ID: 1091138058

View in Genome Browser
Species Human (GRCh38)
Location 11:133210611-133210633
Sequence ATTTCAACTTTGATGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091138058_1091138061 -10 Left 1091138058 11:133210611-133210633 CCCTGTTCCATCAAAGTTGAAAT 0: 1
1: 0
2: 3
3: 19
4: 226
Right 1091138061 11:133210624-133210646 AAGTTGAAATGACCACAAAATGG 0: 1
1: 0
2: 3
3: 28
4: 376
1091138058_1091138064 8 Left 1091138058 11:133210611-133210633 CCCTGTTCCATCAAAGTTGAAAT 0: 1
1: 0
2: 3
3: 19
4: 226
Right 1091138064 11:133210642-133210664 AATGGCTTTAGAGGAGCTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 168
1091138058_1091138065 23 Left 1091138058 11:133210611-133210633 CCCTGTTCCATCAAAGTTGAAAT 0: 1
1: 0
2: 3
3: 19
4: 226
Right 1091138065 11:133210657-133210679 GCTAAAGGTTCCAACATACATGG 0: 1
1: 0
2: 0
3: 4
4: 74
1091138058_1091138062 -1 Left 1091138058 11:133210611-133210633 CCCTGTTCCATCAAAGTTGAAAT 0: 1
1: 0
2: 3
3: 19
4: 226
Right 1091138062 11:133210633-133210655 TGACCACAAAATGGCTTTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091138058 Original CRISPR ATTTCAACTTTGATGGAACA GGG (reversed) Intronic
902357164 1:15912689-15912711 ATCTCAAACTTGATGGAAGAAGG - Intronic
904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG + Intronic
905988022 1:42305560-42305582 TTTTCAACATGGATGGAACTGGG + Intronic
906850284 1:49241357-49241379 ATTTCATCTTTGATGAGAAAAGG - Intronic
907004531 1:50897637-50897659 ATTTCTAATTTTATAGAACAAGG + Intronic
908196903 1:61754208-61754230 ATTTCAACTTTGTTGAAACACGG - Intronic
908481467 1:64544421-64544443 AATTCCACTTTGCTGGAACAAGG - Intronic
910488792 1:87745653-87745675 TTTTCAAATATGATGGAACAAGG + Intergenic
910595227 1:88973827-88973849 ATTGAAACTTTGATGGACTAGGG - Intronic
911883996 1:103274142-103274164 ATTTAAACCCTGATGGAAAAAGG + Intergenic
911927266 1:103850144-103850166 ATGTCAACTTAGATAAAACATGG + Intergenic
912628338 1:111224899-111224921 ATTTCAAGTTTGAGGAAAAAAGG + Intronic
913017235 1:114751565-114751587 ATTTGATATTTGAAGGAACATGG - Intronic
913996777 1:143657133-143657155 ATAACAATTTTTATGGAACAAGG - Intergenic
916505807 1:165427372-165427394 ATTCCAACATTGATGGGGCAAGG - Intronic
916659863 1:166913304-166913326 ATTTCAGTTTTGATGTCACAAGG + Exonic
916965350 1:169934789-169934811 ATTTCAAGTATGCAGGAACAGGG + Intronic
916982271 1:170151429-170151451 CTTTTAACTTTGATGGCAAAGGG - Intronic
918600075 1:186348058-186348080 ATAGCAATTTTTATGGAACAAGG + Intronic
918835474 1:189459005-189459027 TTTTTGACATTGATGGAACAGGG - Intergenic
919167313 1:193911949-193911971 ATGTCAACTGTGAGGGAACTTGG + Intergenic
920286453 1:204883264-204883286 GTTTCAACTTGGATAGAACAAGG + Intronic
