ID: 1091142232

View in Genome Browser
Species Human (GRCh38)
Location 11:133245042-133245064
Sequence CAGGGAAATCATGAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 689
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 639}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091142232_1091142239 17 Left 1091142232 11:133245042-133245064 CCATCTTCCTCATGATTTCCCTG 0: 1
1: 0
2: 3
3: 46
4: 639
Right 1091142239 11:133245082-133245104 GTCTGCCATTGTGTAAAAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 159
1091142232_1091142238 14 Left 1091142232 11:133245042-133245064 CCATCTTCCTCATGATTTCCCTG 0: 1
1: 0
2: 3
3: 46
4: 639
Right 1091142238 11:133245079-133245101 TGAGTCTGCCATTGTGTAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 151
1091142232_1091142241 26 Left 1091142232 11:133245042-133245064 CCATCTTCCTCATGATTTCCCTG 0: 1
1: 0
2: 3
3: 46
4: 639
Right 1091142241 11:133245091-133245113 TGTGTAAAAGGTGGACTTCAAGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091142232 Original CRISPR CAGGGAAATCATGAGGAAGA TGG (reversed) Intronic
900631039 1:3635469-3635491 CAGTGAGAGCATGAGGAAAAAGG + Intronic
900684395 1:3938883-3938905 CAGGGACCTCATGTGGAAAATGG - Intergenic
901527255 1:9831380-9831402 GAGGGAAAGCCTGAGGCAGAAGG + Intergenic
902040489 1:13488945-13488967 TAGGGAAATCATGAAGAATGTGG + Intronic
903286099 1:22277712-22277734 CTGGGAAAGCATGGGCAAGACGG + Intergenic
904634301 1:31867772-31867794 GAGGGTGATCATGACGAAGAAGG - Intergenic
906208764 1:44000755-44000777 CAGGGAACTCACGAAGATGATGG + Exonic
907645169 1:56235175-56235197 CAGGGGAATCATGGGGAACTAGG + Intergenic
907646089 1:56244994-56245016 CAGGGCAATCAGGCGGGAGAGGG - Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908805074 1:67922117-67922139 CAGGGAAACCAAGAGGTTGATGG + Intergenic
910336097 1:86133345-86133367 CAGGGCAATCATGCAGGAGAAGG - Intronic
910813555 1:91263943-91263965 TAGGTAAATCATAAGGAGGAAGG - Intronic
910924405 1:92383758-92383780 CAGGGAAATCAGGCAGGAGAAGG - Intronic
911727845 1:101260987-101261009 CAAGGAAATCACAAGGAAGAAGG - Intergenic
911873822 1:103133446-103133468 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
912167323 1:107056770-107056792 GAGGGAACTGAAGAGGAAGATGG + Exonic
912209496 1:107543002-107543024 CATGGGAATCATTAGGAAGCAGG + Intergenic
912228783 1:107767934-107767956 CTGGTAAATCATAAGGAAGTAGG + Intronic
912581262 1:110723016-110723038 CAGGGAAGAAATGAGTAAGAAGG - Intergenic
912744977 1:112238644-112238666 GAAGGAAATGAGGAGGAAGATGG - Intergenic
913441496 1:118903072-118903094 CAGGGAAAAAATGAGCAAGAGGG - Intronic
914329818 1:146656639-146656661 GAGGGAAATGATGAGGAAAAAGG + Intergenic
914814965 1:151056576-151056598 GAGGGAAATCAGGAGGAATAGGG - Intronic
915327174 1:155086512-155086534 CAAGAACGTCATGAGGAAGAAGG - Exonic
915460634 1:156068594-156068616 CTGGGAAATCCTGAGGAAGAGGG - Intronic
915809341 1:158890113-158890135 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
915919303 1:159962210-159962232 AAGGGAAAACATGGGGTAGAGGG + Intergenic
916269231 1:162921948-162921970 CAGGAAAACCCTGAGGAAGTTGG + Intergenic
916748954 1:167706747-167706769 CAGGGAACTCATGAAGTACAGGG + Intergenic
917189527 1:172400137-172400159 GGAGGAAATCAGGAGGAAGAAGG - Intronic
917562095 1:176168820-176168842 AAGGGAAGTCAGGAGGAAGAGGG + Intronic
918139731 1:181710170-181710192 AGGGGAGATCATGAGGCAGAGGG - Intronic
918817792 1:189211529-189211551 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
919544496 1:198897581-198897603 CAGGGAAATCATCACAAAGGAGG - Intergenic
919567547 1:199207629-199207651 CAAGGAAATCATGAAAGAGATGG - Intergenic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
920565133 1:206967059-206967081 CAGGCACAGTATGAGGAAGAGGG + Exonic
920713406 1:208316843-208316865 GAGGGAAAATATGGGGAAGATGG + Intergenic
920716760 1:208347358-208347380 AAGGGTTATCATAAGGAAGATGG - Intergenic
920861395 1:209710536-209710558 AAGAGAAATGATGAGGAAGTTGG - Intronic
921115299 1:212084575-212084597 AAGGGAAACTATGAGGCAGAGGG - Intronic
921305766 1:213795149-213795171 CAGAGAAATCAATAGGTAGATGG - Intergenic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
921739054 1:218662948-218662970 CAGGGATTTCATGAGGATGATGG - Intergenic
922374008 1:224942498-224942520 CAGGGCAATCAGGCAGAAGAAGG - Intronic
922633612 1:227140949-227140971 CAGGGAAATCAGGAGGGATCAGG + Intronic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
923559980 1:235031640-235031662 GAAAGAAATCATGAAGAAGAAGG + Intergenic
924377845 1:243431622-243431644 CAGGGAATTCATGTTAAAGATGG + Intronic
924859832 1:247909862-247909884 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063039822 10:2325734-2325756 CATGAAAATCATGAAGAATATGG - Intergenic
1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG + Intronic
1064249287 10:13694464-13694486 CAGGCAGATAAGGAGGAAGAGGG - Intronic
1064921820 10:20527707-20527729 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1064962258 10:20978201-20978223 CAGGGAAGTGTTGGGGAAGATGG - Intronic
1065121189 10:22531819-22531841 CAGGGAAAGAATTAGGAAAATGG + Intergenic
1065418623 10:25517365-25517387 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1065698258 10:28400470-28400492 CAGGGAGATAAAGAGGAACAGGG + Intergenic
1066608756 10:37212016-37212038 CAGGGCAATCATGCAGGAGAAGG + Intronic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067768343 10:49106557-49106579 CAAGAAATTCATGAGGAAGTGGG - Intronic
1067976486 10:51031527-51031549 ATGGGAAAGAATGAGGAAGAAGG + Intronic
1069062787 10:63911893-63911915 TAAGGAACTCATGAGGAATATGG - Intergenic
1069106408 10:64388053-64388075 CAGGCATATTATGAGGAAGCAGG - Intergenic
1069273869 10:66565558-66565580 TAGGGAAAACCTGAGGCAGAGGG + Intronic
1069403785 10:68076688-68076710 CAGGGAAAACAAGGTGAAGAGGG - Intergenic
1070105048 10:73423794-73423816 CAGGGAAGTCATTGGGAACATGG - Exonic
1070605484 10:77895265-77895287 AAGGGAAATCCTGGGGAGGAAGG - Intronic
1070749291 10:78954535-78954557 CAGGGAAAGCATGGCGGAGATGG - Intergenic
1071074966 10:81739049-81739071 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
1071101740 10:82046562-82046584 CAGGGAAATTAGGCAGAAGAAGG - Intronic
1072144604 10:92623346-92623368 CAGAGAAAACAAGGGGAAGAAGG + Intronic
