ID: 1091133926

View in Genome Browser
Species Human (GRCh38)
Location 11:133170853-133170875
Sequence CTGGCTAATTGTGCTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091133926_1091133931 -1 Left 1091133926 11:133170853-133170875 CCCCCAAAAGCACAATTAGCCAG 0: 1
1: 0
2: 3
3: 17
4: 192
Right 1091133931 11:133170875-133170897 GCTCCTCATGAGCAAAGAAGTGG 0: 1
1: 0
2: 1
3: 14
4: 179
1091133926_1091133934 18 Left 1091133926 11:133170853-133170875 CCCCCAAAAGCACAATTAGCCAG 0: 1
1: 0
2: 3
3: 17
4: 192
Right 1091133934 11:133170894-133170916 GTGGTCAGTAAGGAGAAATTTGG 0: 1
1: 0
2: 2
3: 12
4: 208
1091133926_1091133933 8 Left 1091133926 11:133170853-133170875 CCCCCAAAAGCACAATTAGCCAG 0: 1
1: 0
2: 3
3: 17
4: 192
Right 1091133933 11:133170884-133170906 GAGCAAAGAAGTGGTCAGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091133926 Original CRISPR CTGGCTAATTGTGCTTTTGG GGG (reversed) Intronic
901413369 1:9100542-9100564 CTGCCTCTTTGTGCTTTTGAGGG - Exonic
903645782 1:24895666-24895688 CTGGCTAATTTTTTTTTTAGAGG - Intergenic
905903743 1:41601222-41601244 TTGGCTATTTGTGTTTTTTGTGG + Intronic
908129782 1:61063769-61063791 CTGGCTAATTGTATTTTTAGTGG + Intronic
908971559 1:69840890-69840912 CTTCCTAATTGTGTTTTTTGAGG + Intronic
909188602 1:72522537-72522559 CTGGCTAATTGTATTTTTTTTGG + Intergenic
909484780 1:76160471-76160493 CTGGCTTCTTGTGGTTTTGGGGG + Intronic
909840578 1:80316879-80316901 CTTCCCAATTATGCTTTTGGGGG - Intergenic
910191422 1:84599845-84599867 CTGGCTAATTTTTCTTTTTTGGG - Intergenic
913070975 1:115298314-115298336 CTGACTAAGAGTTCTTTTGGGGG - Intronic
915840035 1:159205995-159206017 CTGGCCAGTGGTGCTTCTGGTGG + Exonic
915978638 1:160406888-160406910 CTGGCTAATTTTGCATTTTTTGG + Intronic
917869008 1:179225696-179225718 CTGGCTAATTCTGTGTTTTGGGG - Intronic
918232431 1:182548503-182548525 CTTTCTAATTGTCCTTGTGGGGG - Intronic
918977258 1:191505778-191505800 CTGGTTACTTGTACTTTTGAAGG + Intergenic
919273523 1:195382795-195382817 CTGGCTAATTTTTCTTTTTTTGG - Intergenic
919696788 1:200584958-200584980 CTGGCTTATTTCACTTTTGGTGG - Intronic
919950208 1:202356017-202356039 CTGGCTAATTTTTTTTTGGGTGG - Intronic
921637351 1:217512158-217512180 CTGGCTAATTTTTCTTTTTTTGG - Intronic
922673834 1:227538103-227538125 GTGGCTATCTGGGCTTTTGGAGG + Intergenic
923918524 1:238536739-238536761 CTGGATATATGTGCATTTGGGGG + Intergenic
1065613022 10:27491211-27491233 CTGGCTTATTGTTGGTTTGGTGG + Intergenic
1068077723 10:52277978-52278000 CTGTCTAATTGTGATTTGAGTGG - Intronic
1070652789 10:78250024-78250046 CTGGATAATTCTGTTTTTAGAGG - Intergenic
1071416806 10:85449191-85449213 CTGACTAATTGTGCTCCTGCTGG + Intergenic
