ID: 1091135042

View in Genome Browser
Species Human (GRCh38)
Location 11:133180724-133180746
Sequence CAGCCTTCACAGCCTTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091135042_1091135044 6 Left 1091135042 11:133180724-133180746 CCTCATTAAGGCTGTGAAGGCTG 0: 1
1: 0
2: 1
3: 8
4: 137
Right 1091135044 11:133180753-133180775 GGTACGCATCACACGCAGTCTGG 0: 1
1: 0
2: 0
3: 0
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091135042 Original CRISPR CAGCCTTCACAGCCTTAATG AGG (reversed) Intronic
902694460 1:18130920-18130942 CAGCTCTCACAGCCTGTATGGGG + Intronic
904495208 1:30882566-30882588 CACCCATCACAGCCCTGATGGGG - Intronic
906097456 1:43234036-43234058 CAGCCTGAACAGCCTACATGGGG - Intronic
909139704 1:71848091-71848113 CAGCATTCATAGAGTTAATGAGG - Intronic
909224736 1:73005167-73005189 CATCCTTCAAAGCTTTAGTGAGG + Intergenic
911007058 1:93237298-93237320 CAGTCTTCACAGACTCAAGGTGG - Intronic
911042720 1:93603805-93603827 CAGCAGTCACAGCCTTTTTGAGG + Intronic
911979377 1:104547229-104547251 CAGCCTGCTCAGCCTGTATGAGG - Intergenic
912554635 1:110507368-110507390 CAGGGTTCACAGCCTTCAGGTGG + Intergenic
917152179 1:171957021-171957043 CAGCCTTCACAACTGTGATGGGG + Intronic
917638151 1:176956829-176956851 CAGTCTTCACATCCATGATGTGG + Intronic
922193699 1:223341481-223341503 CAGCCTTCACAGCTGGAAGGTGG - Intronic
923495560 1:234521566-234521588 CAGCCTACACATCCTGAATATGG - Intergenic
1063983902 10:11480565-11480587 CAACCCTCACAGCAGTAATGGGG - Intronic
1066272264 10:33835477-33835499 CAGCCTTTACAATCTTAATAGGG + Intergenic
1072419983 10:95282318-95282340 CAGACTTCACAGCCATATTATGG + Intronic
1076544762 10:131237957-131237979 CTGCCTGCAGAGCCCTAATGTGG + Intronic
1079739193 11:24036307-24036329 AAGCCTTCTCAGCTTTCATGTGG + Intergenic
1081120183 11:39256488-39256510 CAACCTTGACAGCTTTCATGTGG - Intergenic
1082953143 11:58839453-58839475 CAGGATTCATAACCTTAATGGGG - Intronic
1083479334 11:62933696-62933718 CAGCCTTCAGAACCTAAACGTGG - Intergenic
1084302338 11:68259815-68259837 CAGCCTTCACTGCCTGAGTCAGG - Intergenic
1084454850 11:69262509-69262531 CTGCCTGCACTGCCTAAATGAGG - Intergenic
1085156625 11:74301500-74301522 CAGCCTACTCTGCCTTAATTTGG + Intronic
1085916261 11:80891751-80891773 CAGCCTCTACAGACTGAATGAGG + Intergenic
1086317714 11:85610996-85611018 CAGCCTTCAAAACCTTAAAGCGG + Intronic
1086991971 11:93313488-93313510 CAGCCTTGACAGCTTTCATATGG - Intergenic
1091135042 11:133180724-133180746 CAGCCTTCACAGCCTTAATGAGG - Intronic
1092753505 12:11741256-11741278 CAACCTTGACAGCCATCATGTGG + Intronic
1092965014 12:13633061-13633083 CCTCCTTCACAGCCTCAATCTGG + Intronic
1093575198 12:20719675-20719697 CAGCCTTTATAGAATTAATGAGG - Intronic
