ID: 1091138276

View in Genome Browser
Species Human (GRCh38)
Location 11:133212469-133212491
Sequence ATGGAGCAAAGACTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 1, 3: 77, 4: 423}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091138276_1091138279 7 Left 1091138276 11:133212469-133212491 CCTTCCTCAAGTCTTTGCTCCAT 0: 1
1: 0
2: 1
3: 77
4: 423
Right 1091138279 11:133212499-133212521 TCTTCCAGAACGCCGACCCTCGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091138276 Original CRISPR ATGGAGCAAAGACTTGAGGA AGG (reversed) Intronic
901414396 1:9106612-9106634 CTTGAGCAAAGTCTTGAAGAGGG - Intronic
902294145 1:15454833-15454855 ATGGATCAAAGACTTGAACTCGG + Intergenic
902296959 1:15474230-15474252 ATGGATCAAAGACTTGAACTCGG + Intronic
902805141 1:18856316-18856338 ATTGGGCGAAGACTTGAGGGAGG - Intronic
903088280 1:20883723-20883745 AAGGAGAAAACACTTTAGGAAGG + Intronic
903379682 1:22887847-22887869 AAGGAGCAAAGGTTGGAGGATGG + Intronic
905043496 1:34978616-34978638 ATGGAGAACAGAATAGAGGAAGG - Intergenic
905226838 1:36484400-36484422 TTTGAGCAAAGACCTGAAGAAGG - Intergenic
906060759 1:42947030-42947052 ATCCAGCAAACACTTGTGGAGGG - Intronic
906380542 1:45329572-45329594 ATGGGGCAGATACTTGAGGCAGG - Intronic
906829987 1:49020849-49020871 ATGGGGCAAAGATGTGGGGAAGG + Intronic
907445841 1:54507143-54507165 ATGGAGACAAGACTGGAGGAAGG + Intergenic
907539236 1:55197155-55197177 TTTGAGCAAAGACCTGAAGAAGG - Intronic
907866188 1:58401439-58401461 TGTGAGCAAAGAATTGAGGAAGG - Intronic
908110707 1:60894636-60894658 ATGGAGCAAAGACTGGTGATAGG + Intronic
910555128 1:88523136-88523158 ACTGAGCAAAAACTTGAAGAAGG - Intergenic
910685516 1:89912196-89912218 AGGGAGGAAAGACTGGAGGCAGG - Intronic
910766462 1:90787560-90787582 CAGTAGCAAGGACTTGAGGAAGG - Intergenic
910775637 1:90872024-90872046 TTTGAGTAAAGACTTGAAGAAGG + Intergenic
911568207 1:99490201-99490223 ATGGTGCAAATTCTTGGGGAGGG - Intergenic
911582941 1:99656229-99656251 ATGGAGCAAAAATTTCAAGAGGG - Intronic
911588037 1:99713894-99713916 TTTGAGCAAAAACTTGAGGAAGG + Intronic
912201442 1:107462381-107462403 AAGAAACCAAGACTTGAGGAGGG - Intronic
912516405 1:110219269-110219291 ATGGAGATAAGAGTTGAGGAGGG - Intronic
912720930 1:112019291-112019313 CTGGAGCAAAGGCTTGAAGGAGG - Intergenic
913673447 1:121119191-121119213 AGGGAGAAAAGACTAAAGGAAGG - Intergenic
914025224 1:143906547-143906569 AGGGAGAAAAGACTAAAGGAAGG - Intergenic
914452489 1:147805087-147805109 TTGGAGCAAAAACTGGAGGGAGG + Intergenic
914663662 1:149814261-149814283 AGGGAGAAAAGACTAAAGGAAGG - Intergenic
914953224 1:152137520-152137542 TTGGAGCAAAGATCTGAAGAAGG - Intergenic
915067779 1:153240813-153240835 ATGGAGCAGAAACTGGTGGATGG - Intergenic
916045941 1:160999966-160999988 GGGGATCAAAGACCTGAGGAAGG + Exonic
916276972 1:163004922-163004944 ATGCAGGAAAGGCTCGAGGAGGG + Intergenic
916464592 1:165061583-165061605 GTTGAGCAAAGACTTGAGGGAGG + Intergenic
916541974 1:165765627-165765649 TTGGAACAAAGATTTGAAGAAGG + Intronic
916795634 1:168164792-168164814 GTGGAGGAAGGACTAGAGGAGGG + Intergenic
916831018 1:168491181-168491203 TTTGAGCAAAAACTTGAAGAAGG - Intergenic
917283868 1:173404577-173404599 TTTGAGCAAAGACTTGAAGTAGG - Intergenic
917630225 1:176884249-176884271 CTGGAGCAAAGCCATGAGGCAGG + Intronic
917887276 1:179398845-179398867 ATGGATCAAAGCCTTGTGGCAGG + Intronic
918109804 1:181445562-181445584 ATGCAGCAAAGACATGAAGTTGG - Intronic
918301707 1:183210113-183210135 ATGTAGCAGAGACTTAGGGAGGG + Intronic
919708997 1:200707668-200707690 TTTGAGCAAAGACTTGAGAGAGG + Intergenic
920492936 1:206432095-206432117 ATGGAGCTAAGACTGTAAGAAGG + Intronic
920525539 1:206663471-206663493 ATGGGGTAAAAACTGGAGGAAGG - Intronic
920680367 1:208067947-208067969 TTTGAGTAGAGACTTGAGGATGG - Intronic
920682206 1:208081927-208081949 CGGGAGCAAAGAATTCAGGAAGG - Intronic
922204035 1:223431144-223431166 ATAGAGCAAATAGTGGAGGAAGG + Intergenic
922483438 1:225955482-225955504 ATGGAGCAAAGGCTCGAGGCTGG + Intergenic
923439888 1:234007314-234007336 CTTGAGCAAAGCCTTGAAGAAGG + Intronic
923727645 1:236521349-236521371 ATTGAGTAAAGATTTTAGGATGG + Intronic
924344596 1:243062392-243062414 ATTGAGTAAAGACTTGAAGGAGG - Intergenic
1063080120 10:2760050-2760072 ACTGAGCAAAGACTTGAAGGAGG + Intergenic
1063938777 10:11106751-11106773 AAGGAGCTAACACCTGAGGAGGG + Intronic
1064727389 10:18294627-18294649 TTTGAGCAGAGACTTGAAGAAGG + Intronic
1064886042 10:20113752-20113774 ATGGAGGAAAAAATTGAGAAGGG - Intronic