1072037336 10:91575404-91575426 GGGGCCAATTGTGCTGTTGGTGG + Intergenic
1073417978 10:103400416-103400438 CTGGCTCTTTTTTCTTTTGGTGG - Exonic
1074387518 10:113028383-113028405 CTGGTTAATTTTGCTTGGGGAGG - Intronic
1074995840 10:118756132-118756154 CAGGCTAATTTTGTTTTTAGAGG - Intergenic
1075292423 10:121241828-121241850 CTGGCAAATTCTCTTTTTGGGGG - Intergenic
1075293050 10:121246911-121246933 TTTTCTCATTGTGCTTTTGGGGG + Intergenic
1075296964 10:121285989-121286011 AGAGCTAATCGTGCTTTTGGAGG + Intergenic
1075887365 10:125912797-125912819 CCAGCTAATTGTGTTTTTAGTGG + Intronic
1077239472 11:1503027-1503049 CCGCCTCACTGTGCTTTTGGTGG - Intergenic
1078696595 11:13638803-13638825 TTGGTTACTTGTGCTTTTGGTGG + Intergenic
1078733831 11:14001467-14001489 CTGGCTAATTGTTCTTTCTTCGG - Intronic
1080288718 11:30645961-30645983 ATGGCTCATGGTGCATTTGGGGG - Intergenic
1081194851 11:40149140-40149162 TTGGCTACTTGGGCTTTTTGTGG + Intronic
1082599235 11:55128632-55128654 CTGGCTGATTGTTCCTCTGGAGG - Intergenic
1084756271 11:71240757-71240779 CTGGCTAATTGTTTTTTTAGAGG - Intronic
1087649268 11:100845880-100845902 CAGCCTAATTGAGTTTTTGGCGG + Intronic
1088258103 11:107919898-107919920 CTGGCTAATTTTGTATTTTGGGG + Intronic
1088410615 11:109530243-109530265 ATGGATAATTTTGATTTTGGGGG + Intergenic
1088563640 11:111143929-111143951 TTGGCAAATTGTGCTTTCAGTGG + Intergenic
1088871476 11:113893914-113893936 CTGGCCTATTGTTATTTTGGGGG + Intergenic
1091133926 11:133170853-133170875 CTGGCTAATTGTGCTTTTGGGGG - Intronic
1092156568 12:6285785-6285807 CTGGCTAATTTTATTTTTTGTGG + Intergenic
1092437021 12:8457174-8457196 CTAGCTAATTGTATTTTTGTAGG + Intronic
1092549218 12:9479453-9479475 CTGGCTAATTTTGCATTTTTTGG - Intergenic
1093090647 12:14916406-14916428 TTGGCAAAATGGGCTTTTGGTGG + Intronic
1096763431 12:53862676-53862698 CTGGCTAATTGTTTTTTTGGCGG + Intergenic
1097569718 12:61317520-61317542 CTGTCTGATTGTTCCTTTGGAGG - Intergenic
1098417752 12:70255021-70255043 CTGGCTTATTGGACTTTGGGAGG + Intronic
1099085542 12:78242130-78242152 CTGGGTATATGTGCTTTGGGCGG + Intergenic
1101595332 12:106159607-106159629 CTGGCTAATTTTTTTTTTAGAGG - Intergenic
1101868991 12:108546682-108546704 CCGGCTAATTGTATTTTTAGTGG + Intronic
1103823891 12:123720530-123720552 CTGGCTAATTTTATTTTTTGTGG - Intronic
1104395005 12:128425135-128425157 CTGGCTAATGGAGATTATGGTGG - Intronic
1106083674 13:26521591-26521613 CTGGCTAATTGTATTTTTAGTGG - Intergenic
1106313406 13:28573570-28573592 CTTGCTAATATTGCTTTGGGGGG + Intergenic
1108260628 13:48651999-48652021 CTGGCCAATTGGGCTTTTATTGG + Intergenic
1108605054 13:52029374-52029396 CTGGCTGCTTGTTCTTATGGAGG - Exonic