1064228920 10:13512536-13512558 ATTTCAACTTACATTGAAAAGGG - Intronic
1064417213 10:15160302-15160324 ATTTGACCTTGGGTGGAACACGG - Intronic
1065062938 10:21926324-21926346 ATTTGAATTTTGCTGGAAAAGGG - Intronic
1065162047 10:22932756-22932778 ATTTCAAATTTGAAGGAAACTGG + Intronic
1065194830 10:23253933-23253955 CTTTCAACTTTGCTGCAACATGG + Intergenic
1070620426 10:78005465-78005487 TCTCCAACTTTGATGGAACTAGG + Intronic
1071412456 10:85410423-85410445 ATAGCAATTTTTATGGAACAAGG + Intergenic
1071842745 10:89489820-89489842 ATTTCAAATATGATGAAAAAAGG + Intronic
1072132262 10:92506309-92506331 CTTTCAACTTTGTAGCAACAGGG - Intronic
1072134536 10:92531872-92531894 TTTGCAACTTTCATCGAACAAGG + Exonic
1077830123 11:5858623-5858645 TTTGCAGCTATGATGGAACATGG + Intronic
1079568596 11:21914874-21914896 AATTCAACCTTGATGGAAATAGG + Intergenic
1080232127 11:30028461-30028483 ACTTCAAATATGGTGGAACAGGG + Intergenic
1080726843 11:34906521-34906543 ATTTCTATTATGATGCAACAAGG + Intronic
1083068792 11:59954307-59954329 ATGTCTGCTTTCATGGAACAAGG - Intergenic
1085018696 11:73191619-73191641 ATTTCACCTTGTGTGGAACATGG - Intergenic
1085934927 11:81129712-81129734 ATTTCAACTTTGGAGAAACAAGG - Intergenic
1086291633 11:85317048-85317070 ATATCAACTTTGAAGGTAAAAGG + Intronic
1086406318 11:86502093-86502115 ATTTCAGTTTGGATGGAGCATGG - Intronic
1086830210 11:91553005-91553027 ATTTCCACTTTTGTGGAACAGGG + Intergenic
1088300413 11:108352145-108352167 ATCTCAACTTTAATGAAAAATGG + Intronic
1089822841 11:121244228-121244250 TTTTCAAATTTGATGGCAGAAGG - Intergenic
1090447011 11:126773167-126773189 GTGTCAACTTTGCTGGGACATGG + Intronic
1091138058 11:133210611-133210633 ATTTCAACTTTGATGGAACAGGG - Intronic
1094410232 12:30160498-30160520 CTTACAAATTTGGTGGAACATGG + Intergenic
1097361947 12:58668193-58668215 ATTTCCACTTTGTAGAAACAAGG - Intronic
1097502866 12:60427845-60427867 ATTTCAACTTGGAAGGGAAATGG - Intergenic
1098741199 12:74175527-74175549 ATAGCAATTTTTATGGAACAAGG - Intergenic
1102337574 12:112094974-112094996 ATTTCAAGTTTTAAGGAATATGG + Intronic
1103389661 12:120562777-120562799 ATCTCAACTTTGAGGGAAACAGG - Intronic
1104154032 12:126113497-126113519 TTTTCACCTTAGATGGAACAAGG + Intergenic
1104468982 12:129013627-129013649 ATTTCAACTTGTATGGGAAAAGG + Intergenic
1106691102 13:32117687-32117709 ATTTCAACTTTGGTGGAGACAGG + Intronic
1108897187 13:55346382-55346404 ATTGCAACTTTAAAGGAAGAAGG - Intergenic
1108929949 13:55806134-55806156 ATTTCAAGATTGATGGCATATGG - Intergenic
1109332493 13:60946751-60946773 ATAGCAACTTGGATGGAACTAGG - Intergenic
1109555997 13:63976419-63976441 CTTCCAACTTAGTTGGAACATGG - Intergenic
