ID: 1091131315

View in Genome Browser
Species Human (GRCh38)
Location 11:133149410-133149432
Sequence CCTGGGGCCTCTCCTTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091131315 Original CRISPR CCTGGGGCCTCTCCTTTTAC TGG (reversed) Intronic
900690651 1:3978386-3978408 ACTGGGGCTTGTCCTTTTGCTGG + Intergenic
901101426 1:6722052-6722074 CCTCGGGCCTCCCATGTTACTGG + Intergenic
902288103 1:15419517-15419539 CCTGGCCCCTCTCTTTTTCCTGG - Intronic
902584824 1:17432335-17432357 CCAGAGGCCTCTCCTTCCACAGG - Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
911816732 1:102361867-102361889 ACTGATGCCTCTCATTTTACAGG - Intergenic
914490728 1:148148838-148148860 CCTGGCGCCTCTCCTCCTCCTGG - Intronic
915224470 1:154402449-154402471 CCTAGGGCTTCCCCCTTTACAGG + Intergenic
916196116 1:162224909-162224931 CCCGGGGGCCCTGCTTTTACTGG - Intronic
916563017 1:165949501-165949523 CCTGGGGCCCCTCCCTTTGGAGG - Intergenic
917534393 1:175863855-175863877 AATGGGGCCTTTCATTTTACAGG + Intergenic
917970653 1:180204541-180204563 CCTTGGGCTTCACCTTTGACGGG + Intergenic
920100453 1:203513983-203514005 CCTGGGGCCCTTCTTTTTCCAGG - Intergenic
920244253 1:204576122-204576144 CCTGTAGCCTCTCCCTGTACAGG - Intergenic
922854783 1:228765642-228765664 CCTGGGGCCTCTTCACTTTCAGG + Intergenic
924121444 1:240803394-240803416 CCTTTGGCCTCTACATTTACTGG + Intronic
1062910054 10:1206365-1206387 ACTGGGGCGTCTCCTTGAACTGG + Intronic
1063959125 10:11292413-11292435 CCTGTGGCCTTTCCATTGACAGG + Intronic
1068805324 10:61188694-61188716 TCTGGGGCCTTGCCTTTTCCTGG - Intergenic
1071329003 10:84542293-84542315 CCTGGCCCCTCACCTTGTACTGG - Intergenic
1073300270 10:102466949-102466971 CATGGGGCCTCTCCATTTTAGGG + Intronic
1075234082 10:120710819-120710841 CCTGTGGGCCCTGCTTTTACAGG + Intergenic
1076191789 10:128488309-128488331 CCTGGTGTCTCTTCTTTTAAGGG + Intergenic
1076866345 10:133168157-133168179 CCTGGGGCCGCTCCCTCTCCAGG + Intronic
1077228030 11:1446871-1446893 CCAGGGCCCCCTCCTTGTACTGG + Intronic
1078085638 11:8231697-8231719 CCTGGAGTCTGTCCTTCTACTGG + Intronic
1078151974 11:8767082-8767104 CCTGGAGCCTCTCCTTACTCTGG - Intronic
1079093376 11:17495739-17495761 CATGGGGCTTCTCCTTTCACTGG + Intronic
1084802730 11:71555460-71555482 CCTGGTGCCCCTCCCTTTACAGG - Intronic
1084860342 11:72013974-72013996 CCTGGGCCTTCTCCTCTAACTGG + Exonic
1084939317 11:72603907-72603929 CCTGAGGCCCCTCCTTGTGCTGG - Intronic
1085416546 11:76322207-76322229 GCTGGGGGCTCTTCTTTTCCAGG - Intergenic
1089945726 11:122471255-122471277 CCTGGGGTCTGTCCCCTTACAGG - Intergenic
1090405040 11:126471454-126471476 CCTGGGGCCTCCCCTTCCTCTGG - Intronic
1091131315 11:133149410-133149432 CCTGGGGCCTCTCCTTTTACTGG - Intronic
1091621386 12:2091942-2091964 CCTGTGACCTCACCTTTTAAAGG + Intronic
1094147494 12:27245078-27245100 CCAGTGGCCTCCCCTTTTACTGG + Intronic
