAAGGGAGG - Intergenic
1137468031 16:48729037-48729059 ATGTTTGAGAAGCAGCAGGGAGG - Intergenic
1138325723 16:56165575-56165597 CTGTTCCTAAAGAAGCTTGGAGG - Intergenic
1139478978 16:67217907-67217929 CTCTTCCTGAGGAAGCAGAGAGG - Intronic
1139597212 16:67965178-67965200 CTGATCCTGAACAAGCATGGAGG - Intronic
1140010411 16:71126144-71126166 GTGTTTCTGCAAAAGCATGGTGG + Intronic
1140712547 16:77691804-77691826 CTGTGTCTGCAGTAGCACGGGGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141705772 16:85663663-85663685 GGGTTTCTGAAGCAGCAGGTGGG + Intronic
1141752505 16:85968270-85968292 CTGTTTCAGCAGAACTAGGGTGG + Intergenic
1142305947 16:89285751-89285773 GTGTCTCTGCAGAGGCAGGGTGG - Intronic
1203077015 16_KI270728v1_random:1127146-1127168 CTTGTTCTCAAGAAGAAGGGAGG + Intergenic
1143266594 17:5642584-5642606 CTGTTTCTGGAGCAGTATGGTGG - Intergenic
1143735744 17:8911076-8911098 CTGATTCTGAAAAAGCAGCTGGG - Intronic
1146913091 17:36660521-36660543 CAGATTCCGAAGAAGCTGGGAGG - Intergenic
1147049547 17:37781764-37781786 CTGTTTTTTTAGAAGCAGGGAGG - Intergenic
1147197958 17:38780182-38780204 CTCTTTCAGAAGAAACGGGGCGG + Intronic
1150468137 17:65412784-65412806 CTGTTTCTCAGGGAACAGGGAGG + Intergenic
1150880085 17:69014747-69014769 CTCTTTCTGAGGAAGCACAGAGG + Intronic
1152374458 17:79911925-79911947 CTGTCTCTGAAGCACCAGGATGG - Intergenic
1153030669 18:710510-710532 CTGTTTCTAAAGAAAAAAGGAGG - Intronic
1154171485 18:12056244-12056266 CTGTTTCTAAGGAGGCATGGTGG - Intergenic
1156747852 18:40414392-40414414 CTGCTTCTGAAAAAGCAGATTGG - Intergenic
1156860616 18:41831943-41831965 CTGTTTCTTTAGCAGCAAGGAGG - Intergenic
1158217083 18:55111464-55111486 GTGTGTCTGGAGCAGCAGGGGGG - Intergenic
1160169966 18:76544784-76544806 CTGGTGCAGAAGAGGCAGGGGGG + Intergenic
1163783079 19:19260763-19260785 TTGCTTCTGAGGAAGGAGGGGGG - Intronic
1164338861 19:24365176-24365198 CTGTTTTTGAAGAATCTGTGAGG + Intergenic
1164339667 19:24377616-24377638 CTGTTTTTGTAGAATCTGGGAGG + Intergenic
1164860060 19:31555638-31555660 CTGGTTCTAAAGATGCAGAGAGG - Intergenic
1165161107 19:33816946-33816968 CTGTCTCTGGAGAATCAGGAGGG - Intergenic
1165287541 19:34854181-34854203 CTGCATCAGAAGATGCAGGGTGG + Intergenic
1165463480 19:35958464-35958486 CTGGTTCTGAGGAGGCTGGGCGG + Intergenic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1166569536 19:43784894-43784916 CTGGTTCTGAGGGAGGAGGGGGG + Intergenic
1167235426 19:48311764-48311786 CTGTTTCTCAGGAAACAGGCCGG - Intronic
1167264813 19:48478258-48478280 CTTGTCCTGAAGAAGCAAGGTGG - Exonic
1168588084 19:57610642-57610664 CTGTTCCTCAGGAAACAGGGAGG + Intronic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
926391800 2:12401590-12401612 GTGTTTCTGAAGATGTAGGGTGG - Intergenic