1109568893 13:64159411-64159433 AGTTCAAATTTGATAAAACATGG - Intergenic
1110542887 13:76725943-76725965 ATTTAAACTGTGTAGGAACAAGG - Intergenic
1111335596 13:86818012-86818034 ATTTCATCCTTTATGCAACAAGG + Intergenic
1111929110 13:94495537-94495559 ATTTAAACTTTGATGATACATGG - Intergenic
1112691453 13:101900208-101900230 ATTTAAACATTCATGGAAAATGG - Intronic
1114357156 14:21923794-21923816 ATTGCACCTGTGATGGAACTGGG - Intergenic
1114812076 14:25912555-25912577 AGCTCATCTTTGATGGCACATGG - Intergenic
1117111316 14:52458607-52458629 TTTTCTACTTTGATGTAGCATGG - Intronic
1124631106 15:31337884-31337906 ATTTCAACCTTGATAAAAGATGG - Intronic
1124844474 15:33277041-33277063 ATTTCATTTATGAGGGAACATGG + Intergenic
1125703610 15:41711028-41711050 ATTTCTGCTTTGGTGAAACAGGG - Exonic
1126430763 15:48581611-48581633 ATTTCAAATTTGAGGGAACTAGG - Intronic
1126444246 15:48724301-48724323 ATTTCAACTTTTATTGAATAGGG + Intronic
1127067595 15:55256784-55256806 ATTTCATATTTGATAAAACAAGG - Intronic
1127355128 15:58190907-58190929 ATTTTAATTTTGATGCAAAAAGG + Intronic
1127536620 15:59895766-59895788 ATTTTAACTCTTCTGGAACAGGG - Intergenic
1129113807 15:73353775-73353797 ATTTCAACCCTGAGGGTACAGGG - Intronic
1129932253 15:79421661-79421683 AATCCATCTTTGATGAAACATGG + Intronic
1131563621 15:93465477-93465499 CTATCAACTTTGCTGGAAAATGG - Intergenic
1131696900 15:94887255-94887277 AGTCCAGCTTTGCTGGAACAGGG - Intergenic
1134599416 16:15521726-15521748 TTATCAACTTTACTGGAACAGGG + Intronic
1135821025 16:25686218-25686240 ATTTTACCTTTGATGGAAAAAGG - Intergenic
1137867700 16:51917765-51917787 ATTTCCACTTTGTAGGGACAGGG - Intergenic
1137909219 16:52359302-52359324 ATTTCAACTTGACTGGATCATGG + Intergenic
1138719309 16:59060394-59060416 ATTTCAACTTGAATGAATCAGGG + Intergenic
1139327247 16:66161970-66161992 ACCTCAACTTTTATGTAACAAGG + Intergenic
1142912481 17:3107082-3107104 ATTTCCACTGTGATGGAGCAGGG - Intergenic
1142929032 17:3266724-3266746 GCTTCAACTTTAATGTAACAAGG + Intergenic
1142976713 17:3649025-3649047 ATTTCTAGGTTGATGGAACAGGG - Intronic
1143225184 17:5295578-5295600 ATGTAAACTTTGACAGAACAGGG - Intronic
1146875597 17:36407865-36407887 ATTTCAAATTGAATGGAAAAAGG - Intronic
1147063790 17:37905004-37905026 ATTTCAAATTGAATGGAAAAAGG + Intergenic
1147960909 17:44167116-44167138 ACTTCAACCTGGAGGGAACAGGG - Intergenic
1148521661 17:48282424-48282446 ATGTTAGCTTTGAGGGAACAGGG - Intronic
1149511220 17:57243339-57243361 ATTCCAACTTTGGAGGACCATGG - Intergenic
1151209898 17:72536713-72536735 ACCTCACCTTGGATGGAACATGG + Intergenic
1152885689 17:82847934-82847956 ATTTGAATTTTTATGGAACTGGG + Intronic
1153696367 18:7646864-7646886 ATTCCAACTTGGAGGAAACAAGG - Intronic