1096112689 12:49038666-49038688 CCTGGGGGCACTCCGTTTCCTGG - Exonic
1096580705 12:52582950-52582972 TCTCTGGCCTCTCCTCTTACAGG - Intergenic
1102229163 12:111250407-111250429 CCTGGGTCCTCTTGTTTTAGAGG - Intronic
1102624448 12:114223725-114223747 CCTGAAGCATCTCCTTTTCCTGG - Intergenic
1108640933 13:52381634-52381656 CTTGTGGCCTCACCTTTTATAGG - Intronic
1111997721 13:95181308-95181330 TCTGGGGCCTCTTCTTGTGCTGG - Intronic
1117827623 14:59719952-59719974 CCTGGGAGCTCTCCCTCTACAGG + Intronic
1121667730 14:95685879-95685901 CCTGTGGCCATTCCTTTAACAGG - Intergenic
1122960698 14:105092575-105092597 CCTTGGGCCCCTCCTTTATCTGG - Intergenic
1202897585 14_GL000194v1_random:19186-19208 CCTGGGGCCTTGAGTTTTACTGG - Intergenic
1123740016 15:23226692-23226714 CCTGGCGCCTCTCCTTCTCTTGG + Intergenic
1124291240 15:28455660-28455682 CCTGGCGCCTCTCCTTCTCCTGG + Intergenic
1124338866 15:28876965-28876987 CCTGAGCCCTCTCCTTTTCCCGG + Intergenic
1124454332 15:29826915-29826937 ACTGGGGCCTCTGCTCTCACAGG + Intronic
1124474839 15:30024167-30024189 CCTGGGGCATCTCATGTTCCAGG + Intergenic
1127379602 15:58419518-58419540 CCTGGGGCCTCTGCTTTACATGG + Intronic
1129219988 15:74126772-74126794 CCTCCGGCCTTTCCTTGTACAGG - Exonic
1129718864 15:77866848-77866870 CTTGGGGACTCTCCTATCACAGG - Intergenic
1129756278 15:78101135-78101157 CCTGGGGCCTGTCCTTTCTGGGG + Exonic
1132261738 15:100431603-100431625 CATGGTGCCACTCCATTTACTGG - Intronic
1132364472 15:101247171-101247193 TCTTGGGGCTCTTCTTTTACTGG + Intronic
1132603012 16:782265-782287 CCTGGGGCCTTTCTTATTGCAGG + Intronic
1132648666 16:1010590-1010612 CCTGGGCCCTCCACTTTCACGGG - Intergenic
1138056720 16:53842298-53842320 ACTGGAGCTTCTCCTTTTAGTGG - Intronic
1140218673 16:73028114-73028136 CCTGCGGCTTCTCCTTTTTTTGG + Intronic
1150588217 17:66537788-66537810 CATGGTGCCTTTTCTTTTACTGG + Intronic
1152911505 17:83007782-83007804 CCTCGGGCCTCTAGTTTCACAGG - Intronic
1153360015 18:4183901-4183923 CCTCGGGTCTGTCTTTTTACTGG - Intronic
1155777575 18:29786755-29786777 ACTGTGGTCTCTCCTTTTTCTGG - Intergenic
1156602541 18:38626275-38626297 CCCGTGGCCTCTCCCTATACAGG + Intergenic
1158754570 18:60306541-60306563 CCTGGTTCCTTTCCTTTCACTGG - Intergenic
1160442223 18:78901641-78901663 CCTGGGGTCTGTCCTTTCTCTGG + Intergenic
1160526311 18:79540427-79540449 CCTGGGGCCTCTCCCTGCACTGG + Intergenic
1160994891 19:1877988-1878010 CCTGGCGCCTCTCCTCCTCCTGG + Intronic
1162766669 19:12924150-12924172 CCTGGGGCCTCTCCCTGGAGCGG - Exonic
1163235256 19:16025968-16025990 CCTGGTGCCCCTCCCTTCACAGG - Intergenic
1164507144 19:28869933-28869955 CCTGGGGACCCACCCTTTACTGG + Intergenic
1165113054 19:33513235-33513257 CCTGGGGCCTCTTCCCTAACTGG + Intronic
1165606889 19:37113458-37113480 ACTGGGACCTTTCCTTTTAATGG + Intronic
1166958301 19:46480765-46480787 CATGGGGCCTCTCGGTTTCCTGG - Intergenic
1167591661 19:50407406-50407428 CCTGGGGCCTCACCCTTTGAGGG - Exonic