1110009829 13:70318033-70318055 TTGGCTCCTTGTGCATTTGGGGG + Intergenic
1110709860 13:78638751-78638773 ATGGCTATTTATGCTTTTGAAGG + Intronic
1113121521 13:106928605-106928627 CTGGATATTTGTGCCTTTAGTGG + Intergenic
1115198176 14:30824678-30824700 CTGGTTGATTGTGATTTCGGTGG - Intergenic
1115482121 14:33870823-33870845 ATGGCTAATAGTACTTATGGAGG + Intergenic
1116614452 14:47116430-47116452 TTGGCTATTTGTGGTTTTTGTGG - Intronic
1117286130 14:54287442-54287464 GTTACTAATGGTGCTTTTGGAGG - Intergenic
1119344074 14:73907431-73907453 CTGGCTAACTGTATTTTTAGTGG - Intronic
1123003284 14:105308182-105308204 CGGCCTAATTGTTTTTTTGGGGG - Exonic
1202870758 14_GL000225v1_random:161207-161229 CCAGCTAATTGTGTTTTTAGTGG - Intergenic
1123433188 15:20235577-20235599 CTGGCTAATTTTTGTTTTAGTGG - Intergenic
1124456897 15:29851393-29851415 TTGGCTATTTGTGGTTTTTGAGG - Intronic
1124866199 15:33493784-33493806 CCAGCTAATTATTCTTTTGGTGG - Intronic
1125684209 15:41553839-41553861 CTTCCTAAATCTGCTTTTGGAGG + Intergenic
1132510388 16:338035-338057 CTGCCTACTTGTGCGTGTGGAGG - Intronic
1132701507 16:1224162-1224184 CTGGATAATTGTGCTGGTGATGG + Intronic
1133289431 16:4709242-4709264 CTGGCTAATTTTGCATTTTTGGG - Intronic
1133538851 16:6728559-6728581 TTGAGTAATTGTGCTTTTTGTGG - Intronic
1135036203 16:19079174-19079196 CTGGCTGATTTTGCTTGTGAAGG - Exonic
1135484126 16:22849023-22849045 CTGACTCACTGTGCTTTGGGTGG + Intronic
1138662197 16:58527949-58527971 CTGGCTAATTATGTGTTTAGTGG - Intronic
1140155904 16:72426413-72426435 GGGGCTAATTTTTCTTTTGGTGG + Intergenic
1140823772 16:78686598-78686620 CCAGCTATTTGTGTTTTTGGAGG + Intronic
1147858159 17:43498830-43498852 ATGGCTAATTCTTCTTTTGGGGG + Intronic
1148732803 17:49847894-49847916 CTGGGTAATTGTGGCCTTGGAGG - Exonic
1148886407 17:50776367-50776389 CTGGCTAATTTTTTTTTTTGAGG + Intergenic
1149752404 17:59158419-59158441 CTGACTGATTGTGGTTTTGTTGG + Intronic
1149826605 17:59834424-59834446 CTGGCTACTTTTGTTTTTTGGGG + Intronic
1150175479 17:63050205-63050227 CTGGCTAATTTTTATTTTGGAGG - Intronic
1150930117 17:69575685-69575707 CTGGCCATTTGTGCTTTCTGGGG + Intergenic
1151722361 17:75864700-75864722 CTGGCTTTCTGTGGTTTTGGAGG - Intergenic
1152915853 17:83035339-83035361 CTGGCGAATTTTGTATTTGGGGG + Intronic
1154194611 18:12256241-12256263 TTTGCTAATTGTGCTCTTGCTGG + Intronic
1155831385 18:30519087-30519109 ATGGCTAATTTTCCTTTGGGAGG + Intergenic
1157683879 18:49627692-49627714 CTGACTAATTTTGATTTTTGTGG + Intergenic
1157872930 18:51247051-51247073 GTTGCTAATTGTCCTTGTGGTGG + Intergenic
1158715880 18:59879337-59879359 CTGATTAATTGGGCATTTGGGGG - Intergenic
1160350735 18:78176175-78176197 CTGCCTGACTGTGATTTTGGAGG - Intergenic