1094494687 12:30982069-30982091 GAGACTTCAAAGCCTGAATGGGG + Intronic
1095992746 12:48048294-48048316 AAGGCTTCACAGCAATAATGGGG - Intronic
1097360255 12:58652148-58652170 CAGTATTCACAGCCTAACTGGGG + Intronic
1098660547 12:73087824-73087846 AAGCCTTGACAGCTTCAATGTGG - Intergenic
1100864254 12:98839445-98839467 CAGCCTTCCCAGCCTAAAAGGGG + Intronic
1104635425 12:130435502-130435524 CTGCCTTCACAGCCTTCTTGGGG + Intronic
1109244220 13:59933273-59933295 GAGCAATCACAGCCATAATGAGG - Intronic
1113968038 13:114165745-114165767 CAGCATGCACAGCTTTAATCAGG + Intergenic
1114178715 14:20346798-20346820 CAGCCCTGACATCCTAAATGAGG - Intronic
1114430276 14:22654890-22654912 AAGCCTTCCCAGCCATCATGGGG - Intergenic
1117742513 14:58833616-58833638 CTGCCTTGCCATCCTTAATGGGG - Intergenic
1121819690 14:96956399-96956421 CAGCTTTCAAAGACTTAGTGTGG - Intergenic
1122176417 14:99923238-99923260 CAGCCTTCATTTTCTTAATGGGG + Intronic
1122517763 14:102320303-102320325 CTGCCTTCACAGCCCTGCTGGGG + Intronic
1125241178 15:37578320-37578342 CAGCCTTCACAGCATGAAAGTGG + Intergenic
1126866406 15:52941893-52941915 TTGCCCTCACAGCATTAATGGGG + Intergenic
1131224811 15:90615695-90615717 CAGACTCCAGTGCCTTAATGGGG - Intronic
1132216026 15:100062265-100062287 CGGCCGTCACAGCCTCAAGGAGG + Intronic
1134281291 16:12819453-12819475 CTGCCTTCATCCCCTTAATGTGG + Intergenic
1135611079 16:23867716-23867738 CAGTCTTCACATCCTTAAAGTGG - Intronic
1136136265 16:28258625-28258647 CAGGCTTCTCAGCGTGAATGTGG + Intergenic
1137817023 16:51408057-51408079 CAGCCTGGACAGCCCTTATGAGG + Intergenic
1138249570 16:55491681-55491703 CAGGGTTCTCAGCCTTACTGTGG + Intronic
1140323673 16:73978767-73978789 CAGCCTCCTCAGCCATAAAGTGG + Intergenic
1141250576 16:82353637-82353659 CAGCCTTCACAGAATTGAAGAGG + Intergenic
1141813186 16:86390272-86390294 CAGGCTTCACTGCTTCAATGTGG + Intergenic
1156453893 18:37282026-37282048 GAGCCTGCACAGCCAAAATGTGG - Intronic
1158115882 18:53994604-53994626 CCACCTTTACAGCCTTAATTGGG - Intergenic
925247314 2:2395540-2395562 CAGCTTACACTGCCTTAGTGTGG - Intergenic
925327589 2:3035534-3035556 CAGCTTTCACAGCATTCTTGGGG - Intergenic
928195760 2:29215510-29215532 CAGCCTTCTCATCGTTAATATGG - Intronic
929901667 2:46008979-46009001 CAGCCATCAGAAACTTAATGAGG - Intronic
931900484 2:66782844-66782866 CAGCCTCCACAGTCATAATTAGG - Intergenic
932081635 2:68720983-68721005 CAGACTCCAAAGCCTTACTGTGG + Intronic
932294221 2:70610652-70610674 CAGCCTTCACAACCTTAGAGTGG - Intronic
933296236 2:80494325-80494347 CAGCCATCACAGCTTTCCTGGGG - Intronic
935569819 2:104647311-104647333 CAGCCTTCCCAGCTCTAACGCGG - Intergenic
936471072 2:112799213-112799235 CAGCCTTCACTCACTTCATGTGG - Intergenic
939189694 2:138901975-138901997 CAGCCTGCAGTGCCTTGATGGGG + Intergenic