1167960114 19:53098556-53098578 TCTGGGGCCTCTCTTTTTCTTGG - Intronic
1167963902 19:53128364-53128386 TCTGGGGCCTCTCTTTTTCTTGG - Intronic
926123676 2:10258280-10258302 CCTGGGGACTCCCCTCCTACAGG + Intergenic
927194606 2:20538890-20538912 CCTGGGGCCCCTCCCCTTCCCGG + Intergenic
928206500 2:29288309-29288331 CCTGGGGCCTCGTCTTGTCCTGG + Intronic
930124169 2:47783345-47783367 CCCGGGGCCTCTCCTTCCCCAGG + Exonic
931203878 2:60128094-60128116 CCTGGGGTATCTCTTTTTAAGGG - Intergenic
932412797 2:71557283-71557305 CCTGGGGCATCCCCTTCTCCAGG - Intronic
932689474 2:73900176-73900198 CCTGGCGCCTCTCTTTTCTCTGG + Intronic
933159867 2:79011717-79011739 CCTGGGGCCATTACTTTTGCGGG - Intergenic
934763304 2:96867981-96868003 CCTGTGGCCTCTCCTGCTGCGGG - Intronic
935726010 2:106024585-106024607 CCTGGGGCCCCTGATTTCACAGG - Intergenic
937161020 2:119760576-119760598 CCTGGGACCTCTGCTTTTGCGGG + Intronic
938490708 2:131759527-131759549 CCTGGGGCCTTGAGTTTTACTGG + Intronic
946096288 2:217277258-217277280 CCTGGGGCCTCTTTTATTAAGGG + Intergenic
946114516 2:217449707-217449729 CCTGGGGCCTCTCCACTCTCTGG + Intronic
946900869 2:224370038-224370060 CCTGGTGCCTCTTCTATTAAAGG - Intergenic
948603568 2:239120918-239120940 CCTGGGCCGTCTCCTTTAAAAGG - Intronic
1171341990 20:24437078-24437100 CCTGGCCTCTCTCCATTTACTGG + Intergenic
1172392487 20:34575316-34575338 CCTTGGGCCTCTCCATTCAGGGG - Intronic
1173292998 20:41730710-41730732 CCTGGGGCTGCTGCTTTCACAGG - Intergenic
1173926906 20:46787551-46787573 CCAAGAGCCTCTCCTTTTACAGG + Intergenic
1174725720 20:52859670-52859692 CCTGAGGCCCCTCCTCTTCCAGG + Intergenic
1176617269 21:9035175-9035197 CCTGGGGCCTTGAGTTTTACTGG - Intergenic
1176993202 21:15522554-15522576 CCTTGGGCCTCTTTTTTTAAGGG + Intergenic
1178704977 21:34865614-34865636 CCTGGGGCCTCCCCGCTGACTGG - Intronic
1178966737 21:37127153-37127175 CCTGGGGTCTCTTCTTATAAGGG + Intronic
1180887557 22:19257867-19257889 CCTGGGGTCTCTTCTTCTCCAGG - Intronic
1182568560 22:31218402-31218424 CCAAGGGCCTCTCCTTTTTCAGG - Intronic
1183459821 22:37943019-37943041 ATTGGGGCCTCACCATTTACAGG + Intergenic
1184516668 22:44966472-44966494 GCTGGGGCCTGTCTTTTCACAGG - Intronic
1185331180 22:50252680-50252702 CTTGGCCCCTCCCCTTTTACGGG - Intronic
952217679 3:31294099-31294121 CCTGGAGCCTGTTCTTTTGCAGG + Intergenic
956841345 3:73142921-73142943 CCTGAGGTCTCTCCTTCAACTGG + Intergenic
956874872 3:73452518-73452540 GCTGGGACCTCTACTTTCACAGG + Intronic
957530955 3:81440434-81440456 CCTGGTGTCTCTCCTTATAAGGG + Intergenic
957728870 3:84106169-84106191 CATGAGGCCTCTACTTTTCCTGG - Intergenic
958951719 3:100424240-100424262 CCTGGGGAATCTCCTAATACTGG - Intronic
961672020 3:128540105-128540127 CCTTTGCCCTCTCCATTTACTGG - Intergenic
964410973 3:156397701-156397723 CCAGGGACCCATCCTTTTACAGG + Intronic
966060598 3:175749605-175749627 CTTGGGGGCTCTGCTTTTATGGG - Intronic