1065554404 10:26900746-26900768 ACTGAGCAAAGACTTGAAGAAGG + Intergenic
1066056458 10:31685532-31685554 TTTGAGCAAAGACTTGAAGTAGG - Intergenic
1066128994 10:32371924-32371946 GTTGAGCAAAGACTTGAAGGAGG - Intronic
1066578154 10:36849175-36849197 GTTGAGCAAAGCCTTGAAGAAGG - Intergenic
1066731734 10:38442680-38442702 ATTGAGTAAAGACTTGAAGGAGG + Intergenic
1068781566 10:60924285-60924307 ATGTAACAGAGACTTAAGGATGG + Intronic
1070400531 10:76049638-76049660 ATGGAGCACAAACTCGAGGAAGG - Intronic
1070659142 10:78292540-78292562 ATGGAGCACAGACTAGTGGGGGG - Intergenic
1071455960 10:85851881-85851903 AGGGAGAAAAAAATTGAGGATGG - Intronic
1071715857 10:88094630-88094652 TTGGAGGAAAGAGTTGAGGATGG - Intergenic
1072598386 10:96898051-96898073 ATTGAGCACTTACTTGAGGATGG + Intronic
1072735255 10:97874766-97874788 ATTGAGCAAAGACTTAAAGTAGG - Intronic
1072789109 10:98304620-98304642 TTGAAGCAAAGCCTTGAAGAAGG - Intergenic
1072880421 10:99221612-99221634 AAGGAGAAAAAACTTGAGCAGGG + Intronic
1074683485 10:115934680-115934702 ATGGAGGACAGACTGGAGTAGGG - Intronic
1077724839 11:4663783-4663805 AAGGACAAAAGACTTTAGGAAGG - Intergenic
1078234373 11:9470480-9470502 TTTGAGCAAAGACTTGAAGAGGG + Intronic
1078376112 11:10794644-10794666 TTTGAGCCAAGACCTGAGGAGGG + Intergenic
1078473316 11:11609430-11609452 TATAAGCAAAGACTTGAGGAAGG - Intronic
1080494293 11:32801029-32801051 ATGGAGCCAACACTGGAGGAGGG - Intergenic
1082262024 11:50083709-50083731 ATTGAGCAAAGACTTGAAGGAGG - Intergenic
1082735673 11:56853070-56853092 TTTGAGCAAAAACTTGAAGAAGG - Intergenic
1082777027 11:57253590-57253612 ATGTAGCAAGGGCCTGAGGAAGG + Intergenic
1083275024 11:61592045-61592067 TCTGAGCAAAGACTTGAGGGAGG + Intergenic
1083691409 11:64411173-64411195 ATGGAGCTGAAACTTCAGGAAGG + Intergenic
1083796793 11:65021605-65021627 ATGGAGCAGGGCCTTGAGGAAGG + Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1086495717 11:87402623-87402645 GTTAAGCAAAGACTTGAAGAAGG + Intergenic
1086523356 11:87697306-87697328 ATGGAGCAAAGCCTTCAGGCTGG + Intergenic
1086596602 11:88579526-88579548 TTTGAGCAAGGACTTGAGGAAGG + Intronic
1087152704 11:94872823-94872845 ATGGGGGAAAGGGTTGAGGATGG + Exonic
1087612490 11:100451606-100451628 TTTGAGCAAAGACTTGAAGAAGG + Intergenic
1087727597 11:101740114-101740136 ATGGAGGATAGACTTCAGGCTGG + Intronic
1088214719 11:107495015-107495037 ATGGAGTGGAGACTTGAAGATGG - Intergenic
1088497527 11:110446583-110446605 AGGTAGGAAAGACTCGAGGAAGG - Intronic
1088559800 11:111102115-111102137 ATGGAGCCAAGAATTAAGGGAGG - Intergenic
1089001695 11:115057480-115057502 AGGGAGCAGAGACTTGAGGCAGG - Intergenic
1089493546 11:118897714-118897736 AGGGAGCAATAACTTGAAGAAGG + Exonic
1089931918 11:122321425-122321447 CTGGAGAAAAGACCTGAGGTGGG + Intergenic
1090072265 11:123554260-123554282 TTGGAGGAATAACTTGAGGAAGG + Intronic
1091138276 11:133212469-133212491 ATGGAGCAAAGACTTGAGGAAGG - Intronic
1091625876 12:2120440-2120462 AAAAAGCAGAGACTTGAGGATGG - Intronic
1092252375 12:6907043-6907065 TTTGAGCAAAGAATTGAAGAAGG + Intronic
1093024509 12:14233790-14233812 ATGGAGTAATGAGTTGTGGAGGG - Intergenic
1093410399 12:18858335-18858357 TTTGAGCAAAGACTTGAAGGAGG - Intergenic
1094299137 12:28941300-28941322 AAGGAGCACAGACTTGAGTGAGG + Intergenic
1094426560 12:30322464-30322486 AGGGAGAAAAGACTTTAAGAAGG + Intergenic
1094436865 12:30430383-30430405 ATTCAGCAAAGACTTGAAGGAGG - Intergenic
1095146064 12:38727869-38727891 TTTGAGCAGAGACTTGAGGTTGG - Intronic
1095268048 12:40182771-40182793 ACAGAGCAAAGACTAGGGGAAGG + Intergenic
1095497424 12:42799534-42799556 ATGGAGAAGTGACTGGAGGAAGG - Intergenic
1096572604 12:52532473-52532495 CTGGGGCCAAGGCTTGAGGAGGG - Intergenic
1097334700 12:58369366-58369388 ATGGAGCAAAGACAGGAGAGTGG - Intergenic
1098924901 12:76338448-76338470 GTGTAACAAAGACTGGAGGAAGG + Intergenic
1099006527 12:77240610-77240632 ATTGAGGAAAGGTTTGAGGAGGG + Intergenic
1099652627 12:85447817-85447839 TTTGAGGAAAGACTTGAAGATGG + Intergenic
1100658259 12:96669890-96669912 ATGGAGCATAAACTTGAGGATGG + Intronic
1101009508 12:100434948-100434970 AAGGAGCCAAGATTTAAGGAAGG - Intergenic
1101061556 12:100977863-100977885 ATGGAGCAAAGAGTGGTGGGAGG - Intronic
1101682587 12:106984173-106984195 AAGGAGCAAACACTTGAGAAAGG - Intronic
1101807513 12:108077307-108077329 ATGGAGCAGAGAGTTGAGGCTGG - Intergenic
1102701467 12:114843168-114843190 ATTGAGCAAACACTGGAGAAAGG - Intergenic
1103013648 12:117477184-117477206 ATGCAGAGAAGCCTTGAGGATGG - Intronic
1104463354 12:128971792-128971814 AGGGAGCAAAGAAGGGAGGAAGG - Intronic