1072529520 10:96305872-96305894 AAGAGAAATCAGGTGGAAGAAGG - Intronic
1073024966 10:100481223-100481245 GAAGAAAATCATGCGGAAGATGG + Intronic
1074179608 10:111047271-111047293 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1074241230 10:111641226-111641248 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1074697580 10:116064525-116064547 CAGGGTAATTATGAAAAAGAAGG - Exonic
1075055587 10:119215955-119215977 CTGGGAAGACATCAGGAAGAAGG + Intronic
1075491161 10:122870933-122870955 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1075787581 10:125060645-125060667 CAGGGCAGTCATGCGGAAGAGGG + Intronic
1076227482 10:128791951-128791973 CAGGGAAATAATAAGAAATATGG + Intergenic
1077683227 11:4266505-4266527 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1077686808 11:4300256-4300278 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1077691967 11:4351446-4351468 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1077697006 11:4402800-4402822 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1077710906 11:4535885-4535907 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1077946806 11:6908712-6908734 CAGGGAAATCAAGCAGGAGAAGG + Intergenic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079339094 11:19597437-19597459 CAGGGAAGTCAGTAGTAAGATGG - Intronic
1079390037 11:20014214-20014236 CAGGGTGATAATGAGGGAGAGGG - Intronic
1079784737 11:24657574-24657596 CAGGGCAATCATGCAGGAGAAGG + Intronic
1080169994 11:29289089-29289111 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1080211281 11:29788418-29788440 CAGGGAAATTAGGCAGAAGAAGG + Intergenic
1080212155 11:29798609-29798631 CAGGGCAATCATGCAGGAGAAGG + Intergenic
1080291662 11:30677931-30677953 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1080398160 11:31908972-31908994 CAGGGAAATCAGGCAGGAGAAGG + Intronic
1080721731 11:34855814-34855836 CAGGGAAATAAGGAGCAAAATGG - Intronic
1080874699 11:36265131-36265153 CAGTGACAGGATGAGGAAGAAGG - Intergenic
1082124097 11:48412048-48412070 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1082135441 11:48543899-48543921 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1082150945 11:48738025-48738047 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1082273336 11:50195735-50195757 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1082741870 11:56919718-56919740 CAGGGCAATCAAGCGAAAGAAGG + Intergenic
1083021414 11:59511213-59511235 CAGAGAAAAAATGAGAAAGAGGG + Intergenic
1083333761 11:61911367-61911389 CCTGGAAATGAGGAGGAAGAGGG - Intronic
1083407520 11:62468594-62468616 CTGAGAAATCAGGAGAAAGAGGG + Intronic
1085122564 11:73976621-73976643 CAGGTGAGTCATGAGGTAGACGG - Exonic
1087487160 11:98770763-98770785 AAGGGAGACCATGGGGAAGAGGG + Intergenic
1087498734 11:98923655-98923677 GAGGGAAAGGAAGAGGAAGAAGG - Intergenic
1088238343 11:107749034-107749056 GAGGGAAATTAGGAGGATGAAGG + Intergenic
1088318382 11:108530455-108530477 CAGGGAAGGCAATAGGAAGATGG + Intronic
1088379663 11:109179491-109179513 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1088392617 11:109331580-109331602 CAGAGAAATCATGAGGACTAAGG + Intergenic
1088960424 11:114658440-114658462 CTGGGCACTCATGAGAAAGATGG + Intergenic
1089303444 11:117512452-117512474 CAGGGAAAAAATGGGGATGAGGG + Intronic
1090132533 11:124159705-124159727 GAGGGAAATGAAGAGGAGGAGGG - Intergenic
1090609080 11:128454027-128454049 AAGGGAAACCATAAGGAAGAAGG - Intergenic
1090716814 11:129438442-129438464 CAGGCAAAAGAAGAGGAAGAAGG - Intronic
1090904966 11:131066950-131066972 CAGAGAAATCATTGTGAAGAGGG - Intergenic
1091052679 11:132387552-132387574 CAGGGCAATCATGCAGGAGAAGG + Intergenic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091191504 11:133699288-133699310 CCTGAATATCATGAGGAAGACGG - Intergenic
1091719681 12:2803628-2803650 GAGGGAAAGGATGAGGAAAACGG - Exonic
1091916414 12:4274003-4274025 CGGGGAAAGCAGGAGGGAGAGGG + Exonic
1092749922 12:11709228-11709250 CAGGGGTAGAATGAGGAAGAAGG - Intronic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1093937339 12:25015666-25015688 CAGGAAATTAATGAGGGAGAAGG - Intergenic
1094383824 12:29872405-29872427 GAGGGAAAGAATGTGGAAGAAGG + Intergenic
1094423037 12:30292289-30292311 CAGGGCAATCATGCAGGAGAAGG + Intergenic
1095244969 12:39908833-39908855 TATGAAAAGCATGAGGAAGATGG + Intronic
1095629177 12:44354286-44354308 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1095912432 12:47442299-47442321 CATGAAAATGCTGAGGAAGAAGG + Intergenic
1097757276 12:63420442-63420464 AAGGGAACTCTAGAGGAAGAGGG + Intergenic
1097840610 12:64318004-64318026 CATGGAAGTCATGAAGAAGGAGG - Intronic
1097956921 12:65495699-65495721 CAGGGCAGTCAAGAGGAAGTGGG - Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098306028 12:69103518-69103540 CAGGGAACTTCTTAGGAAGATGG - Intergenic
1098357544 12:69625935-69625957 CATGGAAGGCATGAGGAATAGGG + Intergenic
1098372504 12:69775406-69775428 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1098590948 12:72211267-72211289 AAGGCAAACCATGAGGATGAAGG + Intronic
1098747509 12:74258728-74258750 CTGAGAAATCATGGGGAAAAAGG - Intergenic
1099669830 12:85675593-85675615 AAGGGAAATGATAGGGAAGAAGG + Intergenic
1099760882 12:86919003-86919025 CAGGGCAATCATGCAGAAGAAGG + Intergenic
1099981888 12:89613679-89613701 CAGGGAAACAATGAGTAAAAGGG + Intronic
1100691319 12:97041203-97041225 CAGTGAAATCATGAGTATCAGGG + Intergenic
1100709681 12:97242409-97242431 CTAGGAAAGCATGAAGAAGAAGG - Intergenic
1101124643 12:101619309-101619331 AAGAGAAATCAGGAGAAAGAAGG - Intronic
1101391736 12:104307103-104307125 CAGTAAAATGATGAGGATGATGG + Intronic
1101727915 12:107403295-107403317 CAGGGATATTATAATGAAGAAGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104277134 12:127339915-127339937 AAGGGCCATCATGTGGAAGATGG - Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1105537913 13:21287403-21287425 GAGGGAAATCAGGAGAAATAGGG + Intergenic
1106287890 13:28334110-28334132 CAGGCAAATCACTTGGAAGAGGG - Exonic
1106869165 13:34000378-34000400 AAAGGAAATCATGAGGAGGAAGG - Intergenic
1107166893 13:37292869-37292891 CAGGGAAATTTTGAGAAAAAAGG + Intergenic
1107384528 13:39893802-39893824 CAGAGACACCAAGAGGAAGACGG - Intergenic