926670252 2:15570422-15570444 CTGTTTGTAACAAAGCAGGGGGG - Intergenic
926684069 2:15685069-15685091 CTGACTCTGAAGAAGCAGCTGGG - Intergenic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
928290880 2:30036373-30036395 CTTTTCATGAAGAAGTAGGGAGG - Intergenic
930031469 2:47060685-47060707 CTGGCTCTGAGGATGCAGGGAGG + Intronic
930511010 2:52345596-52345618 CTGGTTCTGGAGACGCAAGGGGG - Intergenic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG + Intergenic
937744521 2:125395823-125395845 ATGGTGCTGAAAAAGCAGGGCGG + Intergenic
938064296 2:128272765-128272787 TGGTTTCTGAAAAAGCTGGGAGG + Intronic
939877949 2:147599043-147599065 CTTTTTCTGCAGAAGCCTGGAGG + Intergenic
940024827 2:149194807-149194829 GTGTTTCTGGAGAAGCAAAGAGG + Intronic
941173416 2:162167477-162167499 CTGTTTGTAAAGAAGAAAGGAGG - Intergenic
941863322 2:170307945-170307967 CTATTTCTGAAGTAGGAGGCAGG - Intronic
942932784 2:181515791-181515813 CTGTTTCTGAGAAAGGAGAGAGG - Intronic
943928110 2:193814280-193814302 TTGTTTCTTGACAAGCAGGGAGG - Intergenic
945655284 2:212615890-212615912 CTGTTTCTGAAGTGAAAGGGAGG + Intergenic
946819273 2:223613554-223613576 CGGTTTCGGAGGAACCAGGGCGG + Intergenic
948920164 2:241062578-241062600 GTGTCTGTGAAGCAGCAGGGCGG - Intronic
1169305854 20:4489724-4489746 CTGTTGCAGAAGAAACAGTGTGG - Intergenic
1169519382 20:6354757-6354779 CTGTTTCTGAAGAGGAAAAGGGG + Intergenic
1169653707 20:7898126-7898148 CTGTTGCATAAGAAGTAGGGTGG + Intronic
1169910630 20:10645007-10645029 CTGTTTCTGGATACTCAGGGAGG - Intronic
1170567530 20:17615451-17615473 CTGTTTCTGAAGACTCTAGGGGG + Exonic
1171182437 20:23100752-23100774 CTGATGTTGAAGAAGCAAGGAGG + Intergenic
1172364159 20:34336040-34336062 CTGTTTCTGCAGTAGCCTGGTGG - Intergenic
1172626139 20:36348209-36348231 CAGTTACTGAAGAAGGAAGGAGG + Intronic
1174186614 20:48710785-48710807 CTGTTCCTGCAGACGCAGTGTGG - Intronic
1174195857 20:48772376-48772398 CTGTTTCTGGTGAATCAGGCCGG + Intronic
1174368928 20:50073306-50073328 CAGCTTCTGAAGAAGGTGGGTGG + Intergenic
1174513966 20:51076931-51076953 CTGTATCTGGGGGAGCAGGGGGG - Intergenic
1174692530 20:52521868-52521890 TTGTGTCTCAAGAAGTAGGGAGG + Intergenic
1175482127 20:59319183-59319205 CTGTTTCTGAGGAACTTGGGTGG + Intronic
1176545452 21:8195672-8195694 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
1176564403 21:8378717-8378739 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
1176801187 21:13432368-13432390 TTGGTTCTCAAGAGGCAGGGTGG + Intergenic
1177384798 21:20394812-20394834 CTGCTTTTGAACAAACAGGGTGG - Intergenic
1177961464 21:27672117-27672139 GTGCTTCTGAAGAGGCAGTGTGG - Intergenic