1104463361 12:128971816-128971838 AGGGAGCAAAGAAGGGAGGAAGG - Intronic
1105318333 13:19289624-19289646 AAGGTGGAAAGACTTGAGTAGGG + Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1107305714 13:39016395-39016417 GTGGAGCCAAGACTTGAGCCTGG + Intronic
1108115057 13:47118504-47118526 TTGGAGCAAAGTCTTGAAGAAGG + Intergenic
1108786385 13:53907623-53907645 ATGGAGCAAAAAATGGATGAAGG - Intergenic
1109132710 13:58609438-58609460 TTGGAGCAAAGACTTAAAGGAGG + Intergenic
1109410923 13:61968351-61968373 ATGGACTAAAAACTTGAGTAAGG + Intergenic
1110523134 13:76504624-76504646 ATGTAGCAAAGACCTGAGTGTGG - Intergenic
1110805346 13:79747917-79747939 ATGATGCAAAGATTGGAGGATGG - Intergenic
1112037360 13:95509008-95509030 ATGGGGCAGAGACTGGAGGATGG + Intronic
1114029618 14:18566558-18566580 ATGGAGGAAAGAATAGAGCAAGG + Intergenic
1114621313 14:24098046-24098068 ATGGGACAAAGCCTGGAGGAAGG + Intronic
1114845996 14:26322688-26322710 ATGGAGAAACGACTTGACCAAGG - Intergenic
1115940919 14:38608812-38608834 GAGGAGCAGATACTTGAGGAGGG + Intergenic
1116182201 14:41549435-41549457 CTGCAGCAAAGATGTGAGGAGGG + Intergenic
1117390810 14:55260667-55260689 ATGGAGGAAATAGTTGAGAAAGG + Intergenic
1117450834 14:55848241-55848263 TGGGGGCAAAGACTTGAGCATGG - Intergenic
1117825871 14:59703026-59703048 GTGGAGCAAAGATTTAAGGAAGG - Intronic
1117858214 14:60058491-60058513 ATGAAGCAAATACTAGAGAAGGG + Intronic
1118878882 14:69809438-69809460 AGGGAGCAAAGTCTGTAGGAGGG + Intergenic
1119796078 14:77398647-77398669 ATGTAGTAAGGAGTTGAGGAGGG - Intronic
1119907936 14:78322543-78322565 ATGGAGCACAGAGTTGAGGGAGG - Intronic
1121217604 14:92260672-92260694 ATGGACAAAAGACATCAGGAAGG - Intergenic
1121832632 14:97065405-97065427 CTGAAGCCAAGACTTGGGGAAGG - Intergenic
1123170855 14:106371561-106371583 ATGGAGCTAGGACTTGAGAGAGG - Intergenic
1124918521 15:34000115-34000137 TTTGAGCAAAGATCTGAGGAGGG - Intronic
1126783638 15:52159311-52159333 ATGGAGACAACACTGGAGGAGGG + Intronic
1127027387 15:54821964-54821986 ATGGGGCAAAGCCCAGAGGAAGG + Intergenic
1127191546 15:56536608-56536630 CTGGAGTAAAGGCATGAGGAAGG + Intergenic
1127643234 15:60934798-60934820 ATGGAGCAGAGCCTGGAGGCAGG - Intronic
1127964693 15:63914788-63914810 TTTGAGCAAAGACTTGAACAAGG - Intronic
1128325784 15:66723149-66723171 ATGGAACAAAGTCATGAGGAGGG + Intronic
1128666387 15:69541058-69541080 AGGTAGAAAAGACTTGAAGACGG + Intergenic
1128773421 15:70301031-70301053 CTGGGACAGAGACTTGAGGAGGG - Intergenic
1129712100 15:77825672-77825694 ATGGAGCCTGGACCTGAGGAAGG + Intergenic
1130211216 15:81924537-81924559 AAGGAGTCAAGACTGGAGGAAGG - Intergenic
1131295330 15:91143137-91143159 ATTAAGCAAAGACTGGAGGACGG + Intronic
1131398044 15:92102506-92102528 ATGCAGCTAAGACTCAAGGAGGG + Intronic
1133227993 16:4351733-4351755 TTTGAGCAAAGATTTGAAGAAGG - Intronic
1133431625 16:5742191-5742213 AAGGAGGAAGGACTGGAGGAAGG - Intergenic
1133574185 16:7072076-7072098 AAGGAACAAAGACTAGAGAACGG - Intronic
1135055126 16:19225743-19225765 ATGTGGCAAGGAATTGAGGAAGG - Intronic
1135173656 16:20209067-20209089 ATGGGGAGAAGACTTGAGGTTGG - Intergenic
1135502491 16:23008743-23008765 ATGGAGGAAATAATTGGGGAGGG + Intergenic
1135912773 16:26576726-26576748 ATAGAGCAAAAAGTGGAGGAAGG - Intergenic
1136174182 16:28506214-28506236 AGGGACCAAAGGCTGGAGGATGG - Intronic
1136232526 16:28894995-28895017 ATGCTGCATAGACTAGAGGAAGG + Intronic
1137247152 16:46715047-46715069 ATGGTGGAAATACTTGAGGGGGG - Intronic
1137886213 16:52106616-52106638 ATGGAGGAAAGCCTTGTGCATGG + Intergenic
1138649260 16:58449436-58449458 GTGGAGCAAAGACTCGAGCCTGG - Intergenic
1139574290 16:67831519-67831541 GTGGAGGAGAGACTTGGGGAGGG - Intronic
1139778572 16:69332055-69332077 TTGGAAAAAAGACTTTAGGACGG + Intronic
1139835411 16:69834363-69834385 ATTGAGCAAAGACTAAAGGATGG - Intronic
1139933785 16:70552109-70552131 ATGGGGCAAAGAAGGGAGGAGGG - Intronic
1143299384 17:5898483-5898505 TTTGAACAAAGTCTTGAGGAAGG + Intronic
1143496696 17:7316514-7316536 TTCGAGCAAAGGCTTGAAGAAGG - Intronic
1144274946 17:13657325-13657347 TTTGAGTAAAGACTTGAGGAAGG + Intergenic
1144482794 17:15641293-15641315 ATGGTTTAAAGATTTGAGGATGG + Intronic
1146789374 17:35742857-35742879 ATGGAGCAGAGTCTGGGGGAAGG + Exonic
1147027471 17:37600477-37600499 ATGGATAAAAGACTTGTAGATGG + Intronic
1147419485 17:40315058-40315080 GGGGAGGAAAGAGTTGAGGAGGG + Intronic
1147656872 17:42096160-42096182 ATGGAGCAAGGACATGAGGCTGG - Intergenic
1147910839 17:43855068-43855090 ATGCAGCAGAGACTTGTGGGGGG - Intronic