1107566384 13:41609701-41609723 CATGGAGATCCTGAGAAAGATGG - Intronic
1107877386 13:44802757-44802779 CTGGGAAAGCATGAGCAATATGG - Intergenic
1107908159 13:45081241-45081263 AAGGGAAATCAATAGGATGAAGG - Intergenic
1108147167 13:47490439-47490461 TATGGAAATTATTAGGAAGATGG + Intergenic
1110039651 13:70736654-70736676 CAGGGTAATAATTAGGAACATGG + Intergenic
1110237730 13:73233989-73234011 AAGGGAAAACATGATGAACAAGG - Intergenic
1110512501 13:76367591-76367613 CAAAGCAATCTTGAGGAAGAAGG + Intergenic
1110898046 13:80781940-80781962 CATGGAAAACATGAAGAAAATGG - Intergenic
1112092567 13:96097161-96097183 CAAGGTAACCATCAGGAAGAAGG - Intronic
1112163607 13:96894658-96894680 GAGGGAAATCATGAGGCACTGGG + Intergenic
1112567959 13:100567424-100567446 CAATGGAATAATGAGGAAGATGG - Intronic
1112712375 13:102144302-102144324 AAGGAAAATCATGGAGAAGATGG - Intronic
1113324898 13:109271623-109271645 CAGCAAAATCATGGGGAAGAAGG + Intergenic
1113565930 13:111319846-111319868 CGGGATACTCATGAGGAAGAAGG - Intronic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114377890 14:22168839-22168861 CAGTAATATCATCAGGAAGACGG - Intergenic
1114753969 14:25237667-25237689 CAGGAAAAGAATGAGGAAGCAGG - Intergenic
1115390830 14:32853155-32853177 CAGGGAAATCAGGTAGGAGAAGG - Intergenic
1116056208 14:39866657-39866679 GAGGGAGAGCAGGAGGAAGAAGG + Intergenic
1117661731 14:58013677-58013699 CAGGGAAAAGATGAGGAAACTGG + Intronic
1117944595 14:61005329-61005351 CAGGGCAATCATGCAGGAGAAGG + Intronic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1118538336 14:66793327-66793349 CAGGGAAAGCACAAAGAAGATGG + Intronic
1119370572 14:74137954-74137976 CAGGTAATTCATTTGGAAGAAGG - Intronic
1119575273 14:75715295-75715317 CAGGGCCCACATGAGGAAGATGG - Intronic
1119950430 14:78738822-78738844 CAGGGAAATAAGAAGGCAGATGG + Intronic
1120111021 14:80556512-80556534 GAGGGAAAAGTTGAGGAAGACGG + Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1202915737 14_GL000194v1_random:170433-170455 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202877011 14_KI270722v1_random:12611-12633 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1123822750 15:24047336-24047358 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1123905923 15:24921283-24921305 CAGGGAATTCGTGAGGATGCAGG + Intronic
1124164822 15:27317097-27317119 CAGGAAAATTATTATGAAGATGG - Intronic
1124569621 15:30850598-30850620 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1124821499 15:33050870-33050892 CATTAAAATAATGAGGAAGAGGG + Intronic
1124889072 15:33715011-33715033 CAAGGGATGCATGAGGAAGAAGG + Intronic
1124955017 15:34354619-34354641 GATGGAAAACAAGAGGAAGAAGG + Exonic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1125423257 15:39525673-39525695 CAGGGCAAATATGAGGAAGGAGG + Intergenic
1125716550 15:41822913-41822935 CAGGGAGAACATGTGGGAGAAGG - Intronic
1126235411 15:46378001-46378023 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126535644 15:49760108-49760130 CAGGGAAATCATGAAGAAAATGG + Intergenic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1129045753 15:72732773-72732795 CAGGTCAATCAGGAGGTAGAGGG + Intronic
1130811295 15:87381356-87381378 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1131292026 15:91114732-91114754 CAGGGAAAGCTTCAGGAAAAGGG + Intronic
1131481619 15:92787197-92787219 CAGAGAATTGATGATGAAGATGG - Intronic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131687405 15:94784675-94784697 CAGTGGAATCATGAGGCACAGGG - Intergenic
1131765193 15:95668358-95668380 CAGGGAAATAATCAGGGAAAAGG - Intergenic
1134814931 16:17198129-17198151 CTGGGAACTCACGAGGCAGAAGG - Intronic
1137503798 16:49032835-49032857 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1138310640 16:56020630-56020652 GAGAAAAATCATCAGGAAGATGG + Intergenic
1139118565 16:63987128-63987150 GAAGGAAATCATGGGGAAAATGG - Intergenic
1139603747 16:68003034-68003056 CACGGAAATCACGGGGAAGATGG - Intronic
1140003742 16:71054294-71054316 GAGGGAAATGATGAGGAAAAAGG - Intronic
1140527047 16:75631699-75631721 CATGGAAATCACGGAGAAGATGG - Exonic
1140615342 16:76656265-76656287 GAGGGAAATTATAAAGAAGAAGG - Intergenic
1140889337 16:79271837-79271859 CAGGGAGGTGATGAGGAAGAAGG + Intergenic
1141050007 16:80752885-80752907 GAGGGAATTCCTCAGGAAGAAGG + Intronic
1141798567 16:86291580-86291602 CAGGGAGTGCATGAGGAAGCTGG + Intergenic
1142057676 16:88009250-88009272 GAGGGAAAGCATTAGGAATATGG + Intronic
1142208934 16:88798414-88798436 ACGGGTGATCATGAGGAAGATGG + Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143865792 17:9922263-9922285 CTTGGAAAAGATGAGGAAGAGGG + Intronic
1144439770 17:15271291-15271313 TAGGGAAAGCAAGAGGGAGAGGG - Intergenic
1144768152 17:17744178-17744200 CTGGGAATTAATGACGAAGAGGG - Intronic
1146069508 17:29667156-29667178 AAGGGAGATCATGATGCAGAAGG - Exonic
1146092846 17:29899276-29899298 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147572246 17:41578599-41578621 AAGAGACAACATGAGGAAGAAGG - Intergenic
1147844136 17:43393104-43393126 CAGGGAAATGAAGTGAAAGATGG - Intergenic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1148336222 17:46843084-46843106 AAGGCACCTCATGAGGAAGAAGG + Intronic
1148383299 17:47216443-47216465 CAAGGAAATGATGGGGAGGAAGG - Intronic
1150023933 17:61651943-61651965 CAGGGGAATGATGAGAATGATGG + Intergenic
1151637522 17:75361418-75361440 CAGGGAAATCCTCAGAAAAATGG + Intronic
1151924104 17:77181189-77181211 CAGGGAGAGCATCAGCAAGAGGG - Intronic
1152049770 17:77963944-77963966 GAGGCAAATAAAGAGGAAGATGG - Intergenic
1152204886 17:78969332-78969354 CAATGAGATCAGGAGGAAGAAGG - Intergenic
1152315219 17:79576398-79576420 CATGAAAATCATGGAGAAGATGG + Intergenic
1153489840 18:5635660-5635682 CAGGGAAGTCATGGTGGAGATGG - Intergenic
1153521970 18:5962238-5962260 CAGGAAGGTCATCAGGAAGAAGG + Intronic
1153542209 18:6167825-6167847 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155380887 18:25220651-25220673 CATGGAGATCATGAGGATAATGG + Intronic
1157016672 18:43723190-43723212 CAGGGAAATCAGGCAAAAGAAGG + Intergenic
1157136198 18:45058305-45058327 CAGTGAAATCATAAGCAATAAGG + Intronic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1158512857 18:58106893-58106915 CAGGAGAATGATGAGGAAGTGGG + Intronic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158880543 18:61775373-61775395 CAGAGATTTCATGATGAAGATGG + Intergenic