1161829544 19:6592364-6592386 CCGGCTAATTTTTTTTTTGGGGG + Intronic
1162735064 19:12742391-12742413 CCGGCTAATTTTTGTTTTGGGGG + Intronic
1164657108 19:29930303-29930325 TTTGCTACCTGTGCTTTTGGTGG + Intronic
1168275553 19:55276164-55276186 CTGGCTGATTGTGCTAAAGGCGG - Intronic
925739315 2:6992005-6992027 CTGGGTAAGTGTGGCTTTGGAGG - Intronic
926269592 2:11355180-11355202 CTGGCTAATTGTGTTTTTAGTGG - Intergenic
927044633 2:19264459-19264481 CAGGCTAAATGTGCTTTGGGAGG + Intergenic
927111198 2:19864840-19864862 CTGGATAATTGTGCTGGTGGTGG - Intergenic
927803115 2:26119681-26119703 CTGGCTAATTTTTATTTTTGTGG + Intronic
933635925 2:84708864-84708886 GGGGCCAATTGTGCTTTTTGGGG + Intronic
933756632 2:85644591-85644613 CTGGCTAATTTTTTTTTTGTAGG + Intronic
936381909 2:111993889-111993911 CTGGCGTATTGTGCTGTGGGTGG + Intronic
936963284 2:118099637-118099659 CAGGCTACTTGTGATTTTTGAGG - Intronic
937335635 2:121060566-121060588 CTGGCTAATTTGGCTTTGTGGGG + Intergenic
941703176 2:168627548-168627570 CTGGGTATTTGTTCTTTTGATGG + Intronic
941779190 2:169426525-169426547 CTGGCCAATTCTGCATTTGCTGG - Intergenic
943985008 2:194607062-194607084 ATGGCTAATAGTGGTTTTGGAGG + Intergenic
944949348 2:204729388-204729410 GAGGCCAATTGTGCTTTTGTAGG + Intronic
946924364 2:224612050-224612072 CTGGATAATTCTGTTGTTGGGGG + Intergenic
1168864054 20:1069489-1069511 CAGGGTAATATTGCTTTTGGAGG - Intergenic
1169380627 20:5103900-5103922 TTGGTTGCTTGTGCTTTTGGGGG - Intronic
1169395201 20:5222945-5222967 CTTGCTCATTGTGGTTATGGTGG + Intergenic
1170849469 20:19991423-19991445 CAGGATAATTCTTCTTTTGGGGG + Intronic
1171898803 20:30836915-30836937 ATGGCTATTTCTGCTTTTGTTGG - Intergenic
1172712501 20:36936820-36936842 CTGGCTAATTTTTCTTTTTTTGG + Intronic
1173196971 20:40922925-40922947 TTGGCTTATTTGGCTTTTGGGGG - Intergenic
1177619600 21:23570284-23570306 CTGGTAAAATTTGCTTTTGGAGG + Intergenic
1178822233 21:35985766-35985788 CCGGCTAATTTTGTTTTTAGTGG - Intronic
1179772808 21:43635969-43635991 GTGGCTAATTGTACCTTGGGAGG + Intronic
1181564193 22:23724266-23724288 CTGGCTAATTTTTGTTTTTGTGG - Intergenic
1183884836 22:40870865-40870887 CCGGCTAATTTTTTTTTTGGGGG - Intronic
951502746 3:23407961-23407983 ATGTGTAATTGTGCTTCTGGTGG + Intronic
952169514 3:30791558-30791580 CTGGCTAAATGTGCTCCTAGAGG + Intronic
953839258 3:46375616-46375638 CTGGTAAATTGTACTTTTGTGGG - Exonic
954065367 3:48101658-48101680 CTGGCTAATTTTTCTTTTTTTGG - Intergenic
955838774 3:63089011-63089033 CTTGATAATTGTACTTTAGGTGG + Intergenic
956684757 3:71815623-71815645 CTGACCAATTGTGGTTTTTGAGG - Intergenic
959385287 3:105697653-105697675 GTGGCTTGTTGTACTTTTGGTGG - Intronic