1154290249 18:13100440-13100462 ATTTCAACTTTTGTGGAAGGCGG - Exonic
1156023541 18:32626399-32626421 ATTTCCACTCTGATTGAAAATGG + Intergenic
1157646805 18:49282039-49282061 ATTACTATTTTGATGGAGCAAGG + Exonic
1157927530 18:51782571-51782593 ATTCCAACTTTGAAGAAGCAGGG + Intergenic
1160158580 18:76452651-76452673 ATTTGAACTTAGGTGGAAGATGG - Intronic
1164268771 19:23649621-23649643 ATAGCGACTTTTATGGAACAAGG + Intronic
1165970618 19:39625924-39625946 ATTTCATATTTGATGGAGAAGGG - Intergenic
1167689020 19:50974357-50974379 ATTTCAAGGATGAAGGAACAGGG + Intergenic
925816403 2:7755332-7755354 ATGAAATCTTTGATGGAACATGG + Intergenic
926417358 2:12662907-12662929 ATTTCATTTTTCCTGGAACATGG + Intergenic
930831579 2:55749418-55749440 AGTTCAACTGTTATGGAAGATGG + Intergenic
932021537 2:68092660-68092682 ATTTCAACAGTGTTGGAACCAGG + Intronic
933372535 2:81434040-81434062 ATTTCAAATATGATGAAATAGGG + Intergenic
935069486 2:99681475-99681497 ATGTGAATTTTGAGGGAACACGG - Intronic
935824212 2:106927229-106927251 ATAGCAATTTTTATGGAACAAGG - Intergenic
935903369 2:107816443-107816465 ATTTCAACTTCGCTTGATCATGG + Intergenic
937678613 2:124619495-124619517 GTATCAACTTGGCTGGAACATGG + Intronic
938029479 2:127980456-127980478 TTTTAAACTTTCATGGAGCATGG - Intronic
939308712 2:140443736-140443758 ATTTGAATTTTGATGGAAGATGG + Intronic
941032986 2:160534271-160534293 ATATCAATTTTGAGAGAACATGG - Intergenic
942165696 2:173238605-173238627 ATTTCAACTTGTGGGGAACAAGG - Intronic
946652919 2:221913644-221913666 ATCTGAGCTTTGATGGAAGAAGG + Intergenic
946812567 2:223541537-223541559 TTTCCAAATTTGATGGAGCATGG + Intergenic
1168934644 20:1653569-1653591 ATTTCTACCTTCATGGAAGAGGG + Intronic
1169422704 20:5472662-5472684 ATTGCAACTTTGATGGACACTGG - Intergenic
1169426715 20:5502813-5502835 ATTGCAACTTTGATGGACACTGG + Intergenic
1169663152 20:8003056-8003078 ATTTCACCCTGGAGGGAACAAGG + Intronic
1171057074 20:21917717-21917739 ATTTCATCTTTGCTGTAATAAGG - Intergenic
1176203598 20:63876032-63876054 CTTTAAACTTTTGTGGAACAGGG + Intronic
1176704872 21:10107595-10107617 ATTTCTACTTTGATGAAACATGG - Intergenic
1177891422 21:26808479-26808501 TTTTCAGCTTTCCTGGAACAAGG + Intergenic
1184317743 22:43710175-43710197 ATTTCAAATTGGAAAGAACAGGG + Intronic
950223256 3:11212778-11212800 GTTTTGACTTTGATGAAACAGGG - Intronic
951754553 3:26075913-26075935 ATTGCAACTTTGCTGCCACAGGG - Intergenic
952060013 3:29496575-29496597 ATATCCACTTTGATGGTAAATGG + Intronic
952242340 3:31544989-31545011 AATTAAACTTATATGGAACAAGG - Intronic
952325542 3:32317362-32317384 ATTTCAAGTAAGATGGACCAAGG - Intronic
952582126 3:34846928-34846950 ATTTCGAATGTGATGGAAGAAGG + Intergenic