1148287744 17:46410703-46410725 CTGGAGCAAAGGCTGGAGCATGG - Intergenic
1148309913 17:46628283-46628305 CTGGAGCAAAGGCTGGAGCATGG - Intronic
1149112585 17:53050618-53050640 ATTGAGCAAAGACTTGCAGAAGG - Intergenic
1150829037 17:68502138-68502160 ATGAAGCAAGGACATGAGTAGGG - Intergenic
1150848259 17:68680773-68680795 GTGGAGAATAGACTTTAGGATGG + Intergenic
1151598769 17:75093806-75093828 GTGGAGCACAGCCGTGAGGATGG - Exonic
1152191560 17:78891377-78891399 ATGGACCAGAGACCTGGGGAAGG - Exonic
1152211379 17:79004661-79004683 ATGGAGCAAGGAGTTAGGGAGGG + Intronic
1152211476 17:79004932-79004954 ATGGAGCAAGGAGTTAGGGAGGG + Intronic
1152514176 17:80812654-80812676 ATGGGGCCAAGACTCGAGGAGGG - Intronic
1152798451 17:82320207-82320229 ATGGAGCAAAGGCCAGAGGAGGG - Intergenic
1153106113 18:1529071-1529093 TTTTAGCAAAGACTTGAAGAAGG + Intergenic
1153473893 18:5475877-5475899 CTGTATCAAAGACTTGACGAAGG - Intronic
1153481719 18:5554048-5554070 CGGGAGCAAAGACTTGAAGTAGG - Intronic
1155738269 18:29251801-29251823 AAGGAGCAAGGAACTGAGGAAGG + Intergenic
1156310714 18:35919289-35919311 TTTCAGCAAAGACTTGAAGAGGG + Intergenic
1156471582 18:37380382-37380404 ATTGGGCAAAGACATGAGAATGG - Intronic
1156891037 18:42189494-42189516 ATGGAGCAGATCCTGGAGGAAGG + Intergenic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1159129111 18:64259914-64259936 CTGGAACAGAGCCTTGAGGATGG - Intergenic
1159261764 18:66022458-66022480 AAGGAGCAAACCCTAGAGGAAGG - Intergenic
1159331143 18:66995358-66995380 ATGGAGAAAAGTCTTAAGGCAGG + Intergenic
1159890456 18:73948502-73948524 ATTGAACAAAGATTTGCGGAGGG + Intergenic
1159964807 18:74584772-74584794 AAGCAGCTATGACTTGAGGAAGG - Exonic
1164616807 19:29672074-29672096 ATGGAGCTAAGAACTGAGCAGGG + Intronic
1166249194 19:41555039-41555061 ATGGAGCAAACAGTTGTGGTGGG - Intronic
1166787023 19:45373882-45373904 ATTGAGCAAAGAGCTGAGGGAGG - Intergenic
1166870046 19:45865411-45865433 ATGGGGGTCAGACTTGAGGAAGG - Intronic
1166952421 19:46438412-46438434 TTGGAGCAAAGACCTGAAGGAGG + Intergenic
1167281492 19:48571856-48571878 TTGGAACAAAGACTTGAAAAAGG + Intronic
1167793902 19:51696801-51696823 GTTGAGCAAAGACCTGAGCAAGG + Intergenic
1168366209 19:55790094-55790116 TTTGAGCAAAGACTTGGAGAAGG - Intronic
1202646265 1_KI270706v1_random:144798-144820 ATTGAGCAAAGACTTGAAGGAGG - Intergenic
925561446 2:5200137-5200159 AATGAGGAAAGACTTGGGGACGG - Intergenic
926624580 2:15080568-15080590 ATGGATCAAGAACTTGAGCAAGG + Intergenic
926744730 2:16141596-16141618 ATGGAGCAAATGCATGAAGATGG - Intergenic
926758514 2:16254942-16254964 ATGGAGTGAAGGCTTGAGGAAGG + Intergenic
926771558 2:16381609-16381631 CTTGAGCAAAGACTTGAAGGAGG + Intergenic
928033554 2:27801125-27801147 ATGTAGCAGAGGCTGGAGGACGG + Intronic
928124326 2:28605426-28605448 ATGGAACAAAGCCTTGGGGAAGG - Intronic
928400546 2:30975090-30975112 ATGGAGCCATGAGTTGGGGAGGG + Intronic
929065765 2:37973661-37973683 TTGGAGCAGAGACTTGAAGGAGG + Intronic
929575471 2:43049335-43049357 GTGGAGCACAGAGTTGAGCAGGG - Intergenic
929867837 2:45733614-45733636 TTTGAGCAAAGACTTGAAGGAGG + Intronic
930043267 2:47145950-47145972 CTTGAACAAAGACTTGAAGAAGG + Intronic
930214342 2:48678936-48678958 CTTGAGCAAAAACTTGAAGAAGG - Intronic
930945501 2:57068809-57068831 ATGGATTAAAGACTTGAAGAGGG + Intergenic
931918390 2:66984619-66984641 ATGTAGCAAAGTGTTGAAGAGGG + Intergenic
932085694 2:68756668-68756690 ATCCAGCAAATCCTTGAGGAAGG + Intronic
932547772 2:72732768-72732790 TTTGAGCAAAGATTTGAAGAAGG + Intronic
934509406 2:94925227-94925249 ATTGAGCAAAGACTTGAAGGAGG - Intergenic
936628254 2:114172193-114172215 ATAGAACAAAGGGTTGAGGAAGG + Intergenic
937310421 2:120899281-120899303 TAGAAGCAAACACTTGAGGATGG + Intronic
937900400 2:127015594-127015616 AGGCATCAAAGACTTGGGGAAGG - Intergenic
939054668 2:137350294-137350316 ATTGAGCCAAGACTGGATGAAGG + Intronic
940329000 2:152454623-152454645 ATGGAGCAAATACTCCAGGAAGG - Intronic
941356307 2:164497008-164497030 ATTCAGCAAGGACTTGTGGATGG - Exonic
941580902 2:167294023-167294045 CTGGAGCGCAGACTTGAGGATGG + Intergenic
942079312 2:172385228-172385250 ATGCAGCAAAGCCATGAAGAGGG - Intergenic
943708258 2:191059586-191059608 ATGTAGCAAAGACTGCAGAAGGG + Intronic
943738677 2:191387312-191387334 GGGGAACAAAGACTTGATGAGGG - Exonic
944685609 2:202114928-202114950 ATGGAGGAAAGGCTTGAGAAAGG - Intronic
946326452 2:218986888-218986910 TGGGAGCAAAGACTAGAGGTTGG + Intergenic
946703234 2:222433160-222433182 AAGAAGCTAAGACTTGAGTATGG + Intronic