1159198349 18:65148445-65148467 CAAAGAAAGCATGAAGAAGAAGG - Intergenic
1160080077 18:75717991-75718013 CAGGAAAAGCGTGAGCAAGAAGG - Intergenic
1160160831 18:76468841-76468863 CAAGGAACTGATGGGGAAGATGG - Intronic
1161480000 19:4505665-4505687 CATTGAGATGATGAGGAAGATGG - Intronic
1162180156 19:8863224-8863246 CAGAGAAATCAGGTAGAAGAGGG + Intronic
1163141693 19:15353689-15353711 CTGGGAAATCATTAGAAAGGAGG - Exonic
1163165105 19:15491400-15491422 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1163415875 19:17186179-17186201 CAGGGACATCATCTGGAACATGG + Intronic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164510027 19:28889282-28889304 CAGGGACAGCATGAGGCAGGAGG - Intergenic
1166381852 19:42358867-42358889 CCGGGAAGTCAGGAAGAAGATGG + Exonic
1166718513 19:44984436-44984458 CAGGGAAGCCCTGTGGAAGAAGG + Intronic
1167214240 19:48153881-48153903 CAGAGAAGCCAAGAGGAAGAAGG - Exonic
1168189347 19:54726557-54726579 CAGGGGACTGAAGAGGAAGATGG + Intronic
1202673664 1_KI270710v1_random:20321-20343 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925824321 2:7832569-7832591 CAGGGAGATCACTAAGAAGAGGG - Intergenic
926117355 2:10221821-10221843 CAGGGTGATGATGATGAAGATGG + Intergenic
927611151 2:24542100-24542122 CATGGAGATCATGACCAAGAAGG + Intronic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
928851188 2:35749122-35749144 CAGGGAAATCAGGAAGGAGAAGG + Intergenic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929618606 2:43332298-43332320 CAAGGAAGTCTTCAGGAAGAGGG - Intronic
930182100 2:48370482-48370504 CAGAGAAATCCTGAAGGAGAAGG - Intronic
930586661 2:53275506-53275528 AATGGAAATCAAGTGGAAGAAGG - Intergenic
930911304 2:56633232-56633254 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
932235519 2:70118086-70118108 GAGGCAAATCATGAGAAAAAGGG + Intergenic
933455779 2:82517440-82517462 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
933550757 2:83772316-83772338 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
936335897 2:111589611-111589633 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
937170889 2:119867420-119867442 CAGTGAGTTCATGAGGAAAAGGG + Intronic
937389699 2:121474263-121474285 CAGGGAAGGCATGAAGAAAATGG + Intronic
937421903 2:121764167-121764189 CATTGAAAACCTGAGGAAGATGG + Intronic
937792941 2:125981656-125981678 CAGGGAAACCATTTGGAAGATGG - Intergenic
939460177 2:142488754-142488776 CAGGGAACTCATGAAGAGGGTGG - Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
940388705 2:153105520-153105542 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
940441700 2:153723451-153723473 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
940474874 2:154149921-154149943 CAGGGAAATCAGGCAGGAGAAGG - Intronic
940667852 2:156630976-156630998 CAGGGCAGTCAGGAGGCAGACGG + Intergenic
940814419 2:158282275-158282297 CAGGGCAATCAGGCAGAAGAAGG + Intronic
941061190 2:160849377-160849399 CAGAGATACCATGAGAAAGAAGG + Intergenic
941306501 2:163875486-163875508 GAGGGAGATCATAAGGAAGATGG - Intergenic
941726782 2:168869354-168869376 CAGGGCAATCAGGCAGAAGAAGG + Intronic
941989533 2:171541440-171541462 CAGGGGTAACATGGGGAAGAGGG + Intronic
942809802 2:179984675-179984697 CAGGAAAATCAGGAGAAAGCTGG + Intronic
942873959 2:180769227-180769249 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943131050 2:183853533-183853555 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943591636 2:189804848-189804870 CAAGGAAAGCATTGGGAAGAAGG - Intronic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
943874209 2:193041745-193041767 CAGAGAAGTCAAGAGGAAAAGGG - Intergenic
943915913 2:193632291-193632313 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
944199141 2:197086758-197086780 CAGGGAAAACATCATTAAGATGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945502006 2:210587754-210587776 GAGGCAAAACATGAGAAAGATGG + Intronic
945533538 2:210985205-210985227 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
946444060 2:219723134-219723156 GAGGTAAATCATTAAGAAGATGG - Intergenic
946552107 2:220813460-220813482 AAGTGAAATTAAGAGGAAGATGG - Intergenic
947243108 2:228017832-228017854 CAGTGAGATCAAGAGGAAGACGG - Exonic
947293749 2:228607016-228607038 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
948286238 2:236787602-236787624 AAGAGAAAAAATGAGGAAGATGG - Intergenic
1169966369 20:11222245-11222267 TAGGGAAAAGATGAGGAAGGGGG + Intergenic
1170220416 20:13936112-13936134 CAGGGAAGTGAAGAGGCAGAGGG - Intronic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1170764658 20:19279700-19279722 CAGGGAAGTCATCAGCAATAGGG - Intronic
1171062965 20:21984292-21984314 CAGGAATATCAGGAGGGAGATGG + Intergenic
1171068426 20:22042453-22042475 CAGGGAAATTAAGAAGGAGAAGG - Intergenic
1171722144 20:28573819-28573841 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1171819460 20:29820855-29820877 CAGGGAAATCAAGCAGGAGATGG + Intergenic
1171898362 20:30832328-30832350 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1171904003 20:30884872-30884894 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1172310889 20:33917697-33917719 CAGGGAGGGCATGAGGAAGTTGG + Intergenic
1174166105 20:48584602-48584624 TAAGGAAAGAATGAGGAAGAAGG - Intergenic
1174172835 20:48627860-48627882 CACGGACATCATGCGGAAGCAGG - Exonic
1176257732 20:64160867-64160889 CAGGTAAATCAACAGAAAGAAGG - Intronic
1176347960 21:5768534-5768556 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176354774 21:5889118-5889140 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176496867 21:7555921-7555943 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1176542281 21:8166604-8166626 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176561232 21:8349649-8349671 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176635089 21:9185080-9185102 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176638276 21:9270053-9270075 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1176723315 21:10410784-10410806 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178116382 21:29421739-29421761 CAGGGCAATCAGGAAGGAGAAGG + Intronic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1178329963 21:31680107-31680129 GAGGGACATCTTGAGGAAGGTGG - Intronic