1180671195 22:17554873-17554895 GTGTTTGTGCAGAAGCAGGGAGG + Intronic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1182358022 22:29731001-29731023 CATCTTCTTAAGAAGCAGGGGGG + Exonic
1183619149 22:38962478-38962500 CTGATTCTGGAAGAGCAGGGGGG - Exonic
1183624349 22:38992414-38992436 CTGATTCTGGAAGAGCAGGGGGG - Exonic
1183640099 22:39087390-39087412 CTGATTCTGGAAGAGCAGGGAGG - Exonic
1184196027 22:42929098-42929120 CTGGATCTGATGAAGTAGGGAGG - Intronic
1203250322 22_KI270733v1_random:111910-111932 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
950006130 3:9692096-9692118 TTGTTACCTAAGAAGCAGGGAGG - Intronic
950255121 3:11498363-11498385 CTGCTGCTGAAGAAGCGGGCAGG + Intronic
951650258 3:24943748-24943770 CATTTTCTGAATAAGCAGAGTGG + Intergenic
952420027 3:33122289-33122311 CTGGTTCTGCAGAAGCAGCGGGG - Intronic
952441585 3:33335843-33335865 CTGTCTCAGAAGAAGCGGGCAGG + Intronic
953405888 3:42659527-42659549 CTGAACCTGAAGAAGCTGGGCGG + Exonic
953838733 3:46370870-46370892 CTGTTTCTTTTGAAGGAGGGTGG - Exonic
954350260 3:50037399-50037421 CTGTCTCAAAAAAAGCAGGGGGG + Intronic
960622324 3:119648764-119648786 CTTTTACTGAAGAAGCTGTGTGG + Intronic
961578143 3:127855423-127855445 CTGGCTCTGAAGATGGAGGGAGG - Intergenic
961584565 3:127911339-127911361 CAGTTTCTGAAGAACAAGGAAGG - Intergenic
962904545 3:139789904-139789926 CATTTTCTGAAGAAGCATGCTGG - Intergenic
963008289 3:140746834-140746856 CTGGCTTTGAAGAAGGAGGGAGG - Intergenic
963561886 3:146876088-146876110 CTGTTTGGGAAGAAGCAGCAGGG + Intergenic
966443167 3:179969863-179969885 TATTTTCTGAAGAAGCAGGAAGG + Intronic
969104444 4:4794628-4794650 CATTTTCAGAAGAAGCAGGATGG - Intergenic
969217893 4:5736816-5736838 CTGTGTCTCAAGAAATAGGGAGG - Intronic
969305913 4:6326247-6326269 GTGTGTAAGAAGAAGCAGGGAGG + Intronic
969515042 4:7642564-7642586 CTAATTCTCAAGAAGCAGGGTGG + Intronic
969692561 4:8711621-8711643 CTGTCCCTGAAGCAGCAGTGTGG - Intergenic
970398251 4:15692896-15692918 CTGGCTCTGAAGATGCAGGAAGG - Intronic
971679879 4:29684038-29684060 TTGTTTCTCAAAAAGTAGGGAGG - Intergenic
972589392 4:40470159-40470181 CAGTTTCTGGAGAAACGGGGTGG + Intronic
975285518 4:72614148-72614170 CTGGCTCTGAAGAAGTAGAGTGG + Intergenic
975815376 4:78211378-78211400 CTGTCATTGAAAAAGCAGGGAGG + Intronic
977695273 4:99957780-99957802 CTGTTTAGGAAGATGTAGGGGGG + Intergenic
978281462 4:107020870-107020892 CTGTTTCTGAAAGAGGAGGCAGG - Intronic
978419336 4:108513320-108513342 ATGGTGCTGAACAAGCAGGGAGG - Intergenic
978564924 4:110071577-110071599 CAGTTTCAGAACCAGCAGGGGGG + Intronic
978623944 4:110663415-110663437 CTGTTATTGAAAAAGCAAGGGGG + Intergenic
979053261 4:115963290-115963312 CTGATTTTGTAGAATCAGGGAGG + Intergenic
980180835 4:129398681-129398703 ATGCTTCTGAAGCAGCTGGGAGG - Intergenic