946735498 2:222750438-222750460 ATGAAGCAGAGAATGGAGGAAGG + Intergenic
947214560 2:227738091-227738113 AGTAAGCAAAGAGTTGAGGAGGG - Intergenic
947479334 2:230483583-230483605 ATGGATAATAGACTTTAGGAGGG + Intronic
948143397 2:235691083-235691105 AGGGAGCAGAGTCTGGAGGAGGG - Intronic
948238388 2:236408012-236408034 AGCCAGCAAAGACTTGTGGAGGG + Intronic
948325103 2:237111225-237111247 ATAGTGCAAAGAATTGAAGAGGG + Intergenic
948555167 2:238804574-238804596 GTGAAGCAAAGAATGGAGGAGGG - Intergenic
1168889394 20:1284612-1284634 TTGGAGCAAAGACCTGAAGCAGG + Intronic
1168903497 20:1385864-1385886 TTTGAGCAAAGACTTGAAGGAGG - Intronic
1168923908 20:1564415-1564437 ATTGAGCAGAGACTTGAAGGAGG + Exonic
1169028600 20:2390779-2390801 TTTGAGCAAAGACTTGAAGAAGG + Intronic
1169084312 20:2817168-2817190 CTGCAGCATTGACTTGAGGAAGG - Intronic
1169411170 20:5371658-5371680 TTTGAGCAAAGATTTGAGGGAGG - Intergenic
1170116349 20:12864508-12864530 ATAGAGCAAAGAATGCAGGATGG - Intergenic
1170230156 20:14037665-14037687 ATGGAGCTAAGGATTGATGAAGG + Intronic
1170482173 20:16776787-16776809 ATTGGGCAAAGATTTCAGGAAGG - Intergenic
1170802902 20:19604835-19604857 ATGGAACAAAGACTGAGGGAAGG - Intronic
1171049339 20:21840663-21840685 AGGGAGCATAGACTGGCGGAAGG + Intergenic
1173465341 20:43276450-43276472 ATGGAGAACAGATTGGAGGAAGG + Intergenic
1173906819 20:46635465-46635487 TTTGAGCAAAGACCTGAAGAAGG - Intronic
1174050494 20:47764136-47764158 TTTGAGCAAAGACCTGAGGAGGG - Intronic
1174520196 20:51123437-51123459 CTGGGGCTAGGACTTGAGGATGG + Intergenic
1174945593 20:54981795-54981817 ATGAAACAAAGAGATGAGGATGG + Intergenic
1175664866 20:60849933-60849955 ATGGTGCAAAGACCTCAGTAAGG - Intergenic
1176422049 21:6523984-6524006 ATGGCGCAAAGACCTCATGACGG - Intergenic
1176605609 21:8827963-8827985 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
1177113598 21:17058712-17058734 ATGGAGAAAAGCCTAGAAGAAGG + Intergenic
1177191661 21:17858549-17858571 ACGAAGCAAAGTTTTGAGGAAGG + Intergenic
1177568306 21:22852456-22852478 ATGGAACAAAAACTGGAGAAAGG - Intergenic
1177911123 21:27033656-27033678 ATGCAGCAAGGAACTGAGGATGG + Intergenic
1179352331 21:40624014-40624036 ATGGCGATAAGTCTTGAGGATGG + Intronic
1179406833 21:41133066-41133088 AGGGAACAAACACTTGAGGAAGG - Intergenic
1179697539 21:43132299-43132321 ATGGCGCAAAGACCTCATGACGG - Intergenic
1180118177 21:45725840-45725862 ATGGAGCAAAGACCTGATGGAGG + Intronic
1180347906 22:11719567-11719589 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
1180355685 22:11837669-11837691 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
1180382569 22:12154656-12154678 ATTGAGCAAAGACTTGAAGGAGG - Intergenic
1180453734 22:15493608-15493630 ATGGAGGAAAGAATAGAGCAAGG + Intergenic
1180906832 22:19419427-19419449 ATTGAGCAAAGACCTGAAGGAGG - Intronic
1181042740 22:20200132-20200154 ATGCAGCACAGACATGAGAAAGG - Intergenic
1182989812 22:34756471-34756493 TTGGAGCAAAGACTAGAAGGAGG + Intergenic
1183016098 22:34988701-34988723 ATCAAGCAAAGACTTGTGGTAGG + Intergenic
1183151023 22:36037519-36037541 AAGGAGCAAAGACCTGAGCCTGG - Intergenic
1184764414 22:46564126-46564148 CTGGAGCTAGGAATTGAGGAAGG + Intergenic
1185307814 22:50131263-50131285 TGGGCCCAAAGACTTGAGGAAGG - Intronic
949174610 3:1044789-1044811 AAGATGCAAAGACTGGAGGAGGG - Intergenic
949472640 3:4412909-4412931 ATGAAACAAACACTGGAGGAAGG + Intronic
949749084 3:7330374-7330396 AGAGGGCTAAGACTTGAGGATGG - Intronic
950087500 3:10270641-10270663 CTGGAGCCAAGCCTAGAGGAGGG + Exonic
950148521 3:10668592-10668614 ACTGAGCAAAGACTTGAAGGAGG - Intronic
950329016 3:12141217-12141239 ATGAAGCAAAGGATGGAGGAAGG - Intronic
953837124 3:46356464-46356486 AAGGATCAAATACTTGAAGAGGG + Intronic
954220655 3:49151698-49151720 AGGGAGCACAGAGGTGAGGAGGG + Intergenic
954335705 3:49916039-49916061 ATGGAGCAAACACTGCAGGCAGG + Intronic
955088808 3:55729349-55729371 TTGGAGCAAGGACTTGAAGGTGG - Intronic
955430148 3:58835098-58835120 ATGGATGAAAGACTGGAAGAAGG - Intronic
957252533 3:77792229-77792251 ATTCAGCAAAGACCTGTGGAAGG + Intergenic
957464759 3:80573194-80573216 ATTGTGCAAAGACTGCAGGAGGG + Intergenic
959663823 3:108899618-108899640 ATGGAGCAAAAGCTTGATGGAGG + Intergenic
960185648 3:114634918-114634940 TAGGAGCAAAGAAATGAGGAGGG + Intronic
962129298 3:132655581-132655603 ATTCAGCAAAGACTTGAAGGGGG - Intronic
963631997 3:147745042-147745064 TTTGAGCAAATACTTGAGGGAGG + Intergenic
966574934 3:181490035-181490057 TTTGAGCAAAGACTTTAAGATGG - Intergenic
967671973 3:192247167-192247189 ATGGTGCTAAGACTTGCTGATGG + Intronic