952713544 3:36455230-36455252 ATTTCTTCCTGGATGGAACAGGG - Intronic
957582896 3:82098698-82098720 ATTTCAACTTTGATAAAAAATGG - Intergenic
958609341 3:96403872-96403894 ATGTCAACTTGGCTGGACCAGGG - Intergenic
959221704 3:103529654-103529676 GTTTCAATTTTGTTGGACCATGG - Intergenic
960291953 3:115896805-115896827 CTTTCAAATTTGAGGGAAGAGGG + Intronic
960916353 3:122699037-122699059 ATTTCAACATAGATGGATCTTGG + Intronic
961084086 3:124051735-124051757 ATTTCTACTTTGGTGAAACTGGG + Intergenic
962220867 3:133563749-133563771 ATTGCAGCTTTGCTGCAACATGG - Intergenic
963463624 3:145649132-145649154 ATCTCAAATTTGATGAAATATGG + Intergenic
963593237 3:147289663-147289685 ATTTCAAATTTGAGGAAACTTGG + Intergenic
964046664 3:152336583-152336605 ATTTTAAATTTGAGGGAACTGGG - Intronic
964524942 3:157608088-157608110 AATTCAACTTGCAGGGAACACGG - Intronic
964698309 3:159535034-159535056 ATTTCACAGTTGAGGGAACAGGG - Intronic
964985723 3:162735241-162735263 ATTTCAAGTATGATGGGAAATGG + Intergenic
965812940 3:172610444-172610466 ACCTCACCTTTGGTGGAACAGGG - Intergenic
965961031 3:174428846-174428868 ACATCCAATTTGATGGAACAGGG - Intergenic
966456666 3:180125096-180125118 ATTTGACCTTTGAAGAAACATGG + Intergenic
967294219 3:187949571-187949593 AATTCCACTTTGAGAGAACAAGG - Intergenic
967321035 3:188195551-188195573 AATTTAACTTTGATGAATCAAGG - Intronic
971698676 4:29938776-29938798 CTTACAACTTTGAGGGAACCCGG + Intergenic
972893317 4:43587117-43587139 ATTTCAGCTTTGATGAATCCAGG + Intergenic
973826850 4:54715965-54715987 ACTTCAACTTTTTTGGAAGATGG + Intronic
976152771 4:82108688-82108710 ATTTCAAATTTGATGTTTCATGG + Intergenic
979786923 4:124727127-124727149 ATTTCCACTTTGGTGAAACTGGG + Intergenic
980267234 4:130533019-130533041 ATTTAGAATTTGATGAAACACGG + Intergenic
980377094 4:131964026-131964048 ATTTCTACTTTGATGAAACATGG - Intergenic
981384455 4:144112297-144112319 ATTTCTACTTTTATAGAATATGG - Intronic
982204936 4:152990535-152990557 ATCTCATTTGTGATGGAACAGGG - Intergenic
986484109 5:8217967-8217989 ATTTCCTCATTGATGAAACAAGG + Intergenic
986970255 5:13326482-13326504 ATTTCACCTTTAACGCAACATGG + Intergenic
988081740 5:26424040-26424062 ATTTTATCTTTGAGGGAGCATGG - Intergenic
989010796 5:36870280-36870302 ATTTCAACTTTAAGTGAAAATGG + Intergenic
989250410 5:39307809-39307831 ATTTCAATTTAGATGGAAGGTGG + Intronic
990773711 5:59281301-59281323 ATTTCATCTTTGAGGAAACTGGG - Intronic
991059773 5:62361538-62361560 ATTCCAAATTTTATGGAAAAAGG - Intronic
995153483 5:108880310-108880332 AATTCAGCTTTGATGTAGCATGG + Intronic
995266553 5:110168359-110168381 ATTTCTACTTTGATATACCATGG + Intergenic
995715017 5:115073736-115073758 ATTTCTATTATGATGCAACAAGG - Intergenic