939692956 2:145288559-145288581 CACCTTTTACAACCTTAATGGGG + Intergenic
939830413 2:147064360-147064382 CAGCCTTGGCAGCTTTCATGTGG + Intergenic
941238294 2:163003374-163003396 CAGCCTTCACAGAATTGAGGAGG - Intergenic
943531704 2:189090285-189090307 CAGCCTTCACAGAATTGAAGAGG - Intronic
947243514 2:228021295-228021317 CAGATCTCACAGCCTCAATGTGG + Intronic
947717673 2:232350072-232350094 CAGCCTTCTCAGCCTTGCTCGGG - Intergenic
1168781884 20:499345-499367 TAGCCCTGACAGCTTTAATGGGG + Intronic
1173538928 20:43837118-43837140 CACCCATCAAAGCCTTCATGGGG + Intergenic
1174159071 20:48537557-48537579 CAGCCTTCAGAGCTCTAATCAGG + Intergenic
1177526981 21:22306036-22306058 CAGCCTTCACAGACTTGAAAAGG + Intergenic
1177699766 21:24622681-24622703 CAGCCTTCATAGAATTAAAGAGG - Intergenic
1182225995 22:28799521-28799543 CAGCCTTCACTAGATTAATGAGG - Intronic
949845180 3:8362456-8362478 AACCCTTCAAAGCCTTAAGGAGG + Intergenic
953102818 3:39846407-39846429 CAACCTTCACAGCCCTCATAGGG - Intronic
955062763 3:55507494-55507516 CAGCCTTCACAGCGTGTCTGTGG - Intergenic
955409449 3:58646386-58646408 CAGCCTTCACAGGGTAAATTGGG + Intronic
959576677 3:107941749-107941771 CTCTCTTCACAGCCTTAATATGG - Intergenic
961512560 3:127412033-127412055 CAGCCCTAACAGCCCTAAGGCGG + Intergenic
961715424 3:128854103-128854125 CTGGCTTCACAGCCTTGCTGGGG + Intergenic
962046126 3:131761043-131761065 TAGCCTTCAGGGCCTGAATGAGG + Intronic
970908702 4:21248708-21248730 CCATTTTCACAGCCTTAATGTGG + Intronic
972463816 4:39332715-39332737 CAGACTTCAGAGGCTGAATGTGG - Intronic
973141370 4:46772585-46772607 CCTCCTTCCCAGCTTTAATGAGG - Intronic
975216494 4:71761773-71761795 AAGCCTTGACAGCTTTCATGTGG + Intronic
979659037 4:123231416-123231438 CAGCCTTCACAGAATTGAAGAGG + Intronic
982822980 4:159967316-159967338 AAGGATTCACAGCATTAATGGGG + Intergenic
985286019 4:188336975-188336997 CAGCCTTCAGAGCAGGAATGAGG - Intergenic
987097932 5:14566485-14566507 CAACCTTGACAGCCTCCATGTGG - Intergenic
988803366 5:34717602-34717624 CAGAATTCACATCCTTAAGGAGG - Intronic
990264541 5:54061262-54061284 AAGCCTTCACAGCTTCCATGTGG + Intronic
992836042 5:80642296-80642318 CAGCCTTTACAGAATTAAAGAGG - Intronic
997779311 5:136640931-136640953 CAGCTTTCAGAGCCTTTCTGAGG - Intergenic
997879278 5:137574920-137574942 CAGCCTTCTCAGGTTTAAGGAGG - Intronic
999312238 5:150558914-150558936 AAGCCCTCACAGCCTAATTGAGG + Intergenic
999796313 5:154992875-154992897 CTGCCTTGACAGCATCAATGTGG - Intergenic
999938928 5:156519261-156519283 CACCCTTCCCAGACTGAATGAGG + Intronic
1004423895 6:15494816-15494838 CAGCCTGCACAGCCTTGTGGTGG + Intronic
1007125365 6:39421717-39421739 GAGCCTGAACAGCCTTAATAAGG - Intronic