1179037984 21:37776341-37776363 CAGGGAAATCAGGCAGGAGAAGG - Intronic
1179426553 21:41284061-41284083 CAGGGAAATCAGGAGGTCCAGGG + Intergenic
1179965278 21:44801363-44801385 CAGTGAGAGCTTGAGGAAGAAGG - Intronic
1180295697 22:10932506-10932528 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180304473 22:11063521-11063543 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1180337424 22:11591008-11591030 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1180370698 22:12033354-12033376 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180371590 22:12042887-12042909 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180415062 22:12701730-12701752 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180422318 22:12877550-12877572 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1181641307 22:24201100-24201122 CCAGGAAATCCTGAGGAAGAGGG - Intergenic
1181759688 22:25049571-25049593 CTGGAAACTCAAGAGGAAGAAGG - Intronic
1182926273 22:34128379-34128401 CAGAGAGCTGATGAGGAAGAAGG - Intergenic
1182931604 22:34179707-34179729 CAGGGAAATATTGTGGAAAAGGG + Intergenic
1183601229 22:38841832-38841854 CAGGAAAATAATCAGGAAAAAGG - Intronic
1183721303 22:39563057-39563079 CAGGGCTGTCATGCGGAAGAGGG + Intergenic
1183865767 22:40703009-40703031 GAGATAAATCGTGAGGAAGAGGG - Intergenic
1184340314 22:43882214-43882236 CGGGGACATCTTGAGCAAGAGGG - Intronic
1184584032 22:45435645-45435667 GAGGGAAATCCTTGGGAAGAAGG + Intergenic
1203247221 22_KI270733v1_random:83022-83044 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
949799883 3:7892104-7892126 CAGGGTAGTCATGAGAAATATGG + Intergenic
950141682 3:10620298-10620320 CTGGGAACTCTGGAGGAAGACGG + Intronic
950190713 3:10974399-10974421 CAGGGAAAGCAGGAAGGAGAAGG - Intergenic
951743511 3:25950684-25950706 CATGGAAATCCAGAGGGAGAGGG + Intergenic
951783072 3:26386732-26386754 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
952003059 3:28808976-28808998 CAGGGAAATGATATGGGAGAAGG - Intergenic
952249966 3:31643634-31643656 CAGAGAAATTAGGAGTAAGAAGG - Intergenic
952546856 3:34429734-34429756 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
952612693 3:35229946-35229968 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
952749281 3:36812329-36812351 CAGGCTGATCATGAGGCAGAGGG + Intergenic
953205709 3:40826986-40827008 TAGGGAAATCATCAGGGACAAGG + Intergenic
953225732 3:41017980-41018002 CAGAGAAGTGAAGAGGAAGATGG + Intergenic
953234953 3:41098007-41098029 CAGGGAAAATCTGAGCAAGAAGG - Intergenic
953680799 3:45036550-45036572 CCGGGATGTCCTGAGGAAGAAGG - Intergenic
954323207 3:49846005-49846027 CAGAGAACTCTTGAGGAAGTTGG - Intronic
954987245 3:54806200-54806222 CAGGGCAATCAGGCGGGAGAAGG + Intronic
955625866 3:60918619-60918641 AAAGGAAACCAGGAGGAAGAAGG + Intronic
956412612 3:68994401-68994423 CAGGGAATTGGAGAGGAAGAAGG + Intronic
956513251 3:70017577-70017599 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
956866105 3:73370448-73370470 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
956951185 3:74285126-74285148 TAGGGATATCATGAGGACAAGGG + Intronic
957036744 3:75300635-75300657 CAGGGAAGTTATGATGAAAAAGG - Intergenic
958162602 3:89835857-89835879 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
958545920 3:95550268-95550290 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
959699100 3:109281612-109281634 CCTGGAAATCAGGAGAAAGACGG - Intergenic
959905898 3:111711077-111711099 CAGGAAAAACATGGGAAAGAAGG - Intronic
959940765 3:112078459-112078481 GAGGGAAATGGTGAGGAATATGG + Intronic
960238597 3:115314299-115314321 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
960531453 3:118770088-118770110 CAGAGAACTCATGGGGAAAATGG - Intergenic
960569565 3:119172558-119172580 CAGGAAACTCTGGAGGAAGATGG - Intronic
960839761 3:121945214-121945236 TAGAGAAATGATGAGCAAGAAGG + Intergenic
960902515 3:122566334-122566356 CAGGGCAAGCAAGGGGAAGATGG + Intronic
961080488 3:124023105-124023127 CAGGGAAGTTATGATGAAAAAGG - Intergenic
961714489 3:128849297-128849319 CATGGAAATCATCCCGAAGAAGG - Intergenic
962405238 3:135094659-135094681 GAGGGAAAGCAGGAGGGAGAAGG - Intronic
962449930 3:135504584-135504606 GAGGGAACTCAGGAGGGAGAGGG - Intergenic
963578512 3:147094956-147094978 GAGTGAAATCATGAGTAATATGG - Intergenic
963978862 3:151513618-151513640 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
964408924 3:156378521-156378543 CAGAGAAAGGTTGAGGAAGAAGG - Intronic
964963262 3:162455786-162455808 CAGGGAAATTAGGCAGAAGAAGG + Intergenic
965015165 3:163148470-163148492 CAGGGAAATTAGGCAGAAGAAGG - Intergenic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
965950155 3:174299017-174299039 CAGGGAAGTCTTTGGGAAGAAGG - Intergenic
966677944 3:182609569-182609591 CAGGGAGATTATGAGTGAGATGG - Intergenic
966821636 3:183929495-183929517 CAGGTAAACCAAGAGAAAGAGGG - Intronic
967061908 3:185880128-185880150 CAGGTAAAACATGTGGGAGAGGG + Intergenic
967790733 3:193546285-193546307 TAAGGAAATCATGAGGAATGAGG - Intronic
1202748620 3_GL000221v1_random:134968-134990 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
968740365 4:2326492-2326514 CAAGGCAATCATGAGCAAAAAGG - Intronic
968902210 4:3437060-3437082 CAGGGAAATGCTGGGCAAGAAGG + Intronic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
970326826 4:14934485-14934507 CATGAAAATAATGAGGATGAAGG - Intergenic
970497392 4:16640497-16640519 CTGAGAAATAATGATGAAGAAGG - Intronic
970498961 4:16657330-16657352 CAGGGTAATAATGATGATGATGG - Intronic
970606205 4:17684363-17684385 TAGGGAACTCAGCAGGAAGAAGG + Intronic
970786555 4:19804265-19804287 CAGTAAAATCAAGAGGAAGGAGG - Intergenic
971217356 4:24673648-24673670 CAGGGGAATCATTAGGTTGAAGG + Intergenic
971246397 4:24932768-24932790 CAGGGAAAACATTAGTCAGAGGG + Intronic
971329798 4:25673135-25673157 CAGGGAGAGTATGAGCAAGATGG - Exonic
971375246 4:26050907-26050929 CAGTGGAAGCATGAGGAAGCTGG - Intergenic
972160665 4:36222931-36222953 CAGGGAATTTATGAGGAAGAAGG - Intronic
972176904 4:36419563-36419585 CAGACAAATCCTTAGGAAGATGG + Intergenic