967805624 3:193712312-193712334 TTGGACCAAAGACTTGAGTGAGG + Intergenic
967842655 3:194019246-194019268 CTGGAGGAGGGACTTGAGGAAGG - Intergenic
969397491 4:6932058-6932080 TTGAAGCAAAGACTTGAAGGTGG + Intronic
969694291 4:8725946-8725968 CTGGAGCAAAGCCGTGTGGAGGG + Intergenic
970322047 4:14884503-14884525 ATGGAGAATAGATTGGAGGATGG - Intergenic
970807083 4:20049483-20049505 ATGGAACAAAGAATAGGGGATGG + Intergenic
971095099 4:23391696-23391718 ATGGAACAAAGACCTAGGGAAGG + Intergenic
971396646 4:26234508-26234530 TTTGAGCAAAGACTTGAACAAGG - Intronic
972635573 4:40881242-40881264 AGGGAGAAAAGTCTTCAGGAAGG - Intronic
973372501 4:49263026-49263048 ATTGAGCAAAGACTTGAAGGAGG - Intergenic
973388502 4:49532115-49532137 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
974814911 4:66991519-66991541 ATGAAGCAAAGAAATAAGGAAGG - Intergenic
975441569 4:74417240-74417262 AAGGAGCAAAGAAGTGAGGTTGG + Intergenic
976261396 4:83148396-83148418 ATAGAGCACTGACTTGAGAAGGG - Intergenic
976505928 4:85847567-85847589 AAGGAGCAAAGGCCTAAGGAAGG + Intronic
976673874 4:87683239-87683261 ATGTGGCAAAGAATTGAGGGTGG - Intergenic
977011990 4:91647861-91647883 TTTGAGCAAAGACTTGAAGGAGG + Intergenic
977138075 4:93331348-93331370 ATTGAGCAAAGACTTGAAAGAGG - Intronic
978839226 4:113190101-113190123 ATGGAGCAAAGGGTTTAGAATGG - Intronic
979258120 4:118625307-118625329 ATTGAGTAAAGACTTGAAGGAGG + Intergenic
979330226 4:119415261-119415283 ATTGAGTAAAGACTTGAAGGAGG - Intergenic
980458050 4:133070387-133070409 ATGGAGCAAAGGGTTAGGGAAGG + Intergenic
980487168 4:133473733-133473755 ATGGAGAATGAACTTGAGGAGGG - Intergenic
980868731 4:138585819-138585841 GTAGAGCAAAGACTTGTAGAAGG + Intergenic
981966925 4:150615035-150615057 TTTGAGCAAAGACTTGAAGGAGG + Intronic
982397514 4:154927940-154927962 ATGGGGCAGAGACTTTAGGGAGG + Intergenic
982874755 4:160632989-160633011 AGAGAGCAAAAACTGGAGGATGG - Intergenic
983988062 4:174084186-174084208 AGGGAGCAAACATTTGAGGGAGG - Intergenic
986346894 5:6844080-6844102 ATGGAGCAAGAGGTTGAGGAAGG + Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
988524174 5:31972008-31972030 ATTGAATAAAGACTTGAAGAAGG - Intronic
989185526 5:38621635-38621657 ATGGAGCTGAGATATGAGGAAGG - Intergenic
989633855 5:43513837-43513859 ATGAAGAAAAAACTTGAAGAGGG - Intronic
990707762 5:58549191-58549213 AAGAAGCAAAGCCTTAAGGATGG + Intronic
991020183 5:61972082-61972104 CTGGAACAAAGTCTTGTGGAAGG - Intergenic
991091343 5:62696576-62696598 GTGGAGCAAAGAATGAAGGATGG - Intergenic
993434960 5:87881618-87881640 ATGGAGCCTGGACTTGAAGAAGG + Intergenic
993539992 5:89137370-89137392 ATGGAGCACGGACTGAAGGATGG + Intergenic
993850890 5:93007213-93007235 TTGGAGCAAAAACTTAAGTAGGG + Intergenic
995787424 5:115844452-115844474 TTTGAGCAAAGACTTGAAGGAGG + Intronic
996220889 5:120931911-120931933 ATGGAGCAAAGACCACAGGACGG + Intergenic
998138023 5:139684667-139684689 ATGGAGGCTAGACTTCAGGAAGG + Intergenic
998798478 5:145843675-145843697 AAGGAGCACAGCTTTGAGGAGGG + Intergenic
999538909 5:152550114-152550136 CTGAAGCAAAAACTTGAAGAAGG - Intergenic
1000441702 5:161271483-161271505 ATGAAGGAAAGAGTAGAGGAAGG + Intergenic
1000940975 5:167359346-167359368 ATGGTGCAAAGATCTCAGGAAGG - Intronic
1001420729 5:171585099-171585121 ATGAAGGACAGACTTGAGCAAGG + Intergenic
1001483049 5:172101771-172101793 TTAGAGCAATGACTTGAAGAGGG + Intronic
1001629946 5:173167721-173167743 TTTGAGCAAAGACTTGAGGCAGG + Intergenic
1001663761 5:173415872-173415894 TTGGAGCAGAGACTTGAAGCGGG + Intergenic
1002144867 5:177172031-177172053 ATACAGCAAAGACTTAAGAAAGG - Intronic
1003237298 6:4307220-4307242 ATTGAATAAAGAATTGAGGAAGG + Intergenic
1003588714 6:7418308-7418330 TTTGAGCAAATACTTGAAGAAGG + Intergenic
1003989279 6:11469859-11469881 AAGGAGCAAAAACATGAGCATGG + Intergenic
1004207517 6:13606164-13606186 TTGGAGCAAAGACTTGAAGGAGG + Intronic
1004349925 6:14882151-14882173 AGGGAGCAAAGACCAGAGGAAGG + Intergenic
1006510282 6:34517644-34517666 TTGGAGCAAAGGCCTGAGGAAGG - Intronic
1006707943 6:36038196-36038218 ATTGAGCAAAAACCTGAAGAAGG + Intronic
1006974345 6:38084072-38084094 ATGGAGCCAAGACTTGGACACGG + Intronic
1007153333 6:39717448-39717470 TTTGAGCAAAGACTTGATGGAGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007707635 6:43800504-43800526 TTTGAGCAAAGACTTGAAGAAGG - Intergenic
1008145951 6:47891550-47891572 ATGGAGAAAATACTAGAGTAAGG - Intronic
1008951859 6:57170637-57170659 CTTGAGCAAAGACCTGAAGAAGG + Intergenic
1009405936 6:63312900-63312922 AAAAAGCAAAGACTTGAGAAAGG + Intronic