995900044 5:117054910-117054932 ATGTCATATTTTATGGAACAAGG + Intergenic
996478126 5:123944278-123944300 ATTATAACTTTTATGGAGCATGG - Intergenic
998876243 5:146602722-146602744 ATTTCAATTCTGATTGATCAGGG - Intronic
999333706 5:150696682-150696704 TTTCTAACTCTGATGGAACACGG - Exonic
1000895786 5:166853936-166853958 CTTGCAATTTTGATGGAATAAGG - Intergenic
1001028783 5:168246580-168246602 ATGCCAATTTTGATGGATCATGG - Intronic
1005225051 6:23633087-23633109 ACTTTAAGTTTGATGGGACATGG - Intergenic
1007491838 6:42229094-42229116 CTTTCAACTGTGGAGGAACAGGG - Intronic
1008463993 6:51809732-51809754 ATTCCACTTTTGATGGAAAAAGG - Intronic
1009327350 6:62369548-62369570 GTTTCAACTTTGAGTTAACATGG + Intergenic
1009662001 6:66625700-66625722 ATTGCAACTTAGATGGGCCAAGG - Intergenic
1010134161 6:72530918-72530940 ATTTCTTCTATGATTGAACAAGG - Intergenic
1010665603 6:78626240-78626262 ATTTCTTCTGTGATGGGACATGG - Intergenic
1011791992 6:90908279-90908301 ATTCAAACTTGGATGGAGCAAGG - Intergenic
1012384997 6:98670336-98670358 TTTTTAACTTTGATGCACCAAGG + Intergenic
1012511286 6:100004579-100004601 ATTTAAATTTTGGTGGAGCAAGG + Intergenic
1012919920 6:105210701-105210723 ATTTCAACTTGGATGGTAGAAGG + Intergenic
1014601978 6:123424374-123424396 ACTTCAACTTTGCTGTAAAATGG - Intronic
1015681578 6:135814456-135814478 ATATCAACTTGGCTGGATCATGG - Intergenic
1018129509 6:160715764-160715786 ATTTCTCCTTTGAAGGAAAATGG - Intronic
1021278387 7:18684920-18684942 ATTTGAAATTTGAAGGAAAATGG + Intronic
1023474605 7:40563302-40563324 ATTTCACCTTTGGTAGAACATGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025596054 7:62927425-62927447 ATTTTAACTTTGAGAGATCAAGG - Intergenic
1027451552 7:78337128-78337150 AAATCAAGTTTGATGTAACATGG - Intronic
1027456271 7:78395644-78395666 ATTTCAACTTTGAATTAACTTGG + Intronic
1027483414 7:78728479-78728501 ATTCAAACTTTGATGGTACTAGG - Intronic
1028879509 7:95864446-95864468 ATTTCAACTTTCTTGCAATATGG + Intronic
1030407347 7:109130759-109130781 ATTTTAACTATGAAGGAATAAGG + Intergenic
1032841513 7:135717700-135717722 ATGTCAACTTGGGTGGACCATGG + Intronic
1034718813 7:153268585-153268607 AATTCCACTTTAATCGAACATGG - Intergenic
1037005448 8:13774092-13774114 ATCTCAACTTTGATGCAATCTGG - Intergenic
1038093976 8:24286934-24286956 ATCTCCACTCTAATGGAACAAGG + Intergenic
1039462717 8:37759513-37759535 ATTTAAACTGGGATGGGACATGG + Intergenic
1040585564 8:48737256-48737278 TTTTTAACTTTAAGGGAACATGG - Intergenic
1041620728 8:59965153-59965175 TTTTCAACTTTTATGGGAAAGGG + Intergenic
1042353239 8:67799423-67799445 ATTTCAGCTTTGAAAAAACAAGG - Intergenic
1042606423 8:70551098-70551120 ATTACAACTTTGATGGCAATTGG - Intergenic
1042834128 8:73062726-73062748 ATCTCAAATATGATGGAACTTGG + Intergenic