972646600 4:40973788-40973810 CAGGTGAATCCAGAGGAAGATGG - Intronic
972892451 4:43575570-43575592 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
973055732 4:45655318-45655340 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
973228995 4:47820262-47820284 GAGGGAAATAATGAGGGTGAGGG + Intronic
973648536 4:52974167-52974189 CAGGGCAATCAGGAAGGAGAAGG + Intronic
973693888 4:53470487-53470509 CAGGGCAATCAGGAAGGAGAAGG + Intronic
973859313 4:55045415-55045437 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
973860483 4:55059770-55059792 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
974315256 4:60271023-60271045 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
974330036 4:60466425-60466447 CAGGGTAATCAGGCAGAAGAAGG + Intergenic
974475983 4:62380918-62380940 CAGGAAAATCTGGAGAAAGAAGG + Intergenic
975166054 4:71179352-71179374 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
975529094 4:75382254-75382276 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
975529939 4:75389760-75389782 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
975618464 4:76271339-76271361 GAGGGAAATCATGAGCCCGAGGG - Intronic
975662327 4:76700015-76700037 CAGGGAACCCATCAGGAAGCTGG + Intronic
977897034 4:102376745-102376767 CAGGGCAATCAGGTGGGAGAAGG - Intronic
977936848 4:102816126-102816148 AAAGGAATTCATGAGTAAGATGG - Intronic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
977998710 4:103529288-103529310 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
978097973 4:104802909-104802931 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
978231365 4:106404445-106404467 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
978468645 4:109037234-109037256 CAGCTAACTCATGAGAAAGAAGG - Intronic
978856968 4:113404401-113404423 CCAGGTAAACATGAGGAAGATGG + Intergenic
979658626 4:123226205-123226227 CAGGGCAATCAGGAAGGAGAAGG - Intronic
980653364 4:135749817-135749839 CAGAGAAATCAGGAAGGAGAAGG - Intergenic
981605080 4:146531640-146531662 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
982944509 4:161602905-161602927 CAGGAAACTCTTCAGGAAGAAGG + Intronic
983039668 4:162910525-162910547 CAAGGAAATCATGAAAGAGATGG + Intergenic
983100095 4:163614927-163614949 AAGGGAAACCCTGAGGAAGGTGG + Intronic
983687271 4:170425494-170425516 TAAGAAAATGATGAGGAAGATGG + Intergenic
983697026 4:170545120-170545142 TAGGGAAGCCATGAGGAAGAGGG + Intergenic
984177194 4:176434151-176434173 CAGAAAAATCATGATGGAGACGG - Intergenic
984593315 4:181640107-181640129 CAGGGACATCAAGAAGATGAAGG + Intergenic
984911076 4:184674749-184674771 TAAGAAAATCATAAGGAAGAGGG + Intronic
985167938 4:187117372-187117394 AAGGGAAAACATGAGAAAAAAGG + Intergenic
985278012 4:188257700-188257722 CAGTGAAAGCATGAGGATGGGGG - Intergenic
1202753173 4_GL000008v2_random:28465-28487 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1202759072 4_GL000008v2_random:93262-93284 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
987052696 5:14161340-14161362 AAGGGAAACCAGGAAGAAGAGGG - Intronic
987086751 5:14477119-14477141 CAGGTAACTCATGTTGAAGAAGG - Intronic
987207392 5:15641443-15641465 CAGGGAAACCAAGAGGAATGGGG + Intronic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988164684 5:27571302-27571324 AAGGGAAATCATGCATAAGAAGG - Intergenic
989250648 5:39310540-39310562 TGGGGAAATCATGGGGAAAAGGG - Intronic
989843275 5:46108218-46108240 CAGGGTAATCAGGCAGAAGAAGG - Intergenic
989948646 5:50270857-50270879 CAGGGAAATCAGGCAGAAGAAGG + Intergenic
989981707 5:50653760-50653782 CAAGAGAATCAGGAGGAAGAGGG - Intergenic
990678998 5:58220037-58220059 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
990706720 5:58538148-58538170 CAGGGCAATCATGCAGGAGAAGG - Intergenic
990766101 5:59184679-59184701 CAGGGAAAGCATTTGAAAGATGG - Intronic
991115713 5:62952299-62952321 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
991198541 5:63962257-63962279 AAGGGAAGTGAGGAGGAAGAGGG - Intronic
991271952 5:64794582-64794604 AAGGGAAATGGTGGGGAAGACGG + Intronic
992491356 5:77247620-77247642 CAGGGATCTCATGAGGATGAAGG - Intronic
993479162 5:88401576-88401598 CAGAGAAAGCAAGAGGAAAATGG + Intergenic
993540470 5:89143967-89143989 TAGGGAAACAATGAGCAAGATGG + Intergenic
993681490 5:90883959-90883981 GAGGGAAGTAATGAGGAATAAGG - Intronic
994266197 5:97719782-97719804 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
994571944 5:101526728-101526750 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
995276198 5:110280647-110280669 CAGGGAAATCAGGCAGAAGAAGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995569399 5:113463405-113463427 TAGGGTAATCATAAGGGAGATGG + Intronic
995683944 5:114750605-114750627 CTAGGAAATCCTGAGGCAGAAGG - Intergenic
995905091 5:117113788-117113810 CAGGGCAATCATGCAGGAGAAGG - Intergenic
995966727 5:117916562-117916584 CAGGGCAATCATGCAGGAGAAGG - Intergenic
996354580 5:122581605-122581627 CTGGGAAAAAAAGAGGAAGAGGG + Intergenic
996375497 5:122802357-122802379 GAGGGAAATGATGGGGAGGAGGG + Intronic
996400012 5:123052287-123052309 CAGGGAGTACAAGAGGAAGATGG - Intergenic
996477781 5:123940926-123940948 CAAGGAAATCATAAGAAAGAAGG - Intergenic
996831163 5:127742077-127742099 CAGGGAAATAAGGAGTAACAAGG - Intergenic
998736793 5:145151249-145151271 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
1000261381 5:159591699-159591721 CAGGGAAATCATCTGGACCAAGG - Intergenic
1000412893 5:160952203-160952225 CAGGAAAATCAAGTGGAGGAGGG + Intergenic
1000673703 5:164093861-164093883 AAGAGAAAAAATGAGGAAGAGGG - Intergenic
1001427384 5:171632132-171632154 GAGGGAAATCATGATGATGATGG - Intergenic
1002572498 5:180150713-180150735 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1002656531 5:180753240-180753262 CAGGGAAAAGGTGAGCAAGAGGG + Intergenic
1002723284 5:181278849-181278871 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1003752273 6:9072783-9072805 CAGATATGTCATGAGGAAGATGG + Intergenic
1003827377 6:9968028-9968050 CAGGGAAATCAGGCAGGAGAAGG - Intronic
1005237167 6:23778035-23778057 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1005240475 6:23819609-23819631 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1005263556 6:24086987-24087009 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1005390944 6:25332578-25332600 GAGGGACATGTTGAGGAAGAAGG + Intronic