967929169 3:194678182-194678204 CTTGGAGCCTCTCCTTTCATGGG - Intergenic
968733066 4:2280777-2280799 CCATGGGCTTCTCCTTTCACAGG - Intronic
969406927 4:6999639-6999661 CCTGGGGCCTCGCATGTTCCAGG + Intronic
969599510 4:8167548-8167570 CCTGGGACTTCCTCTTTTACAGG + Intergenic
977466779 4:97392245-97392267 ACTGGAGCCTCTGCTTGTACAGG - Intronic
980111350 4:128640304-128640326 CCTGGGTCTTCTGCTTTTCCAGG + Intergenic
981107201 4:140894584-140894606 CCTGGGTCCCCTCCTTTGATTGG + Intronic
981466439 4:145077561-145077583 CCTGAGGTTTCTTCTTTTACTGG - Intronic
982083522 4:151812835-151812857 CCTGGGGCAGCTCTTTGTACAGG + Intergenic
986132125 5:4941859-4941881 CCTGAGGCCTCTGCCTTTGCAGG - Intergenic
986612433 5:9582846-9582868 TCTTGGGACTCTGCTTTTACAGG - Intergenic
987564117 5:19563053-19563075 CCTGGGGCCTTCCCTTTTATGGG - Intronic
988412761 5:30908441-30908463 TCTGCTGCCTCTCCTTTCACAGG - Intergenic
988468123 5:31510683-31510705 CCTTGGCCCTCTCCTTTGCCAGG - Intronic
989314927 5:40066994-40067016 CCTGGGGTCCCTTCTTCTACAGG - Intergenic
989732405 5:44664454-44664476 CCCTGGGCCTCTCCTGTTCCCGG + Intergenic
990417227 5:55598029-55598051 CCTGGGTCCTGACTTTTTACTGG + Intergenic
990911159 5:60853787-60853809 CCTGGCTCTTCTCCTTTTTCTGG + Intergenic
997350770 5:133230031-133230053 TATGGTGCCTGTCCTTTTACTGG + Intronic
1000307805 5:160011659-160011681 CCTGGGGCCACACCCTTAACTGG + Intronic
1001370043 5:171190660-171190682 CCTGGAGGGTCTCCATTTACTGG - Intronic
1002898392 6:1392055-1392077 CTTGGGGCCTTGCCTTTGACTGG - Intronic
1005729715 6:28685106-28685128 GCTGGGACCTTTCCTTTTAATGG - Intergenic
1006025374 6:31143357-31143379 CCTGGCTCCGCTCCTTTTCCTGG + Exonic
1006170357 6:32088543-32088565 CCTGGGGCCATTCCTTTCATAGG + Intronic
1006752649 6:36388123-36388145 CATGGTGCCTCTCCCTTTAGGGG + Intergenic
1009900200 6:69800361-69800383 CCTGGGGCCTCCGTTTTTTCTGG + Intergenic
1010948989 6:82012811-82012833 CCTGAGGCCTCTTCTCTTAGTGG - Intergenic
1018689949 6:166336868-166336890 CCTGGGGCCTCTTTTTTAATAGG + Intronic
1018911390 6:168102301-168102323 CCTGGGGCCTCTGCACTTGCTGG - Intergenic
1019681938 7:2355225-2355247 CCTGGGGCCTCGCCCTGTGCCGG - Exonic
1021689018 7:23214316-23214338 CAGGGGGCCTCTCCTGTTCCTGG + Intergenic
1021986029 7:26099385-26099407 CCTGGGACTTCTGCTTTTGCTGG - Intergenic
1025058646 7:55785512-55785534 CCTGTGGCCTCTCCTTCTCCAGG - Intergenic
1025220480 7:57103427-57103449 CCTGTGGCCTCTCCTTCTCCAGG - Intergenic
1025631297 7:63275248-63275270 CCTGTGGCCTCTCCTTCTCCAGG - Intergenic
1028047707 7:86143607-86143629 CCTGGAGCATCAGCTTTTACTGG - Intergenic
1030864166 7:114678345-114678367 CCTGGGCAATCTCATTTTACAGG - Intronic
1031232300 7:119123605-119123627 CCTGGAGACTCTCCTCTGACGGG - Intergenic
1032061581 7:128729605-128729627 TATTGGGTCTCTCCTTTTACTGG + Intronic
1032505771 7:132433676-132433698 TTTGGGGCCTCTCCTTCTAAGGG - Intronic