1009990583 6:70838550-70838572 TTGGAGCAAAGAGGTGAAGAAGG + Intronic
1010535938 6:77030464-77030486 ATTGAGCAAAGCATTGAGGCAGG + Intergenic
1011326427 6:86153365-86153387 ATGGAGTAAAGACGTTAAGAAGG + Intergenic
1011396829 6:86919142-86919164 GAGGAGAAAACACTTGAGGAGGG - Intergenic
1012416213 6:99016822-99016844 TTTGAGCAAAGACTTGAAGGAGG - Intergenic
1013004594 6:106060566-106060588 ATGGATCATAGACTTGAAGCTGG + Intergenic
1013087778 6:106871196-106871218 ATGTAGCAAAGTCTTGCAGATGG - Intergenic
1014112667 6:117637151-117637173 TTTGAGCAAAGACTGGAAGAAGG + Intergenic
1014846855 6:126288260-126288282 ATGGAACAAAGAAGTGAAGAGGG - Intergenic
1015034512 6:128637111-128637133 ATTCAGAAAAGACTTCAGGAAGG - Intergenic
1015810761 6:137159807-137159829 TTTGAGCAAAGACTTGAAGGAGG - Intronic
1015885129 6:137910081-137910103 AAGAAGAAAAGAATTGAGGAAGG - Intergenic
1016411738 6:143790418-143790440 AAGGAGCAGACCCTTGAGGACGG + Intronic
1016710742 6:147168856-147168878 AGGGAGGAAAGACTTGGGGATGG - Intergenic
1017944651 6:159085525-159085547 ATGGAAAAAAGACCAGAGGAAGG - Intergenic
1019031123 6:169013438-169013460 ATGGATTAAAGACTTAAAGATGG - Intergenic
1019062373 6:169265673-169265695 GTGGAGGAAGCACTTGAGGAAGG + Intergenic
1019157831 6:170050908-170050930 AGGAAGGAGAGACTTGAGGAGGG - Intergenic
1019191328 6:170252673-170252695 ATGGAGCAAAGGCTGGAGAAAGG - Intergenic
1021110840 7:16692863-16692885 TTGGTGTAAAGACTTGAGGGAGG + Intronic
1021499955 7:21321263-21321285 GTGGAGCAGAGACTTGAAGTGGG - Intergenic
1023365907 7:39463277-39463299 ATGTAGCAAAGAATTGCTGATGG + Intronic
1023400105 7:39786600-39786622 ATTGAGTAAAGACTTGAAGGAGG + Intergenic
1023831171 7:44039735-44039757 GAGTAGCAAAGACTTGGGGAGGG - Intergenic
1024073034 7:45802350-45802372 ATTGAGTAAAGACTTGAAGGAGG + Intergenic
1024463839 7:49687716-49687738 ATACAGAAAAGACTTGTGGATGG + Intergenic
1024525296 7:50343271-50343293 ATGGAGAAAAGAAGAGAGGAAGG - Intronic
1024650299 7:51397834-51397856 ATTGAGTAAAGACTTGAAGGAGG - Intergenic
1025054442 7:55753487-55753509 ATTGAGTAAAGACTTGAAGGAGG - Intergenic
1025132494 7:56383639-56383661 ATTGAGTAAAGACTTGAAGGAGG - Intergenic
1025183542 7:56838069-56838091 ATTGAGCAAAGACTTGAAGGAGG - Intergenic
1025688384 7:63738898-63738920 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
1025978152 7:66385884-66385906 ATTGAGCAAAGACTTGAAGGAGG - Intronic
1026056230 7:66986154-66986176 CTGGAGCAAATACTTGTGTATGG + Intergenic
1026146840 7:67753921-67753943 ATTGCACAAAGACCTGAGGAGGG + Intergenic
1027203731 7:76080551-76080573 ATTAAGCAAAGACTTGAAGGAGG - Intergenic
1027929201 7:84509286-84509308 ATGAGGCAAAGAATTGAGGGTGG - Intergenic
1028213196 7:88100841-88100863 GTGGAGTAAAGATTGGAGGAGGG + Intronic
1028213977 7:88109243-88109265 AGGAAGCAAGGCCTTGAGGAAGG - Intronic
1029741499 7:102494041-102494063 GAGTAGCAAAGACTTGGGGAGGG - Intronic
1029759491 7:102593210-102593232 GAGTAGCAAAGACTTGGGGAGGG - Intronic
1029776858 7:102689120-102689142 GAGTAGCAAAGACTTGGGGAGGG - Intergenic
1030980895 7:116184337-116184359 ATGGATTAAAGACTTAAGTAGGG - Intergenic
1031621522 7:123939380-123939402 ATTGAATAAAGACTTGAGGCCGG - Intronic
1032050421 7:128646045-128646067 ATTGAGTAAAGACTTGAAGGAGG + Intergenic
1032150663 7:129426811-129426833 ATGGGGAAAGGAATTGAGGAAGG - Intronic
1032474330 7:132202113-132202135 ATGGAGCAAAGACCTGGGGGAGG - Intronic
1032785475 7:135196535-135196557 GTGGAGCAAAGTCTCCAGGAAGG - Intronic
1033014140 7:137654478-137654500 ATGAACCAGAGACTAGAGGAAGG - Intronic
1033411252 7:141119701-141119723 ATGGAGGAAAGGCTGGAGAAGGG + Intronic
1035094210 7:156340458-156340480 ATGGAGGAAACCCTTGAGGATGG - Intergenic
1035528177 8:330942-330964 TAGGAGCAGGGACTTGAGGAAGG + Intergenic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1036138690 8:6186197-6186219 ATGGAGCAATGACATGAGAGAGG + Intergenic
1036487396 8:9191879-9191901 ATAAAGCAAGTACTTGAGGATGG - Intergenic
1039185775 8:34914357-34914379 ATTGTGAAAAGACTTGAGGTTGG - Intergenic
1039719908 8:40152034-40152056 ATTGTGCAAAGACTTGAAGGTGG - Intergenic
1039901453 8:41755714-41755736 ATGCAGCAAAGCCTGGAGGCAGG - Intronic
1040675873 8:49749587-49749609 AAGGAGCAAAGAAGTGAGGGAGG + Intergenic
1041145302 8:54870027-54870049 CTGGAGCAAACACCTGGGGAGGG + Intergenic
1041300352 8:56405025-56405047 ATGAAGCAGAGACTTGAGGCAGG - Intergenic
1041469617 8:58194018-58194040 ATGGAGAAAGGATTAGAGGAAGG + Intronic
1041764882 8:61408443-61408465 ATGTAGTAAAGACTTGGGGCAGG - Intronic