1005946896 6:30602053-30602075 CAGGGACATCATGAGGCCGGTGG + Exonic
1006382582 6:33708509-33708531 CAGGGTGATCATTAGGACGAAGG + Intronic
1007017467 6:38483128-38483150 CAGAGAAATGATGAAGAGGATGG - Intronic
1007421597 6:41723211-41723233 GAGGGAAAGAATGGGGAAGAAGG - Intronic
1008764011 6:54888388-54888410 AAGGGAATTCTTTAGGAAGAAGG - Intronic
1009517184 6:64635316-64635338 CAGGGCAATCAGGCGGGAGAAGG - Intronic
1009659395 6:66591536-66591558 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1009819913 6:68787147-68787169 CAGGGCAATCATGCAGGAGAAGG - Intronic
1010172583 6:72990651-72990673 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1011024711 6:82855073-82855095 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1011193885 6:84763382-84763404 CAGAGAAATCAAGAGGAGAAGGG + Intronic
1013722578 6:113048654-113048676 CAAGTGAATCATGAGGAGGAGGG - Intergenic
1014036855 6:116776744-116776766 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1014344227 6:120247371-120247393 CATGGCAATCATTTGGAAGAAGG - Intergenic
1014487382 6:122016287-122016309 CAGGTCAATCATGGGGAAAATGG - Intergenic
1014565279 6:122941348-122941370 CACGGCAATCATGCAGAAGAAGG - Intergenic
1015083191 6:129253369-129253391 CAGGGAAATGATGAGGGACAGGG - Intronic
1015435892 6:133187782-133187804 AAGGGCACTCATGAGGAACAGGG - Intergenic
1016121553 6:140348363-140348385 CAGGGACAGGATGTGGAAGAGGG + Intergenic
1016584290 6:145666160-145666182 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1017335305 6:153251436-153251458 TAGAGATATCAGGAGGAAGAGGG - Intergenic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1017593658 6:156005340-156005362 CAGGGAAGTGATGGAGAAGATGG - Intergenic
1017600464 6:156075133-156075155 CAGTGAATTAATGATGAAGAGGG - Intergenic
1017921630 6:158877988-158878010 AAGGGAAATAATGAGAAAGATGG - Intronic
1018389342 6:163330554-163330576 AAGGAAAATAATGAGGAAGATGG - Intergenic
1018550768 6:164996138-164996160 CAGCAAAAACATAAGGAAGAGGG + Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019208035 6:170378955-170378977 CAGGCAAATCAGGAGGAGCAAGG + Intronic
1020008983 7:4798403-4798425 CAGAGAAACCCTGGGGAAGAGGG - Intronic
1020645290 7:10807894-10807916 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1021175424 7:17444376-17444398 CAGGAAAACCTTCAGGAAGATGG - Intergenic
1021371006 7:19846733-19846755 CAGAGACAACATGAAGAAGATGG + Intergenic
1021776360 7:24058907-24058929 CAGGCATAGCATGAGGAAGATGG + Intergenic
1022071885 7:26923884-26923906 CAGGAAAATGATGAAGAAGCTGG + Intronic
1022280139 7:28899966-28899988 CAGTGAAATAATCAGAAAGAGGG - Intergenic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1022462992 7:30629379-30629401 CAAGGAGATAAAGAGGAAGAAGG - Intronic
1023075586 7:36479004-36479026 CAGAGCAATCATGAGGCAGGAGG - Intergenic
1023609197 7:41956985-41957007 AAGGGAAACCAGGAGCAAGAGGG + Intergenic
1023702971 7:42911427-42911449 GGGGGAAATCATGAGGCAGCCGG - Intronic
1024316157 7:48018691-48018713 CAGGCAAACCCTGGGGAAGAGGG + Intronic
1024379619 7:48681504-48681526 GAGAGAAATCTTGAGGAAAATGG - Intergenic
1024892732 7:54222247-54222269 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1024901185 7:54320140-54320162 CAGGGAAATCACGCAGGAGAAGG - Intergenic
1024926710 7:54623461-54623483 AAAGCAAATCCTGAGGAAGAGGG + Intergenic
1027362980 7:77428498-77428520 CAGGGAGGTCAAGAGGAAAATGG + Intergenic
1027762112 7:82292250-82292272 CAAGGAAAACATGAGGCAGATGG - Intronic
1028678249 7:93493511-93493533 CAGGGAACTGAAGAGAAAGATGG - Intronic
1028780345 7:94728584-94728606 CATAGTAATGATGAGGAAGAAGG - Intergenic
1030321989 7:108178977-108178999 CAGGGAAATGACAAAGAAGATGG - Intronic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1031204540 7:118740012-118740034 CATGGAAATTGTAAGGAAGAGGG - Intergenic
1031221350 7:118969907-118969929 CATGGAAAGCATGTGGAATAGGG + Intergenic
1032657599 7:133948388-133948410 CAGGGAAATCCAAAAGAAGATGG + Intronic
1032760008 7:134931848-134931870 CATGGAAATCTTGACAAAGAAGG + Intronic
1032949262 7:136888618-136888640 AAGGGGAATCATGAGGCACAGGG - Intronic
1034035913 7:147821802-147821824 TAGGGAAATGATGAGGAATTTGG + Intronic
1034223734 7:149465767-149465789 CAGGGTAGTCATGAAGAAAAAGG + Intergenic
1034371445 7:150601221-150601243 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1036530857 8:9585263-9585285 CATGGAAATCATGACGAAAAAGG + Intronic
1037128103 8:15374233-15374255 CTGGGAAATGCTGAAGAAGAAGG - Intergenic
1037963734 8:23117772-23117794 CAGGGCAGCCATGAGGAAAAGGG - Intergenic
1037981925 8:23260483-23260505 CAGGAAAATCTTGAAGATGAAGG - Intronic
1038014370 8:23501189-23501211 CATGGAAATATTGAGGAAAAGGG + Intergenic
1038207855 8:25485383-25485405 CAGGGAACTCCAGAGTAAGATGG - Intronic
1038846336 8:31233257-31233279 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1039065644 8:33605232-33605254 CAGGTAAATCAGTAGGAAAATGG - Intergenic
1039112831 8:34058913-34058935 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1039628970 8:39088075-39088097 CAGGAAGATGATGAGGATGAAGG - Intronic
1040123348 8:43707078-43707100 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1040376839 8:46833988-46834010 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1040910226 8:52510608-52510630 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1041110089 8:54475662-54475684 CAGGAAAATACTGAGGAAAAAGG + Intergenic
1041385097 8:57292921-57292943 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1041648347 8:60276795-60276817 GAGTGAAATCATAAGAAAGAGGG + Intronic
1042326491 8:67534194-67534216 CAGGGATCTCATGAGTAAGGAGG + Intronic
1042720746 8:71824392-71824414 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043461128 8:80461378-80461400 TAGCTAAATGATGAGGAAGAGGG + Intergenic
1043502295 8:80870236-80870258 CATGGGAATTATGTGGAAGAGGG - Intronic
1043697017 8:83232491-83232513 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1043756711 8:84012477-84012499 AAGGGAACTCTTGAGGCAGAGGG - Intergenic
1043806797 8:84681833-84681855 CAGGGCAATCAGGCGGAAAAAGG - Intronic