981933288 4:150212718-150212740 ATCTTTCTGAGGATGCAGGGAGG + Intronic
984946212 4:184970541-184970563 CAGTTTTTGGAGAAGCATGGAGG - Intergenic
985925439 5:3012542-3012564 CTGTGTCTGTAGAATCAGGATGG - Intergenic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
986705081 5:10447927-10447949 CTGATTGTGAAGTGGCAGGGAGG + Intronic
986917943 5:12647585-12647607 CAGGTCCAGAAGAAGCAGGGTGG + Intergenic
987165424 5:15193352-15193374 CTGTTTATGAAGGAGCAAGAAGG - Intergenic
987274699 5:16350116-16350138 TTATCTCTGAAGAAGGAGGGAGG - Intergenic
991013106 5:61904181-61904203 CTGTTTCTGGTGAAGCAAGCTGG - Intergenic
991278361 5:64879560-64879582 CTATTTCTGAAATAGCAGAGGGG + Intronic
991974006 5:72168208-72168230 CTGTTGCTGGAGAAGCTGGAAGG - Intronic
991990729 5:72336350-72336372 CTGTGTCAGAAGTACCAGGGAGG - Intronic
993962815 5:94320891-94320913 CTGCTTTTGAAGAATCAGGCTGG - Intronic
995605015 5:113844883-113844905 CTATTTCAGAATAAGCAGGATGG - Intergenic
997346841 5:133198299-133198321 CTGCTCTTGGAGAAGCAGGGTGG + Exonic
997649116 5:135502439-135502461 ATTTTTCTGCAGAAGCAAGGGGG + Intergenic
997888532 5:137654311-137654333 CTGTTTCTCAGGAAGCAGTTCGG + Intronic
998119315 5:139562352-139562374 CAGTTTCTGGACAAGCAGGGTGG - Intronic
999190187 5:149741478-149741500 CTGCTTCTGCAAAGGCAGGGTGG - Intronic
999475192 5:151891794-151891816 CTGTTTGGGGAGGAGCAGGGTGG + Intronic
999811155 5:155128618-155128640 CTGTATCTTAATAAACAGGGAGG - Intergenic
1000620375 5:163478728-163478750 CTTTTCCTGCAAAAGCAGGGTGG - Exonic
1001422770 5:171599948-171599970 CAGTTTCTGCAGCAGCAAGGGGG + Intergenic
1001855815 5:175009730-175009752 ATGTTTCTGAAAGAGCAGGAAGG + Intergenic
1002321250 5:178377407-178377429 CTGATTCTCCAGAAGCAGTGGGG - Intronic
1002962697 6:1931228-1931250 CTTTTGCAGATGAAGCAGGGAGG + Intronic
1003398239 6:5771224-5771246 CTGTGCCTGAAGGAGCAGTGTGG - Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1003916064 6:10787307-10787329 CTATTGCTAAAGAAGCAGTGTGG + Intronic
1004271752 6:14201907-14201929 ATGTTGCTGATGAAGCAGTGGGG + Intergenic
1006728506 6:36217486-36217508 CTTTATCTGAAGAGGCAAGGTGG + Intronic
1006964026 6:37963643-37963665 CTGTTGCTGGTGAAGCAGGATGG - Intronic
1007841569 6:44720415-44720437 CTCTTTCCCAAGAGGCAGGGTGG + Intergenic
1009064649 6:58444629-58444651 CTGTTTTTGTAGAATCAGTGAGG + Intergenic
1010519619 6:76817601-76817623 CTGTGTCTGCAGGGGCAGGGAGG - Intergenic
1011599265 6:89044827-89044849 CCCTCTCAGAAGAAGCAGGGTGG - Intergenic
1013813977 6:114075717-114075739 CAGTATCTGAAGAAGAAAGGAGG - Intronic
1014015960 6:116530218-116530240 CTTTTTCTTAAAAAGGAGGGGGG - Intronic
1014205954 6:118655545-118655567 CAGTGTCTGAAAAAGCAGGCAGG - Intronic