963135340 3:141898216-141898238 TTGGTTGCTTGTGCTTTTGGTGG - Intronic
964909083 3:161756041-161756063 CTGGCAAGTTGTGCTTTTTGTGG + Intergenic
965542413 3:169883044-169883066 CTGCCTAATTGTTCTTGGGGTGG + Intergenic
965681003 3:171251337-171251359 CTGGCTACTTGTGTTGTTAGAGG + Intronic
965711898 3:171563755-171563777 TTGCCTAATTGTGCTTGTGAAGG - Intergenic
965927037 3:173994267-173994289 CTGGCTAATTTTGTATTTTGGGG + Intronic
966792913 3:183689997-183690019 CTGGCTAATTGTGTGTTTTTTGG - Intergenic
971415596 4:26425456-26425478 CTGGCTAATTTTTTTTTTGGGGG - Intronic
972458861 4:39280491-39280513 CTGGCTAATTATTTTTTTGTAGG - Intronic
974149547 4:57989315-57989337 CTGTCTAATTGTTGTTTTGTGGG - Intergenic
974362769 4:60903546-60903568 CTGGCTAATTTTTTTGTTGGGGG + Intergenic
974630720 4:64484237-64484259 CCGGCTAATTGTATTTTTAGTGG - Intergenic
976546965 4:86347109-86347131 CTTTCTATTTGTACTTTTGGAGG - Intronic
981501136 4:145453145-145453167 CTCCCTAATAGTGTTTTTGGTGG - Intergenic
981523664 4:145690949-145690971 CTGGCTAATTCTTTTTTTGTGGG - Intronic
982234216 4:153237122-153237144 CTTGCTAATTTAACTTTTGGGGG + Intronic
982525526 4:156473109-156473131 CTGGCTAATTGTGCTATCTTTGG + Intergenic
986586955 5:9328612-9328634 CCGGCTAATTGTATTTTTAGTGG - Intronic
991200965 5:63991999-63992021 CAGGCTAATAGTTCTTTTGCGGG + Intergenic
993121658 5:83782224-83782246 CCTGCTAATGGTGATTTTGGGGG + Intergenic
995380959 5:111532684-111532706 CTGGCTAACTGTTCTGTTGGTGG + Intergenic
998651714 5:144127936-144127958 CTGACAGATTGTGCTTTTAGAGG - Intergenic
998720345 5:144939321-144939343 TTGGCTATTTGTGCTTTTTTGGG - Intergenic
999413638 5:151375530-151375552 TTGGCTATTTGGGCTTTTGGGGG + Intergenic
1005237366 6:23780066-23780088 CTGGCTTTCTCTGCTTTTGGTGG - Intergenic
1006385118 6:33726522-33726544 CTGTCTAGCTGTTCTTTTGGAGG + Intronic
1007047239 6:38789011-38789033 CTGGCTAGCTGTGACTTTGGAGG + Intronic
1011312595 6:85996741-85996763 CTGGATAATTCTTGTTTTGGGGG + Intergenic
1012811995 6:103970732-103970754 CTGGCTATTTGGGCTTTTTTTGG - Intergenic
1013113573 6:107083473-107083495 CTGGGTAATTTTGTTTTTGGGGG - Intronic
1014769717 6:125446763-125446785 CTTGCTGATTCTGCTTCTGGGGG + Intergenic
1015558078 6:134483268-134483290 CTTGCTAGTTGTGGTCTTGGGGG - Intergenic
1018463049 6:164017320-164017342 TTACCTAATTGTGCTGTTGGTGG + Intergenic
1019671814 7:2283955-2283977 CTGGCTAATTTTGCATTTTTAGG + Intronic
1020483146 7:8687258-8687280 CTGCCTGAGTGAGCTTTTGGAGG + Intronic
1020656113 7:10929994-10930016 CTGGCTAAATGAGCTTTTTTAGG - Intergenic
1022042297 7:26592470-26592492 CTGGCTTATTTGGCTTTTGCTGG + Intergenic