1044821864 8:96160642-96160664 CAGAAAACTGATGAGGAAGACGG + Exonic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1045478484 8:102574122-102574144 CAGGGACATCTTGGGAAAGAGGG - Intergenic
1045720155 8:105099863-105099885 CAGGGAGACCTTGAAGAAGAGGG + Intronic
1045799507 8:106086237-106086259 CAGGGAAATGTTGATGCAGATGG - Intergenic
1046031828 8:108791448-108791470 TAGGGATAGCATGAGGAATATGG + Intergenic
1046126394 8:109914110-109914132 GAAGGAAAACATGAGGAATATGG + Intergenic
1047624776 8:126645489-126645511 GAGGGAAATGAAGAGGTAGAGGG - Intergenic
1047799918 8:128298184-128298206 CAGGGTATTAATTAGGAAGAAGG + Intergenic
1048762951 8:137816700-137816722 CAGGGCAATCATGCAGGAGAAGG + Intergenic
1049477016 8:142801589-142801611 CAGCTAAATCAGGAGAAAGATGG + Intergenic
1050347600 9:4707853-4707875 CAGGCAAATCCTGGGAAAGAAGG - Exonic
1050856723 9:10366914-10366936 CAGGATAATGATTAGGAAGAAGG + Intronic
1050893114 9:10850410-10850432 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1050908046 9:11029372-11029394 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1050924581 9:11247979-11248001 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1050927750 9:11287015-11287037 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1050956429 9:11667254-11667276 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1051185662 9:14458514-14458536 CAGGGCAATCATGCAGGAGAAGG + Intergenic
1051790595 9:20797840-20797862 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1051995074 9:23205290-23205312 CAGGGATATCAACAGGAAAAAGG + Intergenic
1052123408 9:24746207-24746229 CAGGAGAATTTTGAGGAAGAAGG - Intergenic
1052295871 9:26895434-26895456 CGGGTGGATCATGAGGAAGATGG + Intergenic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1053885465 9:42642248-42642270 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1054224484 9:62449697-62449719 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1055099795 9:72451735-72451757 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1056187242 9:84147459-84147481 CAAGGAAATGCTGAGGGAGAAGG - Intergenic
1056631664 9:88298664-88298686 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1056909987 9:90690411-90690433 CAGGGAAATCAAGCAGGAGAAGG + Intergenic
1057415739 9:94860638-94860660 TGGGGAGATGATGAGGAAGAGGG + Intronic
1058962169 9:110002008-110002030 CAGGGCAATCAGGAAGGAGAAGG - Intronic
1059427734 9:114231590-114231612 CAGGCAAATCCAGAGGAAGAAGG - Intronic
1059578595 9:115519199-115519221 GAGAGAAATGAGGAGGAAGAAGG - Intergenic
1059693007 9:116703916-116703938 CAGGGCAACAGTGAGGAAGAAGG + Intronic
1059764915 9:117374998-117375020 TAGGGAGATCCAGAGGAAGAAGG - Intronic
1060276105 9:122184036-122184058 CACCAGAATCATGAGGAAGATGG + Intronic
1060336036 9:122724078-122724100 TAGGTACATGATGAGGAAGATGG - Exonic
1060338386 9:122749936-122749958 CAGGTACATGATGAGGAAGATGG - Exonic
1060834690 9:126746131-126746153 GAGAGAAATCATGAGGACTAAGG - Intergenic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1203757870 Un_GL000218v1:152382-152404 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203463554 Un_GL000220v1:66083-66105 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203717258 Un_KI270742v1:165058-165080 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203533959 Un_KI270743v1:13175-13197 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1203651482 Un_KI270751v1:128644-128666 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1186159177 X:6758737-6758759 CAGACAAATCATGTGCAAGATGG + Intergenic
1186313794 X:8347361-8347383 CAGGGATGTTATGAGGAAGTAGG - Intergenic
1188242964 X:27811010-27811032 CTGGGATATCAAGTGGAAGAGGG + Intronic
1188652941 X:32654144-32654166 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1188778329 X:34249877-34249899 CAGGGCAATCATGCAGGAGAAGG - Intergenic
1189623895 X:42874133-42874155 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1189970319 X:46411883-46411905 CAGGGCAATCATGCAGGAGAAGG - Intergenic
1190301852 X:49061679-49061701 CAGGGAGCTTATGAGGAAGTTGG + Intronic
1190762445 X:53447854-53447876 AAGGGAATGCAGGAGGAAGAGGG - Intergenic
1191064906 X:56337640-56337662 CAGGCAAATCAGGAAGGAGAAGG - Intergenic
1191165256 X:57383323-57383345 CAGGGAAATCAGGCAGCAGAAGG + Intronic
1191180803 X:57561510-57561532 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1191899393 X:66025086-66025108 CAAGGAGATGATGAGGATGATGG + Exonic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1192986953 X:76409800-76409822 AAGGGAAGTCCTGGGGAAGATGG + Intergenic
1193059361 X:77188599-77188621 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1193429477 X:81383273-81383295 CAAAGATATCATGATGAAGATGG - Intergenic
1195395408 X:104405219-104405241 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1195977506 X:110543532-110543554 CAAGGAAATAATAAGGAGGAAGG + Intergenic
1195980615 X:110573831-110573853 AAGGGAGATCATGAGAAATATGG - Intergenic
1196005524 X:110833229-110833251 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1197291718 X:124666584-124666606 TAGGGAAATCATGGGAAAGAAGG - Intronic
1197619982 X:128736880-128736902 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1198730308 X:139720977-139720999 GGGGGAAGTCAAGAGGAAGAAGG + Intergenic
1198990254 X:142505661-142505683 CAGGCATTTCATGAGAAAGAAGG - Intergenic
1199784915 X:151096428-151096450 CAGGGAAAGCTTCATGAAGAAGG - Intergenic
1200704741 Y:6432629-6432651 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1200885804 Y:8268242-8268264 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1200952158 Y:8908734-8908756 CAGGCAGATCATGAGGTAAAGGG - Intergenic
1201029370 Y:9732079-9732101 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1201370794 Y:13262005-13262027 AAGTGAAATCATGTAGAAGAGGG - Intronic
1201475142 Y:14373609-14373631 CAGTGAGATCATGAGGGAGCTGG - Intergenic
1201506289 Y:14704153-14704175 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1201552828 Y:15236861-15236883 CAGACAAATCATGGGCAAGATGG + Intergenic
1201750777 Y:17429670-17429692 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1201752626 Y:17449862-17449884 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1202104834 Y:21352464-21352486 CAGGGAAATCAGGCAGGAGAAGG - Intergenic