1015608027 6:134980958-134980980 CTGGCTCTCAAGAAGTAGGGTGG + Intronic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1017277590 6:152588152-152588174 CTGTATCTGATGAAGCAGCTGGG - Intronic
1017817568 6:158026819-158026841 CTGTGTCAGAAGAGGCAGGTGGG + Intronic
1018380032 6:163250408-163250430 CTAATTCTGCAGAAGCAGTGTGG - Intronic
1018901640 6:168054578-168054600 ATGTTTCCTAAGAAGGAGGGTGG - Intergenic
1019158926 6:170056815-170056837 CTTTTTCTTAAGAGGCAGGAAGG + Intergenic
1020397816 7:7736979-7737001 CAGCTTCTGGAGAAGCAGTGGGG - Intronic
1021974781 7:26001105-26001127 TTGTTTCTCAAGAAATAGGGAGG + Intergenic
1022446075 7:30471782-30471804 CTGTTTCTAAAGAGCCAGGAAGG + Intronic
1023214654 7:37848805-37848827 CTGTCTGGGAAGAAGAAGGGGGG - Exonic
1023457320 7:40354465-40354487 CTGTATCTCAAGAAGCAGCCAGG - Intronic
1023601426 7:41885248-41885270 CAGCTCCTGGAGAAGCAGGGAGG + Intergenic
1024029248 7:45443278-45443300 CAGTTACTGGAGAAGAAGGGAGG - Intergenic
1024058468 7:45681537-45681559 CTGTTGTGGAAGAAGCAGAGTGG + Intronic
1025158338 7:56630545-56630567 CTGTACCTGAAGCTGCAGGGTGG - Intergenic
1025172417 7:56771613-56771635 CTGATTCTCAAGAAGGAGGAAGG + Intergenic
1025575602 7:62636865-62636887 CTGTTTCTGGAGAATCTGTGAGG - Intergenic
1026590657 7:71692419-71692441 CTGTTTCTGAAGGACAAGGAGGG + Intronic
1031326719 7:120408982-120409004 ATGTTTCTTAAGAAGGAGGGAGG + Intronic
1031982444 7:128136422-128136444 CTGTGTCTGAGCAAGGAGGGTGG - Intergenic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032272451 7:130422562-130422584 CTTTTTCTGAATACACAGGGAGG + Intronic
1032456293 7:132075725-132075747 CTGTCTCTGCAGGAACAGGGAGG + Intergenic
1032878642 7:136065373-136065395 CTGTTACTGAGAAAGAAGGGTGG + Intergenic
1035193585 7:157195166-157195188 CTTTTTCTGAAATAGCTGGGAGG - Intronic
1035694704 8:1586364-1586386 CTGGCTCTGAAGATGCAGGCAGG - Intronic
1036989545 8:13577139-13577161 CTGTTACTGGAGAAACAGTGGGG + Intergenic
1037212446 8:16407482-16407504 CTGTTGTTGAAGCATCAGGGAGG - Intronic
1038173906 8:25163700-25163722 CTGTTACTAAGGAAGGAGGGAGG + Intergenic
1038648953 8:29385156-29385178 CTGTTTCTTAAGAAGATGTGTGG + Intergenic
1039078731 8:33715441-33715463 CTGATTCAGTAGAATCAGGGTGG + Intergenic
1039557120 8:38484607-38484629 CTGGTTCTGAAGAGGTCGGGTGG + Intergenic
1041131166 8:54702579-54702601 CAGTTGCTGATGAATCAGGGTGG + Intergenic
1042482863 8:69323584-69323606 GTGCTGCTGAAGATGCAGGGAGG + Intergenic
1042482868 8:69323631-69323653 GTGCTGCTGAAGATGCAGGGAGG + Intergenic
1042985658 8:74580279-74580301 CTGGCTCTGAAGATGGAGGGGGG - Intergenic
1043276306 8:78399410-78399432 CTGTTTCTGAAGAATCTTTGTGG + Intergenic
1043880654 8:85539045-85539067 CTGTCTCTGGAGCACCAGGGTGG + Intergenic
1047787178 8:128164981-128165003 TTGTTTCTGCAGAGGCAGGCTGG + Intergenic