1023800418 7:43829094-43829116 ATGGCTAATAGTACTTATGGAGG + Intergenic
1023924894 7:44660764-44660786 TTGGCTAATTTTGTTGTTGGTGG - Intronic
1029260662 7:99300640-99300662 CTGGCTAATTTTATTTTTTGTGG - Intergenic
1030257574 7:107528251-107528273 CTGGCTAATTGTATTTTTTGTGG + Intronic
1032422397 7:131793109-131793131 ATGGAAAAGTGTGCTTTTGGAGG + Intergenic
1032644047 7:133801609-133801631 CAGGGTAATTGTGCTGTTAGGGG + Intronic
1033064392 7:138140138-138140160 CTGGCTAATTTTTTTTTTGAGGG + Intergenic
1033536383 7:142315938-142315960 GTGGGTAATTGTGTTTTTTGGGG + Intergenic
1033736235 7:144224792-144224814 CTGGCTAATTTTGTTGTTGTTGG - Intergenic
1033746819 7:144326163-144326185 CTGGCTAATTTTGTTGTTGTTGG + Intergenic
1036536270 8:9655544-9655566 CTGTCTAATCGTTCTTCTGGAGG - Intronic
1038547833 8:28439584-28439606 CTGGCTAATTGTGGTTTTTGGGG - Intronic
1041329126 8:56704615-56704637 CTGGCTAATTAGGCTTTGAGGGG + Intergenic
1046485180 8:114877946-114877968 CTGGCTAAGTCTCCCTTTGGGGG - Intergenic
1046581535 8:116099104-116099126 CTGGCTAATTTTTCCTTTTGGGG - Intergenic
1047061884 8:121235946-121235968 CTGGCTAATTTTATTTTTTGTGG + Intergenic
1047605090 8:126466700-126466722 CTGGCCAATTATGAATTTGGGGG - Intergenic
1050307443 9:4319689-4319711 CTGGCTAATTTTATTTTGGGAGG + Intronic
1053387800 9:37708439-37708461 CAGGCTCATTGTTCATTTGGAGG - Exonic
1058875404 9:109239818-109239840 CTGGCTACTTGTGCTCTTCCTGG - Intronic
1059000468 9:110343206-110343228 CTGACTAATTTTGTTTTTCGGGG - Intergenic
1060919065 9:127407555-127407577 CTGGCTGGAGGTGCTTTTGGAGG + Exonic
1062294547 9:135817383-135817405 CTGTTTATTTTTGCTTTTGGGGG + Intronic
1203733699 Un_GL000216v2:115384-115406 CCAGCTAATTGTGTTTTTAGTGG + Intergenic
1186121911 X:6372538-6372560 CAGGATAATGGTGATTTTGGTGG - Intergenic
1186587443 X:10890642-10890664 CTGGCTAATTTTGTTTTTAGTGG - Intergenic
1186924358 X:14316241-14316263 CTTGATAATTGTGCTATTGTTGG + Intergenic
1188977250 X:36690548-36690570 TTGGCTGATTGTGAGTTTGGTGG - Intergenic
1192137558 X:68618496-68618518 CTGGCTAACTATTTTTTTGGGGG + Intergenic
1193536229 X:82718705-82718727 CCAGTTAATTGTACTTTTGGTGG - Intergenic
1196114609 X:111985462-111985484 CAAGGTAATTGTGCATTTGGGGG - Intronic
1196649896 X:118158013-118158035 CTAGCTAATTTTTTTTTTGGTGG + Intergenic
1197744074 X:129919210-129919232 CTGGCTGCTTGTTCTTATGGAGG - Exonic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1199937444 X:152589110-152589132 CTTACTGTTTGTGCTTTTGGAGG - Intergenic
1200066513 X:153506678-153506700 CTGGCCATCTGTGCTGTTGGGGG - Intronic
1201470363 Y:14326703-14326725 CTGGTTTATTCTGCTTCTGGTGG - Intergenic
1202627315 Y:56873037-56873059 CCAGCTAATTGTGTTTTTAGTGG - Intergenic