ID: 1091137853

View in Genome Browser
Species Human (GRCh38)
Location 11:133208401-133208423
Sequence AACTCTCTGGAGTTTACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091137850_1091137853 -4 Left 1091137850 11:133208382-133208404 CCATAGGTTAGGATTTTATAACT 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1091137853 11:133208401-133208423 AACTCTCTGGAGTTTACTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091137853 Original CRISPR AACTCTCTGGAGTTTACTCT GGG Intronic