1008432005 6:51429396-51429418 CAGCCTCCCCAGCCATTATGTGG + Intergenic
1009968436 6:70602148-70602170 CAGAATTCACAGTCTTAAGGGGG - Intergenic
1012830799 6:104201541-104201563 AAGCCTTGGCAGCCTTCATGTGG + Intergenic
1012907685 6:105087083-105087105 GAGGCTGCACAGCATTAATGGGG + Intergenic
1012982046 6:105841099-105841121 CATCCTCAACAGCCTGAATGAGG - Intergenic
1013688081 6:112609253-112609275 AAGCCTTCACAGCTTCCATGTGG + Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1022311328 7:29199022-29199044 CAGTCTTCAAAACCTTAATTGGG + Intronic
1023370463 7:39507999-39508021 AAGGCTTGACAGACTTAATGAGG + Intergenic
1024637337 7:51301450-51301472 CTTCCTTCACAGCCGTACTGTGG + Intronic
1025038555 7:55619238-55619260 AAGCCTTCACAGCTTCTATGTGG + Intergenic
1029257395 7:99278849-99278871 CAGCCTTCACAAACAAAATGGGG - Intergenic
1031175038 7:118339106-118339128 AAGCCTTCACAGCTTCCATGTGG + Intergenic
1032381734 7:131491341-131491363 CAGCCTTCACATCCTAGATCGGG - Exonic
1033388707 7:140905247-140905269 CAGATTTCTCAGTCTTAATGGGG - Intronic
1035879458 8:3228991-3229013 CAGCCTTCTCAGCCTTGTCGGGG - Intronic
1037655624 8:20881663-20881685 CAGCCATCCCAGGCCTAATGAGG - Intergenic
1043513113 8:80969416-80969438 AAGCCTTCACTACCTAAATGAGG + Exonic
1045499211 8:102732129-102732151 CAACCTTCACAGACTGATTGAGG - Intergenic
1049115163 8:140679959-140679981 CAGACTTCACTGCCTTCCTGGGG - Intronic
1049441144 8:142610313-142610335 CAGCCTCCCCTGCCTTTATGGGG - Intergenic
1049441156 8:142610365-142610387 CAGCCTCCACTGCCTTTTTGGGG - Intergenic
1050255384 9:3787704-3787726 CAGCCTTGGCAGCTTTCATGTGG - Intergenic
1051094109 9:13445355-13445377 CAGCCTTCACATCCTCCCTGCGG - Intergenic
1051356335 9:16242791-16242813 CAGCTTTTACAGTCTGAATGTGG + Intronic
1051395252 9:16613486-16613508 AAGCCTGCACAGCAGTAATGGGG - Intronic
1051439475 9:17068859-17068881 AAGCCTTCACAGAATAAATGAGG + Intergenic
1058676337 9:107403453-107403475 CACCGTTCACAGCTTAAATGTGG + Intergenic
1060327168 9:122628620-122628642 CACCCTTGACATCCTTATTGTGG + Exonic
1061940688 9:133882298-133882320 CAGCCTTCACAGCCCCAAAGGGG + Intronic
1187287908 X:17923794-17923816 CAGCCTCCACAGCAGCAATGTGG - Intergenic
1188807850 X:34613826-34613848 AAGTCTTCACAGCTTTCATGTGG - Intergenic
1189951337 X:46234332-46234354 CAGCCTTCTCAGCCTTAAAGTGG - Intergenic
1191095066 X:56665198-56665220 TAGCCTTAACAGCTTTCATGTGG + Intergenic
1192751166 X:73993045-73993067 AGGCCTTCACTACCTTAATGTGG + Intergenic
1193410903 X:81161642-81161664 AAGCCTTCAGAGCCTTAAAGGGG + Intronic
1196259238 X:113558616-113558638 CATCCTTCACAGTATTATTGTGG + Intergenic
1196260331 X:113571761-113571783 CAGCCTTCATAGAATTAAAGAGG + Intergenic
1197268092 X:124397443-124397465 CAGCCTTCTCCTCCTTAAGGAGG - Intronic