1032786530 7:135205130-135205152 GCTGGGGCTTCTGCTTTAACTGG + Intronic
1033011500 7:137627221-137627243 ACTGTGACCTCTCCTTGTACAGG + Intronic
1036574992 8:10019113-10019135 CCTGGGGTCTCTTCTTATAAGGG + Intergenic
1036799109 8:11776704-11776726 CCTGGGGCCTCCCCATCTCCAGG + Intronic
1038749723 8:30284302-30284324 CTAGGGGCCTCTCCTTTTCCTGG + Intergenic
1045258776 8:100552801-100552823 CCTTGGGCTTTTCCTATTACGGG + Intronic
1046141960 8:110105662-110105684 ACTGGAGCCACTCCTATTACTGG - Intergenic
1046288858 8:112132684-112132706 GCTGGCGCCTCTCCCTTCACAGG - Intergenic
1046585409 8:116144712-116144734 CCTGGTGCCTCTCCCTTTCTCGG - Intergenic
1047827726 8:128595642-128595664 CCAGGGGCTTCTCATTTTACAGG - Intergenic
1048270783 8:133026475-133026497 CCTGGGGTCTGTCCTGCTACAGG - Intronic
1048715691 8:137266096-137266118 CTCCGGGCCTCTCTTTTTACTGG + Intergenic
1049331324 8:142055574-142055596 TCTGGGGCCTCTCCTTAGATGGG - Intergenic
1049664465 8:143836843-143836865 GCTGGGCACTCTCCTTTTCCGGG - Intronic
1054735074 9:68742805-68742827 CCTGGGGCACCTCTTTCTACAGG - Intronic
1056544713 9:87604072-87604094 CCTGGTTTCTTTCCTTTTACTGG + Intronic
1057739514 9:97699265-97699287 CCTGGGGTCCCTTCTTCTACAGG - Intergenic
1059392033 9:114005461-114005483 CCTGGGGGCTCACGTTTTATTGG + Intronic
1059441026 9:114306941-114306963 CCTGGGGCCCATCCTGTCACAGG + Intronic
1061216357 9:129224166-129224188 GCTGGGGCCTCTCTTTGTTCAGG + Intergenic
1061601884 9:131675646-131675668 CCTGGGGGCTTTCCTGGTACAGG - Intronic
1061849881 9:133408086-133408108 CCCTGGCCCTCTCCTTTTATTGG - Intronic
1187869002 X:23749047-23749069 CCTGGCCCCTCTCCTTTCTCAGG - Intronic
1188048594 X:25456832-25456854 CCTGGGGACTCTACTTTTACTGG - Intergenic
1189114254 X:38327240-38327262 CCTGGGGCCTGTCCCCCTACAGG + Intronic
1190028186 X:46945826-46945848 CTTGGGGCCCCTTCTTTAACAGG + Intronic
1190731608 X:53230168-53230190 TCTGGAGCCGCTCCTTTTAGTGG - Intergenic
1191055099 X:56232846-56232868 CCCCGGCCCTCTCCTTTTAAAGG + Intronic
1191960660 X:66697987-66698009 CCTGGGACCTCACCTGTCACTGG + Intergenic
1192145498 X:68679696-68679718 CATGGGGCCTCTCATTGCACAGG + Intronic
1192362951 X:70450617-70450639 CCTGAGGCCTCTCCTCTTCTAGG + Exonic
1192498453 X:71632454-71632476 CATGGGGGCTCTCCTTCTTCCGG + Intergenic
1192680831 X:73252397-73252419 CTTGAGCCCTCTCCTTTTACAGG + Intergenic
1193719803 X:84973769-84973791 CCTGGGGACTCTGCATTTTCTGG - Intergenic
1194340244 X:92698077-92698099 CCTGGTTCCTCTCCTTTTTGGGG + Intergenic
1197767659 X:130069601-130069623 CCTTGGGCATCTCCTTAAACTGG + Exonic
1200648614 Y:5814829-5814851 CCTGGTTCCTCTCCTTTTTGGGG + Intergenic
1201150663 Y:11094011-11094033 CCTGGGGCCTTGAGTTTTACTGG - Intergenic
1202385632 Y:24323674-24323696 CTTGGAGCTTCTGCTTTTACTGG + Intergenic
1202485154 Y:25346454-25346476 CTTGGAGCTTCTGCTTTTACTGG - Intergenic