1041821355 8:62037571-62037593 TTGGAGAAAAGACTTGTGAAAGG + Intergenic
1041821454 8:62039045-62039067 TTGGAGAAAAGACTTGTGAAAGG + Intergenic
1041963127 8:63642933-63642955 TTGTACCAAAGCCTTGAGGATGG - Intergenic
1043488636 8:80724826-80724848 ATGGAGCAGAGACTAGGGCAGGG - Intronic
1043843254 8:85134094-85134116 ATGGAGCAATGACTGGAAGGAGG - Intronic
1044598503 8:93981064-93981086 ATGGAGACAAGACCTGGGGAGGG + Intergenic
1045194627 8:99917899-99917921 ATGGATCAAAGACTTAAAGGTGG + Intergenic
1045345753 8:101292091-101292113 ATGGAGCAGAGACAAGAGGATGG + Intergenic
1045479946 8:102583760-102583782 ATGCAGCAAGGGGTTGAGGAAGG - Intergenic
1045555550 8:103211594-103211616 AATGAGCAAACATTTGAGGAAGG - Intronic
1045829552 8:106442256-106442278 ATGAAGCCAAGACTTGATCATGG + Intronic
1046564552 8:115882597-115882619 TTGGAGCAAAGACCTGAAAAAGG + Intergenic
1046705341 8:117443373-117443395 AAGTAGCCAAGACTTGAGGCAGG - Intergenic
1048339825 8:133529847-133529869 GATGAGCAGAGACTTGAGGAAGG - Intronic
1049416853 8:142499271-142499293 CGGGAGCCAAGACTAGAGGAGGG - Intronic
1050021030 9:1284733-1284755 ATGGAGGAATGACATGTGGATGG + Intergenic
1051571737 9:18566554-18566576 TTTGAGCAAAGACTTGATAAAGG + Intronic
1051708949 9:19910403-19910425 ATGGAGCTAAAACTAGAGGCAGG - Intergenic
1053446512 9:38157246-38157268 ATGCAGGAAAGAGATGAGGATGG - Intergenic
1053656026 9:40219039-40219061 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
1053906373 9:42848241-42848263 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
1054352395 9:64029069-64029091 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
1054368132 9:64365263-64365285 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
1054528588 9:66157256-66157278 ATTGAGCAAAGACTTGAAGGAGG - Intergenic
1054675753 9:67855006-67855028 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
1055367214 9:75557369-75557391 ATGGAACAGAGAATTGAGAAGGG + Intergenic
1055524816 9:77121300-77121322 ATGGAGCAAAGATTAGCAGAGGG + Intergenic
1055736020 9:79331523-79331545 GTGGAGCTGAGACTTGAGCATGG + Intergenic
1055865349 9:80806803-80806825 ATTGAGCAAAAACTTTAGAAAGG - Intergenic
1056344697 9:85679933-85679955 ATGAAGCAAAGATTTAAGCATGG - Intronic
1056675275 9:88671513-88671535 CTGCAGCAAGGCCTTGAGGATGG - Intergenic
1057372960 9:94490615-94490637 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
1058032128 9:100211613-100211635 ATGGAGCCAAGGCTTGGAGAAGG + Intronic
1058280166 9:103103811-103103833 ATGGAGAGAAGACCTGAGGTAGG - Intergenic
1058653511 9:107198795-107198817 ATGGGGCTAAGACGTGAGGGTGG - Intergenic
1058742234 9:107955268-107955290 TTGGAGCAAAGACTTGAAGTTGG + Intergenic
1058985860 9:110207852-110207874 AAGGGGGAAAGACTGGAGGAAGG + Exonic
1059697262 9:116741123-116741145 AGGCAGCAAAGACCTGAGGAAGG - Intronic
1059771395 9:117429798-117429820 ATGGAGCAGAAAGTTGAGGAAGG + Intergenic
1061244685 9:129395387-129395409 ATGGAGGATAGACAGGAGGATGG + Intergenic
1061519111 9:131107132-131107154 ATTGAGCAAAGGCTTGAAGTTGG + Intronic
1203553002 Un_KI270743v1:179971-179993 ATTGAGCAAAGACTTGAAGGAGG + Intergenic
1185862885 X:3595464-3595486 TTTGAGCAAAGAGTTGAAGATGG + Intergenic
1186311707 X:8326794-8326816 ATGGAGAAAAGAGTAGAGGATGG - Intergenic
1186615981 X:11188491-11188513 ATGGAGCAAAGATGTGACAAAGG + Intronic
1186622021 X:11251425-11251447 AGAGAGGAAAGAATTGAGGATGG - Intronic
1186744367 X:12551926-12551948 ATGTAACAAAGAGTTGATGAGGG - Intronic
1188056285 X:25544469-25544491 ATGGAGGAAGGACTAAAGGAAGG - Intergenic
1189776410 X:44473742-44473764 ATGCAGCAAAGCTTGGAGGATGG + Intergenic
1192595926 X:72408339-72408361 ACTGAGCAAAGACTTGAAGGAGG + Intronic
1193980461 X:88175908-88175930 AAGCAGCAAAAACTTTAGGAGGG - Intergenic
1194197121 X:90908008-90908030 ATGGAGCAAAGAAAAGATGATGG + Intergenic
1195366875 X:104135069-104135091 AGGGAGGAAAGAGTTCAGGAGGG - Intronic
1196776791 X:119345420-119345442 GTTAAGCAAAGACTTGAAGAAGG - Intergenic
1197214633 X:123856626-123856648 ATTAAGCAAAGACTTGAAGGAGG + Intergenic
1198443272 X:136685205-136685227 ACGGAGACAGGACTTGAGGAGGG - Intronic
1198864040 X:141101987-141102009 ATGAATCAAAGTCTTGAAGAAGG - Intergenic
1198898649 X:141485428-141485450 ATGAATCAAAGTCTTGAAGAAGG + Intergenic
1199412676 X:147542938-147542960 TTTGAGCAAAGATTTGAAGATGG + Intergenic
1200542975 Y:4482211-4482233 ATGGAGCAAAGAAAAGATGATGG + Intergenic
1200800585 Y:7383593-7383615 TTTGAGCAAAGAGTTGAAGATGG - Intergenic
1201154281 Y:11115626-11115648 ATTGAGCAAAGACTTGAAGGAGG + Intergenic