1042907809 8:73790822-73790844 AATTCATCTTTGATGCAACTTGG + Intronic
1043466328 8:80511494-80511516 ATTTCAATTTTGTTGAGACAGGG + Intronic
1044083351 8:87912462-87912484 ATTTCCAGTTTAAAGGAACATGG + Intergenic
1044400418 8:91764326-91764348 ATTTATGCTTTGAGGGAACAGGG + Intergenic
1045688814 8:104739376-104739398 ATTTCAGCTCTTATGGAACTTGG + Intronic
1045957377 8:107924578-107924600 ATTTAAAATTTGGTAGAACAAGG - Intronic
1046603599 8:116345816-116345838 AGTTCAACCATGATGGAAGACGG - Intergenic
1046681700 8:117177696-117177718 ATTTCAACTTGGATGGGGAAAGG + Intergenic
1047340328 8:123974863-123974885 GTTCCATCTTTGATGGAATAGGG - Intronic
1047661290 8:127039787-127039809 ATTTTAACTTTCATGGCAAAAGG - Intergenic
1047842992 8:128774671-128774693 ATTTCGACTTCAATGGCACATGG + Intergenic
1050778411 9:9298424-9298446 ATTTTAACTTTCATGGCAGATGG + Intronic
1050899653 9:10930562-10930584 ATTTCACATTTTATGTAACATGG - Intergenic
1051389271 9:16546364-16546386 ATTTCAAGTTGGATGGCAAAAGG - Intronic
1052007231 9:23362741-23362763 ATTCCAATTTTGATGGAGCTAGG - Intergenic
1053650754 9:40166638-40166660 ACTGCAACTATGATGGCACAGGG + Intergenic
1053754982 9:41297286-41297308 ACTGCAACTATGATGGCACAGGG - Intergenic
1054323037 9:63692067-63692089 ATTCCTAGTTTGATGAAACATGG - Intergenic
1054331263 9:63758410-63758432 ACTGCAACTATGATGGCACAGGG + Intergenic
1054533827 9:66209565-66209587 ACTGCAACTATGATGGCACAGGG - Intergenic
1055338806 9:75260417-75260439 ATTTCAACCTTGGTGAAACTTGG + Intergenic
1058253015 9:102725633-102725655 ATTTCAACTTTTATAGATTAAGG - Intergenic
1202789905 9_KI270719v1_random:77694-77716 ATTTCTACTTTGATGAAACCTGG - Intergenic
1202798642 9_KI270719v1_random:151334-151356 ACTGCAACTATGATGGCACAGGG + Intergenic
1187867207 X:23734577-23734599 ATTTTAACTTTCATGAAAAATGG + Intronic
1188310780 X:28613859-28613881 ATTTTAACTCTGAGAGAACATGG + Intronic
1188820231 X:34765987-34766009 ATTTGAAGTTTGCTGGACCAAGG - Intergenic
1191086292 X:56571136-56571158 AAAACAACTTTGATGGGACAGGG - Intergenic
1195027951 X:100897227-100897249 AATTCAAATTTAATGGTACAGGG - Intergenic
1196023683 X:111017049-111017071 ATATCAAAATTTATGGAACACGG + Intronic
1198385060 X:136121145-136121167 TTTTAAACTTTGATTGATCATGG - Intergenic
1199050425 X:143230758-143230780 ATGTCAACTTTGAGGAAGCAAGG + Intergenic
1199117977 X:144015132-144015154 ATTTCAACTTTTGTGGAAGACGG + Intergenic
1199516641 X:148684493-148684515 ATTTCAAGTTTGATTGATAAAGG + Intronic
1201716394 Y:17048624-17048646 ATTTCTACTTTGATGGTGCTTGG + Intergenic
1201918238 Y:19205582-19205604 ATTTTAGATTTGATGGTACATGG + Intergenic
1202017548 Y:20426801-20426823 ATTTCAGCTTTGTTCCAACAAGG + Intergenic