1049203409 8:141352438-141352460 CTGTGTGTGAAGAGGCAGGGAGG + Intergenic
1049531433 8:143157495-143157517 GTGTGTGTGAAGGAGCAGGGCGG + Intergenic
1050873619 9:10608385-10608407 GTGTTTTTGAAGGAGCAGGATGG - Intronic
1051156829 9:14157403-14157425 CTGTTTCTAAAGAAGGTGGGTGG - Intronic
1053034480 9:34812592-34812614 CTGTCTCTGAGGAAGCAGACTGG + Intergenic
1054338263 9:63828902-63828924 ATGTTTCAGAGGAAGCAGTGGGG + Intergenic
1055422617 9:76160175-76160197 GTGTTTTGGAGGAAGCAGGGAGG - Intronic
1055602656 9:77935850-77935872 CTGTTTCTGAAGAAACTGAAGGG - Intronic
1056857034 9:90140470-90140492 CCCTTGCTCAAGAAGCAGGGCGG - Intergenic
1056988395 9:91386806-91386828 GTGTTTCTGAAGACTCAGGCAGG - Intergenic
1057240266 9:93401583-93401605 TTGTGTCTGAAGGAACAGGGAGG - Intergenic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1057772417 9:97980664-97980686 CTGTTGCTGAGGCAGCGGGGTGG + Intergenic
1057946046 9:99329620-99329642 CTATTTCTCAAGAAGCAGTAGGG + Intergenic
1058204656 9:102088241-102088263 CTGTTTCTGTAGAAGTATGCAGG + Intergenic
1058419210 9:104818757-104818779 CTGTTTCTGAAGAACCAGCTGGG - Exonic
1058419214 9:104818762-104818784 CTGGTTCTTCAGAAACAGGGAGG + Exonic
1061052523 9:128204734-128204756 GAGTTTCTGAAGAAGATGGGGGG - Intronic
1062162836 9:135089151-135089173 CGATTCCTGAAGGAGCAGGGAGG - Intronic
1062530239 9:136996500-136996522 CTGTTTGTCAAGGTGCAGGGCGG - Exonic
1062632328 9:137469384-137469406 CTGTATCTGAAGAGACAGTGTGG + Intronic
1186510056 X:10124116-10124138 ATGTGTCTGAAGGAACAGGGCGG - Intronic
1188047437 X:25442697-25442719 CCTCTGCTGAAGAAGCAGGGAGG + Intergenic
1190196681 X:48325730-48325752 CTGTGTCTCAAGAAATAGGGAGG + Intergenic
1190369395 X:49726834-49726856 CTGTTTCTGAGTTGGCAGGGTGG + Intergenic
1190663409 X:52676101-52676123 CTGTGTCTCAAGAAATAGGGAGG + Intronic
1190676014 X:52782381-52782403 CTGTGTCTCAAGAAATAGGGAGG - Intronic
1191262956 X:58348013-58348035 CTGTTTTTGTAGAATCTGGGAGG + Intergenic
1193352211 X:80476756-80476778 CTGTATCTGCAGTAGCAGTGAGG + Intergenic
1194653222 X:96540830-96540852 TTGTTTTTGAAGAAGCAGTATGG - Intergenic
1195006040 X:100686959-100686981 CTGTTTCTGGGGGAGCAGGGAGG - Intronic
1195889163 X:109672659-109672681 CTATTTCTGGAGAAACAGGAGGG + Intronic
1197250891 X:124215582-124215604 ATGATACTGAAGAAGCAGGCAGG - Intronic
1197734166 X:129838359-129838381 GTGTTTCTGAAGAAGCCGGGGGG - Intronic
1199643821 X:149886117-149886139 CTGATTCTAATGAAGCGGGGTGG + Intergenic
1199955412 X:152737960-152737982 CTGACTCTGATGAAGCTGGGTGG + Intergenic
1200105356 X:153709045-153709067 CTTGTTCTCAAGAAGAAGGGAGG - Intronic
1200254536 X:154572948-154572970 CTGTTTCTGGTGATGCTGGGTGG + Intergenic
1200263233 X:154631460-154631482 CTGTTTCTGGTGATGCTGGGTGG - Intergenic